Alignment and annotation of forensic STR data generated from MPS analysis: Notes from the sequence workbench

Size: px
Start display at page:

Download "Alignment and annotation of forensic STR data generated from MPS analysis: Notes from the sequence workbench"

Transcription

1 Alignment and annotation of forensic STR data generated from MPS analysis: Notes from the sequence workbench Chris Phillips, Katherine Gettings, Jonathan King, Christophe van Neste, Walther Parson

2 Capillary electrophoresis to sequencing of forensic STRs D12S391: X.3 intermediate

3 Capillary electrophoresis to sequencing of forensic STRs D12S391: [AGAT]a [AGAC]b [AGAT]c

4 Sanger to MPS

5 Sanger to MPS Alleles

6 Sanger to MPS A 19 B C 20 D 91 Alleles E F G H 23 I J

7 STR sequence allele nomenclature guidelines

8 STR sequence allele nomenclature guidelines Outlined 8 practical considerations for analysis of forensic STR data generated by MPS Stated analysis, export and storage of MPS data should be as full sequence strings (as in EMPOP) Recommended sequence alignments use the most up-to-date human genome assembly Suggested a framework for variant annotation with a curated sequence template file (S1) The published sequence template file S1 will be transferred to an FTP site with a change-log MPS STR allele nomenclature needs careful discussions and planning - a broader based project Genomic descriptions of novel STRs require systematic checks too: D5S2500 HDplex AGCU

9 STR sequence allele nomenclature guidelines Outlined 8 practical considerations for analysis of forensic STR data generated by MPS Stated analysis, export and storage of MPS data should be as full sequence strings (as in EMPOP) Recommended sequence alignments use the most up-to-date human genome assembly Suggested a framework for variant annotation with a curated sequence template file (S1) The published sequence template file S1 will be transferred to an FTP site with a change-log MPS STR allele nomenclature needs careful discussions and planning - a broader based project Genomic descriptions of novel STRs require systematic checks too: D5S2500 HDplex AGCU

10 STR sequence allele nomenclature guidelines Outlined 8 practical considerations for analysis of forensic STR data generated by MPS Stated analysis, export and storage of MPS data should be as full sequence strings (as in EMPOP) Recommended sequence alignments use the most up-to-date human genome assembly Suggested a framework for variant annotation with a curated sequence template file (S1) The published sequence template file S1 will be transferred to an FTP site with a change-log MPS STR allele nomenclature needs careful discussions and planning - a broader based project Genomic descriptions of novel STRs require systematic checks too: D5S2500 HDplex AGCU

11 STR sequence allele nomenclature guidelines Outlined 8 practical considerations for analysis of forensic STR data generated by MPS Stated analysis, export and storage of MPS data should be as full sequence strings (as in EMPOP) Recommended sequence alignments use the most up-to-date human genome assembly Suggested a framework for variant annotation with a curated sequence template file (S1) The published sequence template file S1 will be transferred to an FTP site with a change-log MPS STR allele nomenclature needs careful discussions and planning - a broader based project Genomic descriptions of novel STRs require systematic checks too: D5S2500 HDplex AGCU

12 TPOX The repeat motif for each STR marker is listed according to the International Society of Forensic Genetics (ISFG) recommendation that the repeat sequence motif be defined so that the first 50- nucleotides on the GenBank forward strand define the repeat motif used (56) [AATG]a

13 TPOX The repeat motif for each STR marker is listed according to the International Society of Forensic Genetics (ISFG) recommendation that the repeat sequence motif be defined so that the first 50- nucleotides on the GenBank forward strand define the repeat motif used (56) [AATG]a 5 3 rs

14 TPOX The repeat motif for each STR marker is listed according to the International Society of Forensic Genetics (ISFG) recommendation that the repeat sequence motif be defined so that the first 50- nucleotides on the GenBank forward strand define the repeat motif used (56) [AATG]a 5 3 rs Data Slicer Chr Position Ref allele Alt allele Data Slicer

15 STR sequence allele nomenclature guidelines Outlined 8 practical considerations for analysis of forensic STR data generated by MPS Stated analysis, export and storage of MPS data should be as full sequence strings (as in EMPOP) Recommended sequence alignments use the most up-to-date human genome assembly Suggested a framework for variant annotation with a curated sequence template file (S1) The published sequence template file S1 will be transferred to an FTP site with a change-log MPS STR allele nomenclature needs careful discussions and planning - a broader based project Genomic descriptions of novel STRs require systematic checks too: D5S2500 HDplex AGCU

16 STR sequence allele nomenclature guidelines Outlined 8 practical considerations for analysis of forensic STR data generated by MPS Stated analysis, export and storage of MPS data should be as full sequence strings (as in EMPOP) Recommended sequence alignments use the most up-to-date human genome assembly Suggested a framework for variant annotation with a curated sequence template file (S1) The published sequence template file S1 will be transferred to an FTP site with a change-log MPS STR allele nomenclature needs careful discussions and planning - a broader based project Genomic descriptions of novel STRs require systematic checks too: D5S2500 HDplex AGCU oversight group

17 STR sequence allele nomenclature guidelines Outlined 8 practical considerations for analysis of forensic STR data generated by MPS Stated analysis, export and storage of MPS data should be as full sequence strings (as in EMPOP) Recommended sequence alignments use the most up-to-date human genome assembly Suggested a framework for variant annotation with a curated sequence template file (S1) The published sequence template file S1 will be transferred to an FTP site with a change-log MPS STR allele nomenclature needs careful discussions and planning - a broader based project Genomic descriptions of novel STRs require systematic checks too: D5S2500 HDplex AGCU oversight group

