European guidelines for the universal description of Ig / TCR clonality testing data
|
|
|
- Richard Lawson
- 6 years ago
- Views:
Transcription
1 December 13, rd Scientific Meeting MolecularDiagnostics.be t Elzenveld, Antwerp European guidelines for the universal description of Ig / TR clonality testing data Anton W. Langerak Dept. of Immunology Erasmus M, Rotterdam Molecular diagnostics in leukemia and lymphoma Diagnosis : tumor (= clone of cells) vs. reactive (to infection)? lonality testing via Ig / TR gene rearrangements lassification / prognosis : (clin.) heterogeneity and surivial MRD analysis : monitoring of therapy effectiveness Dept. of Immunology, Erasmus M 1
2 B- and T-cell receptors D IgH IgH D Antigen binding IgL IgL TR TR TR TR D D D79b D79a D3 D3 D3 D3 D3 D3 D3 D3 D3 D3 B-lymphocyte T-lymphocyte T-lymphocyte Dept. of Immunology, Erasmus M (D) recombination as the basis for diversity H DH H s D joining D IgH IgH D D- joining IgL IgL precursor IGH mrna transcription D79b D79a translation D RNA splicing mature IGH mrna Dept. of Immunology, Erasmus M 2
3 Further diversity in DR3 region / junctional region IGH3-21 IGHD3-3 IGH4-1 IGHM IGH3-21 (germline) TGTATTATGTGGAGA TGTATTATGT TGTATTATGTGG TGTATTATGTG TGTATTATGTGGAG TGTATTATG TGTATTATGTGG TGTATTATGTGGA TGTATTAT TGTATTATGTGG TGTATTATGTG TGTATTATGTGGAGA TGTATTATGTG TGTATTA TGTATTATGTG TGTATTATGTGGA junctional region insertion AGG TATGGA GGATG TGAGT AATGA GT GG GATG TTA GGTAG GTAG GGA AG GTA IGHD3-3 (germline) GTATTAGATTTTTGGAGTGGTTATTATA GATTTTTGGAGTGGTTATTATA TTAGATTTTTGGAGTGGTTATTATA TTTTGGAGTGGTTATTATA TATTAGATTTTTGGAGTGGTTAT GATTTTTGGAGTGGTTATTATA TAGATTTTTGGAGTGGTTATTAT TTAGATTTTTGGAGTGGTTATTATA GATTTTTGGAGTGGT ATTAGATTTTTGGAGTGGTTATTATA TTTGGAGTGGTTATTATA ATTAGATTTTTGGAGTGGTTATTATA TATTAGATTTTTGGAGTG GATTTTTGGAGTGGTTATTATA ATTAGATTTTTGGAGTGG GTATTAGATTTTTGGAGTGGTTATTATA insertion GTA GATG GGT GTAGGTA GTAG GGTAAGG GGAG GGTT GATGA GTG GTAG GTAG GGA IGH4-1 (germline) ATATTTGATAT TGATAT TTTGATAT ATATTTGATAT TTTGATAT ATTTGATAT TGATAT TATTTGATAT ATATTTGATAT TTTGATAT ATTTGATAT GATAT TATTTGATAT AT TTTGATAT ATTTGATAT Dept. of Immunology, Erasmus M lonality testing : heterogenous or identical? fluorescent intensity Dept. of Immunology, Erasmus M DNA fragment length 3
4 lonality testing : heterogenous or identical? fluorescent intensity Dept. of Immunology, Erasmus M DNA fragment length dominant peak = clone BIOMED-2 multiplex PR - complementarity of Ig targets DLBL (n=116) FL (n=109) - FR1 67 % - FR1 73 % - FR2 57 % - FR2 76 % - FR3 47 % - FR3 52 % - all FR 77 % - all FR 84 % - IGH + IGK 91 % - IGH + IGK 100 % ~10 % without clonal Ig targets IGK : added value in combination with IGH BIOMED-2, Leukemia
5 BIOMED-2 multiplex PR - complementarity of TR targets peripheral T-NHL NOS AITL (n= 36) (n=45, post review) - TRB 98 % - TRB 89 % - TRG 93 % - TRG 92 % - TRB + TRG 100 % - TRB + TRG 94 % TRB : good target, added value in combination with TRG BIOMED-2, Leukemia 2007 Standardization of Ig/TR clonality testing pre-analytical analytical post-analytical - analytical phase is largely standardized (BIOMED-2 protocol and kits) - pre-analytical phase -material type selection, preservation, sample handling -isolation of nucleic acid (yield, purity, integrity) -PR target selection - post-analytical phase -interpretation (individual PRs, overall) -reporting / advice (integration with other lab or clinical parameters) Overall aim: standardization of pre-analytical and post-analytical phases Main objectives 1. Recommendations for pre- and post-analytical phases 2. Universal guideline for description of Ig / TR clonality testing data 5
6 Standardization of Ig/TR clonality testing oligo poly mono / bi +/- background skewing Dept. of Immunology, Erasmus M Immunobiology is the basis for different Ig/TR clonality patterns Immunobiological condition Examples Expected type of pattern no lymphocytes non-hematopoietic tissue negative w/o background NOTE: non-specific peak(s) paucity of lymphocytes small infiltrate, small sample (minor) peaks, not consistent (e.g. skin) (immune)activation with dominant immune response (multiple) peaks, consistent dominant clones (e.g. infection, autoimmunity) reactive lymphocytes broad immune response (irregular) Gaussian curve (mono)clonal leukemia, lymphoma, clone of unknown significance mono-/bi-allelic 1-2 peaks, NB: competition idem, + polycl bgr. 1-2 peaks + Gaussian curve idem, but mutated (rare) negative 2 ;non-specific peak(s) idem, mutated + polycl bgr Gaussian curve 2 1 Designed to be applicable in >95% of cases 2 In fact this represents a false-negative result 6