18 STR sequence allele nomenclature guidelines Outlined 8 practical considerations for analysis of forensic STR data generated by MPS Stated analysis, export and storage of MPS data should be as full sequence strings (as in EMPOP) Recommended sequence alignments use the most up-to-date human genome assembly Suggested a framework for variant annotation with a curated sequence template file (S1) The published sequence template file S1 will be transferred to an FTP site with a change-log MPS STR allele nomenclature needs careful discussions and planning - a broader based project Genomic descriptions of novel STRs require systematic checks too: D5S2500 HDplex AGCU oversight group

19 MPS analysis of STRs with the CEPH diversity panel Sequenced 27 A-STRs, 24 Y-STRs and 7 X- STRs in the CEPH panel Checked genotyping concordance with CE analysis of the same 944 samples made in 2010 Transferred the reported STR sequences to Excel and aligned under the current human reference sequence at each locus Used simple macros to reverse-compliment when needed and order sequences alphabetically Cross-checked flanking SNPs plus RR and flanking Indels with 1000 Genomes P-III data

20 20 CODIS-A Autosomal STRs Sized alleles from CE CEPH-wide average Heterozygosity of 81.2% D1S1656 D2S1338 D12S391 FGA D18S51 D21S11 D19S433 Sequenced alleles from MPS No sequence variation detected so far D21S11 FGA TH01 VWA D8S1179 D13S317 D7S820 TH01 D16S539 D10S1248 D2S441 D5S818 D22S1045 D3S1358 CSF1PO!0.15!0.1! % -10% -5% 5% 10% 15% TPOX

21 20 CODIS-A Autosomal STRs Sized alleles from CE CEPH-wide average Heterozygosity of 81.2% D1S1656 D2S1338 D12S391 FGA D18S51 D21S11 D19S433 Sequence reads Sequenced alleles from MPS No sequence variation detected so far D21S11 FGA TH01 VWA D8S1179 D13S317 D7S820 TH01 Allele D16S539 D10S1248 D2S441 D5S818 D22S1045 D3S1358 CSF1PO!0.15!0.1! % -10% -5% 5% 10% 15% TPOX

22 Alignment: human genome assemblies follow a set system short p arm 5 The forward strand starts at the first 5 p-arm nucleotide - to the last 3 q-arm nucleotide of each chromosome long q arm 3 CRS rcrs

23 Alignment: human genome assemblies follow a set system short p arm 5 The forward strand starts at the first 5 p-arm nucleotide - to the last 3 q-arm nucleotide of each chromosome long q arm 3 CRS rcrs 14: coordinates map to unique positions

24 Two main current human genome assemblies 5 1:1 GRCh38 (hg38) December 2013 short p arm long q arm 3 CRS rcrs 22:

25 Two main current human genome assemblies 5 1:1 GRCh38 (hg38) December 2013 GRCh37 (hg19) February CRS rcrs 22: :

26 Frequency of new assembly builds 5 GRCh38 (hg38) December 2013 GRCh37 (hg19) February 2009 NCBI 36 (hg18) March 2006 NCBI 35 (hg17) May 2004 NCBI 34 (hg16) July CRS rcrs

27 Ten A-STR repeat descriptions use reverse strand direction D2S1338 [TGCC]a [TTCC]b - STRbase D2S1338 [GGAA]a [GGCA]b - reference genome Coding strand W. Bär, B. Brinkmann, B. Budowle, A. Carracedo, P. Gill, P. Lincoln, DNA recommendations. Further report of the DNA Commission of the ISFH regarding the use of short tandem repeat systems. International Society for Forensic Haemogenetics, Int. J. Legal Med. 110 (1997)

28 Both double Y-STR loci are tandem inversions DYS385 a/b a=[gaaa]p b=[gaaa]q a=[tttc]p b=[gaaa]q [AAAG]a [GTAG]b [GAAG]c [AAAG]d GAAG [AAAG]e [GAAG]f [AAAG]g DYF387S [CTTT]a [CTTC]b [CTTT]c [CTTC]d [CTTT]e CTTC [CTAC]f [CTTT]g (fragment 2 description changes)

29 Both double Y-STR loci are tandem inversions DYS385 a/b a=[gaaa]p b=[gaaa]q a=[gaaa]p b=[tttc]q b a [AAAG]a [GTAG]b [GAAG]c [AAAG]d GAAG [AAAG]e [GAAG]f [AAAG]g DYF387S [CTTT]a [CTTC]b [CTTT]c [CTTC]d [CTTT]e CTTC [CTAC]f [CTTT]g (fragment 2 description changes)

30 GRCh37 and 38 match in 55 of 58 STRs compared so far DYS437, DYS438, DYS439 show sequence differences in their repeat regions between GRCh37 and GRCh Genomes still uses GRCh37 co-ordinates for all sequence and variant data

31 20 CODIS-A Autosomal STRs Sized alleles from CE CEPH-wide average Heterozygosity of 81.2% D1S1656 D2S1338 D12S391 FGA D18S51 D21S11 D19S433 Sequenced alleles from MPS No sequence variation detected so far D21S11 FGA TH01 VWA D8S1179 D13S317 D7S820 TH01 D16S539 D10S1248 D2S441 D5S818 D22S1045 D3S1358 CSF1PO!0.15!0.1! % -10% -5% 5% 10% 15% TPOX

32 D18S51 Reported Sequence (repeat sequence +10 nt) 5 3

33 D18S51 Reported Sequence (repeat sequence +10 nt) 3

34 D18S51 Repeat sequence 10 nt 3

35 D18S51 Repeat sequence 10 nt 3

36 D13S317 Reported Sequence (repeat sequence + 31 nt) 5 3

37 D13S317 Repeat sequence 31 nt

38 D19S433 Reported Sequence (18 nt + repeat sequence = 48 / 16 nt) 5 3

39 D19S433 Reported Sequence (18 nt + repeat sequence = 48 / 16 nt) 5 3

40 D19S433 Reported Sequence (18 nt + repeat sequence = 48 / 16 nt) 5 3

41 D19S nt Repeat sequence of: 48 nt and: 16 nt 5 3

42 D19S nt Repeat sequence of: 48 nt and: 16 nt 5 3

43 How to deal with less or more nucleotides in the analysed repeat region compared to the reference sequence? _

44 How to deal with less or more nucleotides in the analysed repeat region compared to the reference sequence? _

45 Towards a lean form of STR annotation

46 Towards a lean form of STR annotation e.g. D13S A C T G - + A C T G

47 Towards a lean form of STR annotation e.g. D13S A C T G - + A C T G RR start RR stop Anchor nt

48 Towards a lean form of STR annotation e.g. D13S features in a grid of 2,457 (each with 13:x coordinates) = 8%

49 D21S11 is the most challenging STR to describe 23 size alleles > 92 sequence alleles TA TCCATA [TCTA]a [TCTG]b [TCTA]c TA [TCTA]d TCA [TCTA]e TCCATA [TCTA]f 126 nt of reference sequence > 213 nt of all observed positions

50 D21S11 is the most challenging STR to describe RR start 23 size alleles > 92 sequence alleles (4-fold rise in variation) RR stop TA TCCATA [TCTA]a [TCTG]b [TCTA]c TA [TCTA]d TCA [TCTA]e TCCATA [TCTA]f 126 nt of reference sequence > 213 nt of all observed positions ad hoc 11-nt insertion in AFR singleton [TATCTA] [TCTA]N motif not in reference sequence

51 D21S11 is the most challenging STR to describe RR start 23 size alleles > 92 sequence alleles (4-fold rise in variation) RR stop TA TCCATA [TCTA]a [TCTG]b [TCTA]c TA [TCTA]d TCA [TCTA]e TCCATA [TCTA]f [TATCTA] [TCTA]g 126 nt of reference sequence > 213 nt of all observed positions +10 novel nt ad hoc 11-nt insertion in AFR singleton [TATCTA] [TCTA]N motif not in reference sequence

52 Concluding remarks Obtaining the whole sequence string allows more complete annotation of complex Indel and nucleotide re-arrangements at the repeat region as well as the compilation of flanking region variants from a forensic MPS analysis A standard, unified framework of sequence alignment based on the human genome reference assembly will make it easier to regulate and evolve a sequence-based STR allele nomenclature system Definition of the repeat region start and stop nucleotides in the reference sequence is the key step to ensuring backwards compatibility of existing size-allele nomenclature to the next step of assigning names to sequences To facilitate the adoption of standardised alignment and annotation practices for labs collecting population data with MPS, an Excel sequence template file will be published as an FTP file with regular scrutiny, updates and full change-log details. Since publication made 16 annotation changes.

53 Concluding remarks Obtaining the whole sequence string allows more complete annotation of complex Indel and nucleotide re-arrangements at the repeat region as well as the compilation of flanking region variants from a forensic MPS analysis A standard, unified framework of sequence alignment based on the human genome reference assembly will make it easier to regulate and evolve a sequence-based STR allele nomenclature system Definition of the repeat region start and stop nucleotides in the reference sequence is the key step to ensuring backwards compatibility of existing size-allele nomenclature to the next step of assigning names to sequences To facilitate the adoption of standardised alignment and annotation practices for labs collecting population data with MPS, an Excel sequence template file will be published as an FTP file with regular scrutiny, updates and full change-log details. Since publication made 16 annotation changes.

54 Concluding remarks Obtaining the whole sequence string allows more complete annotation of complex Indel and nucleotide re-arrangements at the repeat region as well as the compilation of flanking region variants from a forensic MPS analysis A standard, unified framework of sequence alignment based on the human genome reference assembly will make it easier to regulate and evolve a sequence-based STR allele nomenclature system Definition of the repeat region start and stop nucleotides in the reference sequence is the key step to ensuring backwards compatibility of existing size-allele nomenclature to the next step of assigning names to sequences To facilitate the adoption of standardised alignment and annotation practices for labs collecting population data with MPS, an Excel sequence template file will be published as an FTP file with regular scrutiny, updates and full change-log details. Since publication made 16 annotation changes.

55 Concluding remarks Obtaining the whole sequence string allows more complete annotation of complex Indel and nucleotide re-arrangements at the repeat region as well as the compilation of flanking region variants from a forensic MPS analysis A standard, unified framework of sequence alignment based on the human genome reference assembly will make it easier to regulate and evolve a sequence-based STR allele nomenclature system Definition of the repeat region start and stop nucleotides in the reference sequence is the key step to ensuring backwards compatibility of existing size-allele nomenclature to the next step of assigning names to sequences To facilitate the adoption of standardised alignment and annotation practices for labs collecting population data with MPS, an Excel sequence template file will be published as an FTP file with regular scrutiny, updates and full change-log details. Since publication made 16 annotation changes.