7 Multiple signals in Ig/TR clonality testing How to deal with multiple signals / products?? - (mono)clonality (mono)clonal cell population (+/- background) monoallelic 1 product per locus * bi-allelic 2 products per locus * - bi-clonality two clones 2-4 per locus * - oligoclonality multiple clones (>3 products per locus *) - irregular polyclonality incomplete Gaussian distribution - polyclonality diverse, Gaussian / normal distribution * for IGK / TRB double!! Dept. of Immunology, Erasmus M Multiple rearrangements per TRB allele Langerak, Hematopathol 2012, in press 7
8 Multiple signals compatible with one clone TRB configuration tube A + B (-) tube (D-) total G / G D- / G / G / D-1 + D-2 / G D-2 / G D-2 / D-2 / D-1 + D D-2 / -1 + D Langerak, Hematopathol 2012, in press Multiple rearrangements per IGK allele Langerak, Hematopathol 2012, in press 8
9 Guideline on Ig/TR clonality testing data lonality testing = molecular pattern recognition molecular morphology Dept. of Immunology, Erasmus M European guideline on Ig/TR clonality testing data 9
10 European guideline on Ig/TR clonality testing data Guideline development in Europe is a challenge! European guideline on Ig/TR clonality testing data Guideline development in Europe is a challenge! lonality testing is not quantitative common language to score patterns 10
11 Universal description of Ig/TR clonality testing data Objective: standardized description (common language) Two levels 1.) technical description per tube (info for labs); 2.) overall molecular interpretation / conclusion (possibly split out for B / T cells, mentioning studied targets, control gene analysis and test sensitivity) (info for pathologists and/or directly to clinicians) Starting points - should be applicable to both heteroduplex and GeneScan analysis - should focus on ~95% of cases - scientific conceptual basis: type of pattern determined by underlying immunobiology EQA scheme meetings 16 th Eurolonality meeting Kiel (Autumn 2008) 1st EQA round (organised by Kiel; wet lab trial) v1 and v2 scoring system 18 th Eurolonality meeting Noordwijk (Autumn 2009) 2nd EQA round (organised by Southampton; wet lab trial) v3 scoring system 19 th Eurolonality meeting Belfast (Spring 2010) 3rd EQA round (organised by Southampton; e-trial) v4 scoring system 20 th Eurolonality meeting Kiel (Autumn 2010) 4th EQA round (organised by Nijmegen; e-trial) v5 scoring system 21 st Eurolonality meeting Ghent (Spring 2011) 5th EQA round (organised by Rotterdam and Groningen; 50 routine samples) final version scoring system 11
12 Polyclonal TRG - A TRB - B Polyclonal IGH FR1 IGH FR3 12
13 (Irrregular) polyclonal TRB - Monoclonal -/+ polyclonal background IGH FR1 IGH FR1 13
14 Multiple products (reproducible) true oligoclonality TRB - A TRG - A Pseudoclonal 194 nt TRB nt 14
15 onclusions Analytical standardization of Ig / TR assays reached (BIOMED-2) Good interpretation requires technical and immunobiological insight (educational workshops; Recommendations on pre- and post analytical phases needed European guideline for scoring Ig / TR clonality testing data (Langerak et al., in preparation) ommon language is essential for QA schemes on Ig / TR testing Thanks to Erasmus M, Rotterdam Ellen van Gastel Ashley van der Spek Dennis Tielemans Brenda erhaaf oyce ermeulen Ingrid Wolvers acques.m. van Dongen Kiel, Germany Monika Bruggemann Matthias Ritgen Southampton, UK Liz Hodges Sue Harris Nijmegen, Netherlands Patricia Groenen Paul Rombout Groningen, Netherlands Ed Schuuring All other Eurolonality labs 15
NGS immunogenetic analysis in vitro: clonality feasibility study
NGS immunogenetic analysis in vitro: clonality feasibility study ERIC EuroClonality-NGS 1-day workshop Rotterdam, NL, November 24, 2017 Anton W. Langerak, Laboratory for Medical Immunology, Dept. Immunology