56 It is important that guidelines for any complex task are precise and easy to follow

57 Gràcies Graciñas Eskerrik asko Gracias

58 Gràcies Graciñas Eskerrik asko Gracias

59 Gràcies Graciñas Eskerrik asko Gracias

60 Gràcies Graciñas Eskerrik asko Gracias

61 Gràcies Graciñas Eskerrik asko Gracias

Enhanced Resolution and Statistical Power Through SNP Distributions Within the Short Tandem Repeats

Enhanced Resolution and Statistical Power Through SNP Distributions Within the Short Tandem Repeats Enhanced Resolution and Statistical Power Through SNP Distributions Within the Short Tandem Repeats John V. Planz, Ph.D. Associate Professor, Associate Director UNT Center for Human Identification UNT

More information

Mutations during meiosis and germ line division lead to genetic variation between individuals

Mutations during meiosis and germ line division lead to genetic variation between individuals Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements

More information

Expand your forensics workflow with the Precision ID NGS System for human identification with mtdna, SNP, and STR analysis

Expand your forensics workflow with the Precision ID NGS System for human identification with mtdna, SNP, and STR analysis Expand your forensics workflow with the Precision ID NGS System for human identification with mtdna, SNP, and STR analysis Integrate NGS into your forensic DNA lab workflow The Applied Biosystems Precision

More information

Advances and New Technologies in Forensic DNA

Advances and New Technologies in Forensic DNA Advances and New Technologies in Forensic DNA Nader Pourmand, PhD Department of Biomolecular Engineering, University of California, Santa Cruz Branch Migratio 3 nbp 6 3 5 3 5 bp 14 bp 23 5 3 5 3 5 Bioluminescence

More information

Short Tandem Repeat (STR) Analysis

Short Tandem Repeat (STR) Analysis Maj Gen (R) Suhaib Ahmed, HI (M) Short tandem repeats (STR) are randomly distributed DNA sequences in which 2-6bp are tandemly repeated. These are scattered on all chromosomes including the autosomes as

More information

Get more information from challenging samples with next-generation sequencing of short tandem repeats

Get more information from challenging samples with next-generation sequencing of short tandem repeats brand bar placeholder APPLICATION NOTE Precision ID NGS System Get more information from challenging samples with next-generation sequencing of short tandem repeats In this application note, we demonstrate:

More information

Forensic Applications of CE and MPS

Forensic Applications of CE and MPS Forensic Biology Polymorphic Enzyme Single Locus PCR RFLP Massively Parallel Sequencing (MPS) Ion Chef System Ion S5 System Ion Chef System Prepare barcoded DNA libraries with Applied Biosystems Precision

More information

Development of New STRs for Forensic Casework: Criteria for Selection, Sequencing & Population Data and Forensic Validation

Development of New STRs for Forensic Casework: Criteria for Selection, Sequencing & Population Data and Forensic Validation Sequencing & Population Data and Forensic Validation Angel Carracedo and M.V. Lareu Institute of Legal Medicine. University of Santiago de Compostela, Spain ½¾½¾½¾½¾½¾½¾½¾½¾½¾½¾½¾½¾½¾½¾½¾ 1. INTRODUCTION

More information

Genetic Identity. Steve Harris SPASH - Biotechnology

Genetic Identity. Steve Harris SPASH - Biotechnology Genetic Identity Steve Harris SPASH - Biotechnology Comparison of Organisms ORGANISM GENES BASE PAIRS Lambda Phage 40 50,000 E.coli 400 5,000,000 Yeast 13,000 15,000,000 Human 20,000 3,000,000,000 (3 billion)

More information

Jennifer D. Churchill, Maiko Takahashi, Christina Strobl, Dixie Peters, Christina Capt, Walther Parson, Bruce Budowle

Jennifer D. Churchill, Maiko Takahashi, Christina Strobl, Dixie Peters, Christina Capt, Walther Parson, Bruce Budowle Validation of a Massively Parallel Sequencing Workflow for Mitochondrial DNA Analysis at UNTHSC Center for Human Identification for Missing Persons and Traditional Casework Analyses Jennifer D. Churchill,

More information

EUROPEAN DNA PROFILING GROUP (EDNAP) MEETING

EUROPEAN DNA PROFILING GROUP (EDNAP) MEETING EUROPEAN DNA PROFILING GROUP (EDNAP) MEETING BLED, SLOVENIA 26 27 APRIL 2006 Host: Aleksander Regent Chairman: A list of participants is attached. Welcome Aleksander Regent welcomed members to Bled. Update

More information

AmpFlSTR Identifiler PCR Amplification Kit

AmpFlSTR Identifiler PCR Amplification Kit Product Bulletin Human Identification AmpFlSTR Identifiler PCR Amplification Kit Fifteen STR (short tandem repeat) loci and Amelogenin co-amplified in a single tube Incorporation of the same proven, reliable

More information

STR Profiling Matching Criteria: Establishment and Importance of a Cell Line Database

STR Profiling Matching Criteria: Establishment and Importance of a Cell Line Database STR Profiling Matching Criteria: Establishment and Importance of a Cell Line Database Margaret Kline Applied Group Biochemical Science Division Chemical Science and Technology Laboratory National Institute

More information

Multiplex analysis of 19 STR loci plus Amelogenin. User manual

Multiplex analysis of 19 STR loci plus Amelogenin. User manual Multiplex analysis of 19 STR loci plus Amelogenin Page 1 of 18 Table of Content 1 Product Information.3 1.1 Product Description 3 1.2 Ordering Information and Kit Components 5 1.3 Storage Conditions..5

More information

Training on STR Typing Using Commercial Kits and ABI 310/3100

Training on STR Typing Using Commercial Kits and ABI 310/3100 Training on STR Typing Using Commercial Kits and ABI 310/3100 Margaret C. Kline, Janette W. Redman, John M. Butler National Institute of Standards and Technology October 22-26, 2001 Human Identity Testing

More information

Part A for Using genetic data in the Add Health Sample

Part A for  Using genetic data in the Add Health Sample Part A for email Using genetic data in the Add Health Sample Andrew Smolen and Brett Haberstick Institute for Behavioral Genetics, University of Colorado at Boulder Add Health Users Workshop, July 2010

More information

PowerSeq 46GY System Eases the transition to MPS for forensic laboratories

PowerSeq 46GY System Eases the transition to MPS for forensic laboratories PowerSeq 46GY Eases the transition to MPS for forensic laboratories The Power to Solve...from Sample to Analysis Coming Soon! The Power to Solve... from Sample to Analysis The Promega PowerSeq s enable

More information

Product Catalog 2012 AmplGen Ltd.