Antigen receptor (immunoglobulin and T-cell receptor) gene rearrangements: Utility in Routine Diagnostic Hematopathology
Antigen receptor (immunoglobulin and T-cell receptor) gene rearrangements: Utility in Routine Diagnostic Hematopathology DIAGNÓSTICO PRÁTICO DOS LINFOMAS São Paulo, Brasil 02 DE SETEMBRO DE 2011 Adam Bagg
Basic principles of IG sequence analysis: Immunogenetic analysis: in vitro
IMMUNOGENETICS IN CLL IN THE NGS ERA Rotterdam, The Netherlands, November 24 th 2017 Basic principles of IG sequence analysis: Immunogenetic analysis: in vitro Lesley Ann Sutton Dept. of IGP, Uppsala University,
IgH/TCR Clonality Status. Performance Monitoring Cover Sheet. Final IgH Clonality Result IGH 131. Uncontrolled Copy
Performance Monitoring Cover Sheet Participant No: Trial No: IgH161703 Issue Date: 20 th December 2016 Performance Monitoring: Your Result N Consensus Clonality Result Final IgH Clonality Result IGH 131
EuroClonality/BIOMED-2 guidelines for interpretation and reporting of Ig/TCR clonality testing in suspected lymphoproliferations
Leukemia (212) 26, 2159 2171 & 212 Macmillan Publishers Limited All rights reserved 887-6924/12 www.nature.com/leu REVIEW for interpretation and reporting of Ig/TCR clonality testing in suspected lymphoproliferations
Clonality testing Potentials & Problems
Clonality testing Potentials & Problems For the Biomed 2 group Han van Krieken Nijmegen, the Netherlands EAHP 2010, Uppsala Introduction Clonality testing needs to be based on knowledge of immunology Poly-
From the patient to the sequence : Primers, PCR, Detection of clonality, Sequencing
6th ERIC Educational workshop on IG gene analysis in CLL, Uppsala, SE, Sept 23, 2016 From the patient to the sequence : Primers, PCR, Detection of clonality, Sequencing Anton W. Langerak Dept. of Immunology
bioinformatics: state of art tools for NGS immunogenetics
bioinformatics: state of art tools for NGS immunogenetics Nikos Darzentas, Ph.D. CEITEC MU, Brno, Czech Republic bat.infspire.org nikos.darzentas@gmail.com Ministry of Health of theczech Republic, grant#
NGS-Based Clonality Testing Assessing Clonality Status, Somatic Hypermutation and Monitoring Minimum Residual Disease (MRD)
NGS-Based Clonality Testing Assessing Clonality Status, Somatic Hypermutation and Monitoring Minimum Residual Disease (MRD) Maria Arcila, M.D. Memorial Sloan Kettering Cancer Center Educational Goals Review
Atlas of Genetics and Cytogenetics in Oncology and Haematology. IMMUNOGLOBULIN GENES: CONCEPT OF DNA REARRANGEMENT * Introduction
Atlas of Genetics and Cytogenetics in Oncology and Haematology IMMUNOGLOBULIN GENES: CONCEPT OF DNA REARRANGEMENT * Introduction I Historical questions II Answers II.1 Light chains (kappa or lambda) II.1.1
IMGT-ONTOLOGY and IMGT databases, tools and Web resources for immunoinformatics
IMGT-ONTOLOGY and IMGT databases, tools and Web resources for immunoinformatics Marie-Paule Lefranc Université Montpellier, CNRS First international Immunoinformatics Symposium Yokohama, Japan, 26-27 February
Applications of AmpliSeq-based Ion Torrent TCRB Immune Repertoire Sequencing
Applications of AmpliSeq-based Ion Torrent TCRB Immune Repertoire Sequencing Timothy Looney, PhD Staff Scientist, Clinical Next-Generation Sequencing Division Thermo Fisher Scientific The world leader
Antibody Structure, and the Generation of B-cell Diversity. Chapter 4 5/1/17
Antibody Structure, and the Generation of B-cell Diversity B cells recognize their antigen without needing an antigen presenting cell Chapter 4 Structure of Immunoglobulins Structure and function Immunoglobulin
Applications of the Ion AmpliSeq Immune Repertoire Assay Plus TCRβ
Applications of the Ion AmpliSeq Immune Repertoire Assay Plus TCRβ Timothy Looney, PhD Staff Scientist, Clinical Next-Generation Sequencing Division Thermo Fisher Scientific The world leader in serving
Detection of T-cell clonality in patients with B-cell chronic lymphocytic leukemia
Detection of T-cell clonality in patients with B-cell chronic lymphocytic leukemia Dijana Djureinovic Degree project in biology, Master of science (1 year), 2008 Examensarbete i biologi 30 hp till magisterexamen,
Chapter 2 Hematolymphoid Proliferations of the Skin