Product Catalog 2012 AmplGen Ltd. Professional solutions for Genetic Human Identification and Molecular Diagnostics Product Catalog 2012 AmplGen Ltd. Riga, Lativa 2 Catalog AmplGen 2012, ver. #02 Dear colleagues, AmplGen is new European

More information

Overview of the Ibis STR Assay

Overview of the Ibis STR Assay Thomas Hall, Ph.D. Overview of the Ibis STR Assay Outline Ibis STR assay format Primer design Database Assay layout Sample analysis Comparison to tradi/onal STR analysis Measures intrinsic property of

More information

Mathematics of Forensic DNA Identification

Mathematics of Forensic DNA Identification Mathematics of Forensic DNA Identification World Trade Center Project Extracting Information from Kinships and Limited Profiles Jonathan Hoyle Gene Codes Corporation 2/17/03 Introduction 2,795 people were

More information

What is DNA? Deoxyribonucleic Acid The inherited genetic material that makes us what we are

What is DNA? Deoxyribonucleic Acid The inherited genetic material that makes us what we are DNA Basic Genetics What is DNA? DNA is Deoxyribonucleic Acid The inherited genetic material that makes us what we are DNA in the Cell Human Genome ~3 billion base pairs of DNA 30,000-35,000 genes Population-each

More information

FORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence

FORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence FORENSIC GENETICS FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS Establishing human corpse identity Crime cases matching suspect with evidence Paternity testing, even after

More information

If you have any queries or problems, please do not hesitate to contact us.

If you have any queries or problems, please do not hesitate to contact us. GEDNAP c/o Institut für Forensische Genetik GmbH Im Derdel 8 48161 Münster September 15, 2017 GEDNAP 54 & 55 Dear colleague, Please find enclosed the samples for the GEDNAP Proficiency Tests 54 and 55,

More information

If you have any queries or problems, please do not hesitate to contact us.

If you have any queries or problems, please do not hesitate to contact us. GEDNAP c/o Institut für Forensische Genetik GmbH Im Derdel 8 48161 Münster June 15, 2018 GEDNAP 56 & 57 Dear colleague, Please find enclosed the samples for the GEDNAP Proficiency Tests 56 and 57, and

More information

Understanding PCR. Total allelic product Peak height Back stutter Forward stutter Variability in peak height

Understanding PCR. Total allelic product Peak height Back stutter Forward stutter Variability in peak height Understanding PCR Total allelic product Peak height Back stutter Forward stutter Variability in peak height 1 Total allelic product (TAP) Total allelic product, T a = height of allele plus height of stutter

More information

Multiplex analysis of 10 STR loci plus Amelogenin

Multiplex analysis of 10 STR loci plus Amelogenin Multiplex analysis of 10 STR loci plus Amelogenin Page 1 of 15 Table of Content 1 Product Information.3 1.1 Product Description 3 1.2 Ordering Information and Kit Components 5 1.3 Storage Conditions..5

More information

Internal Validation of the Promega PowerPlex Fusion System with the Applied Biosystems 3130xl Genetic Analyzer

Internal Validation of the Promega PowerPlex Fusion System with the Applied Biosystems 3130xl Genetic Analyzer Internal Validation of the Promega PowerPlex Fusion System with the Applied Biosystems 3130xl Genetic Analyzer Roy Al Ahmar, B.S. Marshall University Forensic Science Center DNA Laboratory Overview What

More information

Laboratory Exercise 4. Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis.

Laboratory Exercise 4. Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis. Laboratory Exercise 4 4 Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis B A C K G R O U N D The human genome contains over 3000 million base pairs, which are distributed

More information

DNA typing of human cell lines: historical perspective Yvonne Reid, PhD Collection/Research Scientist ATCC Cell Biology

DNA typing of human cell lines: historical perspective Yvonne Reid, PhD Collection/Research Scientist ATCC Cell Biology DNA typing of human cell lines: historical perspective Yvonne Reid, PhD Collection/Research Scientist ATCC Cell Biology Outline Molecular techniques for the authentication of human cell lines Mechanism

More information

Notice of Amendment of the FBI s STR Population Data Published in 1999 and 2001

Notice of Amendment of the FBI s STR Population Data Published in 1999 and 2001 Notice of Amendment of the FBI s STR Population Data Published in 1999 and 2001 Recently, new amplification kits that expand the number of loci in a multiplex reaction have become commercially available.

More information

Report of Analyzing Short Tandem Repeats for Parentage Testing

Report of Analyzing Short Tandem Repeats for Parentage Testing 1 Alex Michael Tseng Department of Forensic Medicine, College of Medicine, National Taiwan University Report of Analyzing Short Tandem Repeats for Parentage Testing Introduction In the three billion letter

More information

The state of Illinois has a grand tradition of corrupt politicians (Re: Former governor Rod Blagojevich.)

The state of Illinois has a grand tradition of corrupt politicians (Re: Former governor Rod Blagojevich.) Biology 321 May 20, 2011 DNA fingerprinting The state of Illinois has a grand tradition of corrupt politicians (Re: Former governor Rod Blagojevich.) 1 2 Innocence Project http://www.innocenceproject.org/know/

More information

Validation of Identity and Ancestry SNP Panels for the Ion PGM

Validation of Identity and Ancestry SNP Panels for the Ion PGM Validation of Identity and Ancestry SNP Panels for the Ion PGM Christopher Phillips, Carla Santos, Maria de la Puente, Manuel Fondevila, Ángel Carracedo, Maviky Lareu Forensic Genetics Unit, University

More information

Sequence data of six unusual alleles at SE33 and D1S1656 STR Loci

Sequence data of six unusual alleles at SE33 and D1S1656 STR Loci Article Sequence data of six unusual alleles at SE33 and D1S1656 STR Loci Alsafiah, Hussain Mohammed, Iyengar, Arati, Hadi, Ss, Alshlash, Waleed M. and Goodwin, William H Available at http://clok.uclan.ac.uk/23651/

More information

Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows

Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Stephen Jackson, Ph.D 27 May 2017 The world leader in serving science Key Applications for Genome Editing Research

More information

Sequence variation in the short tandem repeat system SE33 discovered by next generation sequencing

Sequence variation in the short tandem repeat system SE33 discovered by next generation sequencing Sequence variation in the short tandem repeat system SE33 discovered by next generation sequencing Eszter Rockenbauer, MSc, PhD and Line Møller, MSc Forensic Geneticist Section of Forensic Genetics Department

More information

Development of a Global STR Multiplex for Human Identification Analysis

Development of a Global STR Multiplex for Human Identification Analysis Development of a Global STR Multiplex for Human Identification Analysis Jonathan Tabak Life Technologies 1 Agenda Introduction Multiplex Configuration Strategy Application-Specific Development and Testing

More information

Allele frequencies for 12 autosomal short tandem repeat loci in two bolivian populations

Allele frequencies for 12 autosomal short tandem repeat loci in two bolivian populations Allele frequencies for 12 autosomal short tandem repeat loci in two bolivian populations L. Cifuentes 1, H. Jorquera 2, M. Acuña 1, J. Ordóñez 2 and A.L. Sierra 4 1 Programa de Genética Humana, ICBM, Facultad

More information

DNA Typing for the Identification of Korean War Victims

DNA Typing for the Identification of Korean War Victims DNA Typing for the Identification of Korean War Victims Kyoung-Jin Shin, D.D.S., Ph.D. Department of Forensic Medicine Yonsei University College of Medicine Korean War (1950-1953) Military conflict between

More information

The Evolution of Short Tandem Repeat (STR) Multiplex Systems

The Evolution of Short Tandem Repeat (STR) Multiplex Systems Ann M. Lins, Cynthia J. Sprecher, Katherine A. Micka, Dawn R. Rabbach, Jennifer A. Taylor, Jeffrey W. Bacher, Laura F. Hennes, Allan Tereba, Trent Gu, Elizabeth A. Amiott, Nadine A. Nassif and James W.

More information

From Genetics to Genomics European Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal Investigations

From Genetics to Genomics European Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal Investigations From Genetics to Genomics European Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal Investigations Peter M. Schneider Institute of Legal Medicine University of Cologne

More information

Sequence structure of 12 novel Y chromosome microsatellites and PCR amplification strategies

Sequence structure of 12 novel Y chromosome microsatellites and PCR amplification strategies International Congress Series 1239 (2003) 425 429 Sequence structure of 12 novel Y chromosome microsatellites and PCR amplification strategies Anna González-Neira a, Paula Sánchez-Diz a, Leonor Gusmão

More information

Fast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing:

Fast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing: Fast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing: Patented, Anti-Correlation Technology Provides 99.5% Accuracy & Sensitivity to 5% Variant Knowledge Base and External Annotation

More information

Developing criteria and data to determine best options for expanding the core CODIS loci

Developing criteria and data to determine best options for expanding the core CODIS loci RESEARCH Open Access Developing criteria and data to determine best options for expanding the core CODIS loci Jianye Ge, Arthur Eisenberg and Bruce Budowle * Abstract Background: Recently, the Combined

More information

Genome 373: Mapping Short Sequence Reads II. Doug Fowler

Genome 373: Mapping Short Sequence Reads II. Doug Fowler Genome 373: Mapping Short Sequence Reads II Doug Fowler The final Will be in this room on June 6 th at 8:30a Will be focused on the second half of the course, but will include material from the first half

More information

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Colin Dewey cdewey@biostat.wisc.edu Spring 2012 1. Understanding Human Genetic Variation

More information

Microsatellite markers

Microsatellite markers Microsatellite markers Review of repetitive sequences 25% 45% 8% 21% 13% 3% Mobile genetic elements: = dispersed repeat included: transposition: moving in the form of DNA by element coding for transposases.

More information

Procedure for GeneMapper ID-X for Casework

Procedure for GeneMapper ID-X for Casework Procedure for GeneMapper ID-X for Casework 1.0 Purpose-This procedure specifies the steps for performing analysis on DNA samples amplified with AmpFlSTR Identifiler Plus using the GeneMapper ID-X (GMID-X)

More information

Implementation of MPS into a Specialist Casework Laboratory. David Ballard

Implementation of MPS into a Specialist Casework Laboratory. David Ballard Implementation of MPS into a Specialist Casework Laboratory David Ballard DNA Evidence to Investigative Insights Berlin, 16 Outline ForenSeq STR Validation SNP Validation Relationship/Identification Specialist

More information

DNA 101. DNA 101:Kate Philpott and Jennifer Friedman

DNA 101. DNA 101:Kate Philpott and Jennifer Friedman DNA 101 DNA 101:Kate Philpott and Jennifer Friedman DNA found in cells of your body cell nucleus DNA Found in cells once they leave your body too CONSIDER THE SOURCE Blood* Semen* Hair Bone Saliva* Urine*

More information

SeqStudio Genetic Analyzer

SeqStudio Genetic Analyzer SeqStudio Genetic Analyzer Optimized for Sanger sequencing and fragment analysis Easy to use for all levels of experience From a leader in genetic analysis instrumentation, introducing the new Applied

More information

Procedure for GeneMapper ID-X for Casework

Procedure for GeneMapper ID-X for Casework Procedure for GeneMapper ID-X for Casework 1.0 Purpose-This procedure specifies the steps for performing analysis on DNA samples amplified with AmpFlSTR Identifiler Plus using the GeneMapper ID-X (GMID-X)

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

!"!"!"!"!"!"!"!"!"!"!"!"!"!"!"!"!"!"!"!"!"!"!"!"!"!"!"