Chapter 2 Hematolymphoid Proliferations of the Skin Carlos A. Torres-Cabala, Jonathan L. Curry, Su S. Chen and Roberto N. Miranda Introduction Molecular tests used by practicing pathologists are mostly
Multiple clonal Ig/TCR products: implications for interpretation of clonality findings
DOI 10.1007/s12308-011-0129-1 REVIEW Multiple clonal Ig/TCR products: implications for interpretation of clonality findings Anton W. Langerak & Jacques J. M. van Dongen Received: 30 June 2011 / Accepted:
Detection Limit of Monoclonal B-Cells Using Multiplex PCR and Laser- Induced Fluorescence Capillary Electrophoresis
The Korean Journal of Pathology 2011; 45: 582-588 http://dx.doi.org/10.4132/koreanjpathol.2011.45.6.582 Detection Limit of Monoclonal B-Cells Using Multiplex PCR and Laser- Induced Fluorescence Capillary
Pitfalls in TCR gene clonality testing: teaching cases
DOI 10.1007/s12308-008-0013-9 ORIGINAL ARTICLE Pitfalls in TCR gene clonality testing: teaching cases Patricia J. T. A. Groenen & Anton W. Langerak & Jacques J. M. van Dongen & Johan H. J. M. van Krieken
UNDERSTANDING THE CLONOSEQ ASSAY
FOR HEALTHCARE PROVIDERS UNDERSTANDING THE CLONOSEQ ASSAY Clonality (ID) and Tracking (MRD) Reports clonoseq is an FDA-cleared in vitro diagnostic (IVD) test service provided by Adaptive Biotechnologies
IgH REARRANGEMENTS MOLECULAR ANALYSIS KIT
IgH REARRANGEMENTS MOLECULAR ANALYSIS KIT CAT. Nº MAD-003994BP-2/5 (20 DETERMINATIONS) The diagnosis of malignant lymphomas is one of the most challenging tasks in histopathology. While many cases can
Immunology 2011 Lecture 9 Immunoglobulin Biosynthesis 3 October
Immunology 2011 Lecture 9 Immunoglobulin Biosynthesis 3 October APC Antigen processing (dendritic cells, MΦ et al.) Antigen "presentation" Ag/Ab complexes Antigenspecific triggering B T ANTIGEN Proliferation
Outline. Clonality Targets. Human IGH locus. Human IGK locus. Human TRB locus
Complete Suite of NGS Clonality Assays with Bioinfmatics Identification and Tracking Patient Specific Clones Presha Shah, Ph.D. Development Scientist Outline Part I: LymphoTrack Products What are different
detection limit of cytomorphological techniques detection limit of immunophenotyping and PCR techniques cure follow-up in years
relative frequency of leukemic cells 1 10-1 10-2 10-3 10-4 10-5 10-6 10-7 0 Detection of minimal residual disease (MRD) detection limit of cytomorphological techniques detection limit of immunophenotyping
2111: ALL Post-HCT. Add/ Remove/ Modify. Manual Section. Date. Description. Comprehensive Disease- Specific Manuals
2111: ALL Post-HCT The Acute Lymphoblastic Leukemia Post-HCT Data Form is one of the Comprehensive Report Forms. This form captures ALL-specific post-hct data such as: planned treatments post-hct, the
IMMUNOGLOBULIN GENES UNDERGO TWO DNA REARRANGEMENTS
A Prototype Ig Gene: Murine Kappa About 10 0 V κ gene segments 4 J Gene Segment s 1 C κ Gene Segmen t Multiple V gene segments, distant from J and C A few J gene segments One C gene segment GERMLINE Ig
IMPLEMENTATION OF MICROFLUIDIC CHIP ELECTROPHORESIS FOR THE DETECTION OF B-CELL CLONALITY
CT MEDC MRTNN 2016 16/1 DO: 10.1515/acm-2016-0002 17 MPLEMENTTON OF MCROFLUDC CHP ELECTROPHORESS FOR THE DETECTON OF B-CELL CLONLTY Vazan M 1,2, Kasubova 1,2, Vanochova 1, Lukac P 1,4, Plank L 3, Lasabova
Roche Molecular Biochemicals Technical Note No. LC 12/2000
Roche Molecular Biochemicals Technical Note No. LC 12/2000 LightCycler Absolute Quantification with External Standards and an Internal Control 1. General Introduction Purpose of this Note Overview of Method
T and B cell gene rearrangement October 17, Ram Savan
T and B cell gene rearrangement October 17, 2016 Ram Savan savanram@uw.edu 441 Lecture #9 Slide 1 of 28 Three lectures on antigen receptors Part 1 (Last Friday): Structural features of the BCR and TCR
Immunogenetics. Immunodeficiency
4.05.009 Immune response represents a system of recognition of foreign molecules. Immunogenetics Foreign molecules (proteins, glycoproteins, carbohydrates, ssdna, viruses) or parts of foreign molecules
- Contains an amplification mix for each one of the segments FR1-JH, FR2-JH and FR3-JH, and an internal control for verifying DNA quality.
! The diagnosis of malignant lymphomas is one of the most challenging tasks in histopathology. While many cases can be diagnosed from histomorphological and immunohistochemical data, it is occasionally
BIMM18 Dec 20 th - Flow cytometry in clinical diagnostics
BIMM18 Dec 20 th - Flow cytometry in clinical diagnostics I. B cell leukemia and lymphomas Immunophenotyping as part of the diagnostic work- up of hematologic malignancies offers a rapid and effective
These products are sold FOR RESEARCH USE ONLY; not for use in diagnostic procedures.
Minimal Residual Disease (MRD) testing by Next- Generation Sequencing (NGS) has become an important methodology demonstrating clear potential to optimize therapeutic management of lymphoproliferative diseases.
Attribution: University of Michigan Medical School, Department of Microbiology and Immunology
Attribution: University of Michigan Medical School, Department of Microbiology and Immunology License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution
IMGT Databases and Tools for Immunoglobulin (IG) and T cell receptor (TR) analysis, and for Antibody humanization.
IMGT Databases and Tools for Immunoglobulin (IG) and T cell receptor (TR) analysis, and for Antibody humanization Marie-Paule Lefranc IMGT Founder and Director Professor University Montpellier 2, CNRS,
Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
IMGT, the international ImMunoGeneTics information system.
http://www.imgt.org IMGT, the international ImMunoGeneTics information system http://www.imgt.org Marie-Paule Lefranc IMGT Founder and Director, Professor UM2 and the IMGT team November 28, 2012 IMGT in
Immunoglobulin/T-cell receptor clonality diagnostics
Immunoglobulin/T-cell receptor clonality diagnostics Review 1. Introduction 2. Ig/T-cell receptor clonality detection 3. Standardization of polymerase chain reaction-based clonality testing 4. Pitfalls
Preanalytical Variables in Blood Collection: Impact on Precision Medicine
Preanalytical Variables in Blood Collection: Impact on Precision Medicine Carolyn Compton, MD, PhD Chair, Scientific Advisory Committee, Indivumed GmbH Professor of Life Sciences, ASU Professor of Laboratory
LiquidBiopsy LIQUIDBIOPSY. Automated Rare Template Isolation Platform
LiquidBiopsy LIQUIDBIOPSY Automated Rare Template Isolation Platform Enabling cancer research with highly multiplexed molecular analysis of serially collected blood samples The LiquidBiopsy Platform simplifies
Product Description SALSA MLPA Probemix P438-D2 HLA
Product Description SALSA Probemix P438-D2 HLA To be used with the MLPA General Protocol. Version D2. Catalogue numbers: P438-025R: SALSA MLPA Probemix P438 HLA, 25 reactions. P438-050R: SALSA MLPA Probemix
SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit
SuperTCRExpress TM Human TCR Vβ Repertoire CDR3 Diversity Determination (Spectratyping) and Quantitative Analysis Kit Cat. No. H0521 Size: 2 sets (22 Vβ families/each, with enzymes) H0522 Size: 4 sets
Leukemia (2003) 17, & 2003 Nature Publishing Group All rights reserved /03 $
(2003) 17, 2257 2317 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu LEADING ARTICLE Design and standardization of PCR primers and protocols for detection of clonal
Who pairs with whom? High-throughput sequencing of the human paired heavy and light chain repertoire
Who pairs with whom? High-throughput sequencing of the human paired heavy and light chain repertoire Technical Journal Club September 15 th Christina Müller Background - antibody repertoire is the sum
Antibody Structure. Antibodies
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
Antibody Structure supports Function
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
Chapter 5. Genetic Models. Organization and Expression of Immunoglobulin Genes 3. The two-gene model: Models to Explain Antibody Diversity
Chapter 5 Organization and Expression of Immunoglobulin Genes 3 4 5 6 Genetic Models How to account for: ) Vast diversity of antibody specificities ) Presence of Variable regions at the amino end of Heavy
Course Agenda. Day One
Course Agenda BioImmersion: Biotech for the Non-Scientist A three-day, in-depth course that provides the background required for understanding today s fast-paced biotech marketplace. Beginning with an
Molecular Hematopathology Lymphomas. December 21, 2004