!!!!!!!!!!!!!!!!!!!!!!!!!!! STR ANALYSIS BY CAPILLARY ELECTROPHORESIS: DEVELOPMENT OF INTERPRETATION GUIDELINES FOR THE PROFILER PLUS AND COFILER SYSTEMS FOR USE IN FORENSIC SCIENCE Deborah Hobson, Jill Smerick, and Jenifer Smith

More information

DNA Mixture Interpretation Workshop Michael D. Coble, PhD. Current SWGDAM Guidelines

DNA Mixture Interpretation Workshop Michael D. Coble, PhD. Current SWGDAM Guidelines DNA Mixture Interpretation Workshop Michael D. Coble, PhD Current SWGDAM Guidelines Hierarchy of Rules for Forensic DNA Labs Validation Audits United States FBI (DAB) Quality Assurance Standards NDIS Procedures

More information

EUROPEAN DNA PROFILING GROUP (EDNAP) MEETING

EUROPEAN DNA PROFILING GROUP (EDNAP) MEETING EUROPEAN DNA PROFILING GROUP (EDNAP) MEETING ROME, ITALY 12 13 SEPTEMBER 2007 Host: Alberto Intini and Renato Biondo. Chairman: Niels Morling. A list of participants is attached. Welcome Alberto Intini

More information

Linking Genetic Variation to Important Phenotypes

Linking Genetic Variation to Important Phenotypes Linking Genetic Variation to Important Phenotypes BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under

More information

Developmental Validation of Amplicon Rx, a post-pcr Purification System

Developmental Validation of Amplicon Rx, a post-pcr Purification System Developmental Validation of Amplicon Rx, a post-pcr Purification System Introduction Allelic drop out and allele peaks below analytical threshold are common observation in forensic DNA analysis. These

More information

Mentype Nonaplex I PCR Amplification Kit

Mentype Nonaplex I PCR Amplification Kit Mentype Nonaplex I PCR Amplification Kit Product description The Mentype Nonaplex I PCR Amplification Kit is a multiplex application for the Short Tandem Repeat (STR) loci, which belong to the German Forensic

More information

Procedure for Casework DNA Interpretation

Procedure for Casework DNA Interpretation Procedure for Casework DNA Interpretation 1.0 Purpose The purpose of this document is to provide guidelines for the interpretation of autosomal DNA results when amplified with Identifiler Plus. 2.0 Scope

More information

SNP calling and VCF format

SNP calling and VCF format SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide

More information

Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications

Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications Ranajit Chakraborty, Ph.D. Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications Overview Some brief remarks about SNPs Haploblock structure of SNPs in the human genome Criteria

More information

In the course of this work, thousands

In the course of this work, thousands RESULTS AND DISCUSSION OF STR ANALYSIS BY MASS SPECTROMETRY In the course of this work, thousands of data points were collected using STR markers of forensic interest verifying that GeneTrace s mass spectrometry

More information

The injection of the 28 and 29 PCR cycle data was performed at 3kV for 10 and 5 seconds.

The injection of the 28 and 29 PCR cycle data was performed at 3kV for 10 and 5 seconds. TECHNICAL NOTE Evaluation of a decreased cycle number (28 cycles) and decreased injection time (5 seconds) when the GlobalFiler PCR Amplification Kit is run on a 3130xl Genetic Analyzer The performance

More information

DNA Expert Witness. Nuclear DNA 10/23/14. Adams County Bar Association. DNA found in the nucleus of the cell is called nuclear DNA.

DNA Expert Witness. Nuclear DNA 10/23/14. Adams County Bar Association. DNA found in the nucleus of the cell is called nuclear DNA. Adams County Bar Association DNA Expert Witness Jenifer Smith, PhD Forensic Science Program Eberly College of Science Adams County Bench Bar Conference 10/31/14 Nuclear DNA DNA found in the nucleus of

More information

Chapter 5. Structural Genomics

Chapter 5. Structural Genomics Chapter 5. Structural Genomics Contents 5. Structural Genomics 5.1. DNA Sequencing Strategies 5.1.1. Map-based Strategies 5.1.2. Whole Genome Shotgun Sequencing 5.2. Genome Annotation 5.2.1. Using Bioinformatic

More information

AmpF STR NGM PCR Amplification Kit - Overview

AmpF STR NGM PCR Amplification Kit - Overview AmpF STR NGM PCR Amplification Kit - Overview The most advanced STR kits optimized for analysis of forensic casework and database samples in Europe Data Quality Worth Sharing! 9/7/2011 Life Technologies

More information

Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4

Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 WHITE PAPER Oncomine Comprehensive Assay Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 Contents Scope and purpose of document...2 Content...2 How Torrent

More information

Mentype Nonaplex I PCR Amplification Kit

Mentype Nonaplex I PCR Amplification Kit Mentype Nonaplex I PCR Amplification Kit Instructions for use The Mentype Nonaplex I PCR Amplification Kit is a multiplex application for the Short Tandem Repeat (STR) loci, which belong to the German

More information

The Human Genome and its upcoming Dynamics

The Human Genome and its upcoming Dynamics The Human Genome and its upcoming Dynamics Matthias Platzer Genome Analysis Leibniz Institute for Age Research - Fritz-Lipmann Institute (FLI) Sequencing of the Human Genome Publications 2004 2001 2001