Molecular Hematopathology Lymphomas December 21, 2004 Translocations Small or large fragment of a chromosome fuses with another chromosome The fusion is viable The fusion chromosome is faithfully replicated
chronic leukemia lymphoma myeloma differentiated 14 September 1999 Transformed Pre- Ig Surface Surface Secreted B- ALL Macroglobulinemia Myeloma
Disease Usual phenotype acute leukemia precursor chronic leukemia lymphoma myeloma differentiated Pre- B-cell B-cell Transformed B-cell Plasma cell Ig Surface Surface Secreted Major malignant counterpart
Integration of SCID Screening into the Dutch Newborn Screening Program. Benefits and shortcomings of the available screening assays
Integration of SCID Screening into the Dutch Newborn Screening Program Benefits and shortcomings of the available screening assays SCID screening in USA About half of the states screens half of the newborns
For In Vitro Diagnostic Use. Catalog Number. Reagent Volume. Storage Conditions. Expiration Date. Consult Instructions for Use
Technical Service: Customer Service (US): Customer Service (EU): support@invivoscribe.com sales@invivoscribe.com sales-eu@invivoscribe.com IdentiClone IGH + IGK B-Cell Clonality Assay For Identification
Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
Next Generation Sequencing Activities
Next Generation Sequencing Activities Department of Control and Computer Engineering Politecnico of Turin, Italy Meeting Politecnico of Turin-Ebri Fundation PACIELLO Giulia on Behalf of 2 July 2013 FICARRA
Beth Hutchins, PhD PhRMA ICH Gene Therapy Discussion Group
ICH Considerations on General Principles to Address the Risk of Inadvertent Germline Integration of Gene Therapy Vectors and Current Topics on Gene Therapy in USA Beth Hutchins, PhD PhRMA ICH Gene Therapy
NGS to address ncrna and viruses
NGS to address ncrna and viruses Introduction & TRON Next generation sequencing transcriptomics ncrnas vrna June 30, 2010 John Castle Institute for Translational Oncology and Immunology (TRON) Mainz, Germany
Protocol CRISPR Genome Editing In Cell Lines
Protocol CRISPR Genome Editing In Cell Lines Protocol 2: HDR donor plasmid applications (gene knockout, gene mutagenesis, gene tagging, Safe Harbor ORF knock-in) Notes: 1. sgrna validation: GeneCopoeia
GENETIC BASIS OF ANTIBODY STRUCTURE AND DIVERSITY. Steven J. Norris, Ph.D
GENETIC BASIS OF ANTIBODY STRUCTURE AND DIVERSITY Steven J. Norris, Ph.D Topics I. General principles II. The heavy chain Ig locus and VDJ rearrangement III. Light chain rearrangement. IV. Mechanisms of
Molecular Diagnostics in Hematopathology. Madhuri Ramanathan Ph.D. Ridgewood, New Jersey ASCLS-NJ Spring Seminar April 14, 2016
Molecular Diagnostics in Hematopathology Madhuri Ramanathan Ph.D. Ridgewood, New Jersey ASCLS-NJ Spring Seminar April 14, 2016 Learning Objectives Explain the principles of Molecular Diagnostics Describe
Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL
Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL James Storhoff, Ph.D. Senior Manager, Diagnostic Test Development World Cdx, Boston, Sep. 10th Molecules That
Clonality of the Immunoglobulin Heavy Chain Genes in B Cell Non-Hodgkin Lymphoma Using Semi-Nested PCR
ORIGINAL ARTICLE Tanaffos (2011) 10(2), 25-31 2011 NRITLD, National Research Institute of Tuberculosis and Lung Disease, Iran Clonality of the Immunoglobulin Heavy Chain Genes in B Cell Non-Hodgkin Lymphoma
Structure of IgG and IgM
Structure of IgG and IgM Fig. 5-1 A,B Crystal Structure of Secreted IgG Fig. 5-1 C Structure of an Ig Domain Fig. 5-2 Proteolytic Fragments of IgG (1) Fig. 5-3A Proteolytic Fragments of IgG (2) Fig. 5-3B
Motivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
Recombination Lecture, Dr. Aguilera 2/17/2014
Lymphocytes and Antigen Receptors Thymus T-Cells Lymph nodes Spleen } T+B-cells Paper Presentation: Bone Marrow Stem cells and B-cells Nat. Rev. Immunol. STEM CELL CLP Committed Lymphocyte Precursor T-cells
The generation of lymphocyte antigen receptors (Chapter 5):
The generation of lymphocyte antigen receptors (Chapter 5): 1. Ig Gene Rearrangement (somatic recombination). 2. Ig Somatic Hypermutation. 3. Ig Class Switching 4. T cell Receptor Gene Rearragement 1.
Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze
Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,
Personalized CAR-T Immunotherapy Platform
GLP, GMP, and CLIA-Certified Lab Personalized CAR-T Immunotherapy Platform Accelerate your cancer research and drug discovery Platform Overview 1500 Existing Hybridomas and Antibody Engineering Custom
In Vitro Companion Diagnostic Devices
4 th of Joint Conference of Taiwan and Japan on Medical products regulation In Vitro Companion Diagnostic Devices 2016/12/7 Aoyagi Yumiko Ministry of Health, Labour and Welfare Medical Device Evaluation
IMGT Locus on Focus. ABC Fax Marie-Paule Lefranc
Exp Clin Immunogenet 1998;15:1 7 Received: January 7, 1998 Marie-Paule Lefranc Laboratoire d ImmunoGénétique Moléculaire, CNRS, Université Montpellier II, Montpellier, France IMGT Locus on Focus A New
Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows
Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Stephen Jackson, Ph.D 27 May 2017 The world leader in serving science Key Applications for Genome Editing Research
Illumina Genome Analyzer. Progenika Experience. - Susana Catarino -
Illumina Genome Analyzer Progenika Experience - Susana Catarino - Who are we? 2000 PROGENIKA BIOPHARMA Development, production and commercialization of new genomic tools for diagnosis, prognosis and drug-response
Related SALSA MLPA kits P190 CHEK2: Breast cancer susceptibility, genes included: CHEK2, ATM, BRCA1&2, PTEN, TP53
SALSA MLPA KIT P056-A2 TP53 Lot 1108. One reference probe has been replaced, five probes have a small change in length (but no change in sequence detected) and four extra control fragments at 88-96-100-105
Immunoglobulins Harry W Schroeder Jr MD PhD
Immunoglobulins Harry W Schroeder Jr MD PhD Division of Developmental and Clinical Immunology Departments of Medicine, Microbiology, and Genetics University of Alabama at Birmingham Immunoglobulin Has
ESCMID Online Lecture Library. by author
Molecular diagnostics: when to use (commercial vs in house) Marijke Raymaekers (Belgium) Kate Templeton (UK) Are you mainly using home-brew or commercial assays? In house diagnostics home brew assays Commercial
ImmunoID NeXT. Precision Genomics for Immuno-Oncology. ImmunoID NeXT. The Universal Cancer Immunogenomics Platform
ImmunoID NeXT Precision Genomics for Immuno-Oncology ImmunoID NeXT The Universal Cancer Immunogenomics Platform Personalis, Inc. Advancing Modern Precision Oncology The Universal Cancer Immunogenomics
TCRG TCRA/D IGH IGK/L
Assays immunoseq Assay The inquiry to insight solution for profiling T- and B-cell s Immunosequencing solutions for multiple species and loci Illuminate the adaptive immune system with bias-controlled
Bringing the EuroFlow Concept
Bringing the EuroFlow Concept Cytognos - EuroFlow Supporting Company Company Overview Cytognos provides through worldwide distribution a broad range of reagents and software for flow cytometry applications
TECHNOLOGIES & SERVICES FOR THERAPEUTIC ANTIBODY DEVELOPMENT
Specialist in tissue analysis by Histology, Immunohistochemistry and In Situ Hybridization TECHNOLOGIES & SERVICES FOR THERAPEUTIC ANTIBODY DEVELOPMENT CONTENTS Histalim: who we are Our areas of expertise
Current molecular diagnostic system
LAMP-BART Name: Chris Wong Supervisor: Prof. Margaret Ip Joint Graduate Seminar Department of Microbiology The Chinese University of Hong Kong 18 th December 2012 Current molecular diagnostic system Detection
CHAPTER 24. Immunology
CHAPTER 24 Diagnostic i Microbiology and Immunology Growth-Dependent Diagnostic Methods Isolation of Pathogens from Clinical Specimens Proper sampling and culture of a suspected pathogen is the most reliable
Storage Conditions: -65 C to -85ºC (DNA controls may be separated from assay kits and stored at 2 C to 8 C)
Technical Service: Customer Service (US): Customer Service (EU): support@invivoscribe.com sales@invivoscribe.com sales-eu@invivoscribe.com IdentiClone TCRB + TCRG T-Cell Clonality Assay For Identification
Human sfas Kit v1-2012Sep 1
Human sfas Kit 1-Plate Kit 5-Plate Kit 25-Plate Kit K151KBD-1 K151KBD-2 K151KBD-4 18033-v1-2012Sep 1 MSD Biomarker Assays Human sfas Kit This package insert must be read in its entirety before using this
A comparative analysis of protocols for detection of T cell clonality in formalin-fixed, paraffin-embedded tissue implications for practical use
J Hematopathol (212) 5:7 16 DOI 1.17/s1238-11-128-2 ORIGINAL ARTICLE A comparative analysis of protocols for detection of T cell clonality in formalin-fixed, paraffin-embedded tissue implications for practical
IdentiClone TCRD Gene Clonality Assay For Identification of Clonal T Cell Receptor Delta Chain Gene Rearrangements For In Vitro Diagnostic Use
Technical Service: Customer Service (US): Customer Service (EU): support@invivoscribe.com sales@invivoscribe.com sales-eu@invivoscribe.com IdentiClone TCRD Gene Clonality Assay For Identification of Clonal
CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
Recitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
Representing Errors and Uncertainty in Plasma Proteomics
Representing Errors and Uncertainty in Plasma Proteomics David J. States, M.D., Ph.D. University of Michigan Bioinformatics Program Proteomics Alliance for Cancer Genomics vs. Proteomics Genome sequence
Immunoglobulins. Generation of Diversity
Immunoglobulins Generation of Diversity Unfortunately, for this theory to be true the number of antibody genes would need to be 100-1000-fold greater than the entire human genome Introduction Immunologist
Immunological Techniques
Midterm Extra Office Hours Take Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina,
Molecular Genetics of Disease and the Human Genome Project
9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit
CRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Separations Simply Spectacular INDELS Identify indels Determine if one or both copies of your gene have indels The Guide-it Genotype Confirmation Kit: Simple detection
Mutation entries in SMA databases Guidelines for national curators
1 Mutation entries in SMA databases Guidelines for national curators GENERAL CONSIDERATIONS Role of the curator(s) of a national database Molecular data can be collected by many different ways. There are
Position Description November 2018
Position Description November 2018 MISSION The mission of St Vincent s Institute (SVI) is to carry out the highest quality laboratory based biomedical research, in order to make discoveries that will improve
Roche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
PrimePCR Assay Validation Report
Gene Information Gene Name major histocompatibility complex, class II, DR beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HLA-DRB1 Human HLA-DRB1 belongs
Analytical verification methods for the Oncomine Lung cfdna Assay using the Ion S5 XL System
WHITE PAPER Oncomine Lung cfdna Assay and Ion S5 XL System Analytical verification methods for the Oncomine Lung cfdna Assay using the Ion S5 XL System Key highlights Investigate tumor heterogeneity and
The EORTC Molecular Screening programme SPECTA
The EORTC Molecular Screening programme SPECTA February 2016 Denis Lacombe, MD, MSc EORTC, Director General Brussels, Belgium The changing shape of clinical research Phase I RESOURCES Phase III The changing
Detection of clonality in follicular lymphoma using formalin-fixed, paraffin-embedded tissue samples and BIOMED-2 immunoglobulin primers
1 Department of Pathology, The Gade Institute, Haukeland University Hospital, Bergen, Norway 2 Section for Pathology, The Gade Institute, University of Bergen, Bergen, Norway Correspondence to Professor
Integration of SCID Screening into the Dutch Newborn Screening Program. Benefits and shortcomings of the available screening assays
Integration of SCID Screening into the Dutch Newborn Screening Program Benefits and shortcomings of the available screening assays SCID screening in USA About half of the states screens half of the newborns