More information

Overview. Background ~30 min. Lab activity ~50 min. DNA profiling Polymerase Chain Reaction (PCR) Gel Electrophoresis PCR

Overview. Background ~30 min. Lab activity ~50 min. DNA profiling Polymerase Chain Reaction (PCR) Gel Electrophoresis PCR Overview Day 1: Tuesday Introduction to DNA profiling How do we use DNA to solve crimes? Background Polymerase Chain Reaction (PCR) Gel Electrophoresis Set up PCR Day 2: Wednesday Make and Run Agarose

More information

Human genome sequence February, 2001

Human genome sequence February, 2001 Computational Molecular Biology Symposium March 12 th, 2003 Carnegie Mellon University Organizer: Dannie Durand Sponsored by the Department of Biological Sciences and the Howard Hughes Medical Institute

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

POPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the

POPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the POPULATION GENETICS POPULATION GENETICS studies the genetic composition of populations and how it changes with time. It includes the study of forces that induce evolution (the change of the genetic constitution)

More information

John M. Butler and Peter M. Vallone National Institute of Standards and Technology

John M. Butler and Peter M. Vallone National Institute of Standards and Technology DNA Biometrics: i Standards and Technology John M. Butler and Peter M. Vallone National Institute of Standards and Technology NDIA Biometrics Conference (Arlington VA) NDIA Biometrics Conference (Arlington,

More information

ANNUAL REPORT SUMMARY FOR TESTING IN 2001 Prepared by the Parentage Testing Program Unit October 2002

ANNUAL REPORT SUMMARY FOR TESTING IN 2001 Prepared by the Parentage Testing Program Unit October 2002 ANNUAL REPORT SUMMARY FOR TESTING IN 2001 Prepared by the Parentage Testing Program Unit October 2002 PREFACE This year s annual report continues the past precedent of providing basic summary statistics

More information

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR

Human Genetic Variation. Ricardo Lebrón Dpto. Genética UGR Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.

More information

Generating Forensic DNA Profiles

Generating Forensic DNA Profiles Wright State University CORE Scholar Biological Sciences Faculty Publications Biological Sciences 12-2012 Generating Forensic DNA Profiles Dan E. Krane Wright State University - Main Campus, dan.krane@wright.edu

More information

DNA FINGERPRINTING MADE EASY FOR FORENSICS

DNA FINGERPRINTING MADE EASY FOR FORENSICS DNA FINGERPRINTING MADE EASY FOR FORENSICS Presented by Eilene Lyons The St. Louis Community College Florissant Valley Biotechnology Program Some slides are from a downloaded PPT presentation from The

More information

In silico variant analysis: Challenges and Pitfalls

In silico variant analysis: Challenges and Pitfalls In silico variant analysis: Challenges and Pitfalls Fiona Cunningham Variation annotation coordinator EMBL-EBI www.ensembl.org Sequencing -> Variants -> Interpretation Structural variants SNP? In-dels

More information

CUMACH - A Fast GPU-based Genotype Imputation Tool. Agatha Hu

CUMACH - A Fast GPU-based Genotype Imputation Tool. Agatha Hu CUMACH - A Fast GPU-based Genotype Imputation Tool Agatha Hu ahu@nvidia.com Term explanation Figure resource: http://en.wikipedia.org/wiki/genotype Allele: one of two or more forms of a gene or a genetic

More information

DNA DATABASE MANAGEMENT REVIEW AND RECOMMENDATIONS. ENFSI DNA Working Group April 2017

DNA DATABASE MANAGEMENT REVIEW AND RECOMMENDATIONS. ENFSI DNA Working Group April 2017 DNA DATABASE MANAGEMENT REVIEW AND RECOMMENDATIONS ENFSI DNA Working Group April 2017 1 Table of contents 1 Introduction... 4 2 Establishing a forensic DNA database... 5 3 Inclusion criteria... 6 3.1 Source

More information

Authenticating human cell lines using the Identifiler kits and capillary electrophoresis platforms

Authenticating human cell lines using the Identifiler kits and capillary electrophoresis platforms APPLICATION NOTE Identifiler kits and SeqStudio Genetic Analyzer Authenticating human cell lines using the Identifiler kits and capillary electrophoresis platforms In this application note, we show: The

More information

Analysis of structural variation. Alistair Ward USTAR Center for Genetic Discovery University of Utah

Analysis of structural variation. Alistair Ward USTAR Center for Genetic Discovery University of Utah Analysis of structural variation Alistair Ward USTAR Center for Genetic Discovery University of Utah What is structural variation? What differentiates SV from short variants? What are the major SV types?

More information

Biology/DNA DNA Interpretation SOP. Biology/DNA Division

Biology/DNA DNA Interpretation SOP. Biology/DNA Division Contents 1 Analysis and Interpretation of DNA Results... 3 2 Statistics... 51 3 Reports... 59 Document ID: 25414 Uncontrolled When Printed Page 2 of 61 1 Analysis and Interpretation of DNA Results Autosomal

More information

Centre of Forensic Sciences

Centre of Forensic Sciences Centre of Forensic Sciences Technical Information Sheets DNA Information Introduction DNA is the genetic blueprint of life and is packaged into paired structures known as chromosomes. One from each pair

More information

A critical review for DNA polymorphic markers and blood group markers in paternity testing

A critical review for DNA polymorphic markers and blood group markers in paternity testing International Congress Series 1239 (2003) 749 753 A critical review for DNA polymorphic markers and blood group markers in paternity testing A. Sawaguchi*, X. Wang, T. Sawaguchi Department of Legal Medicine,

More information

Product Description SALSA MLPA Probemix P438-D2 HLA

Product Description SALSA MLPA Probemix P438-D2 HLA Product Description SALSA Probemix P438-D2 HLA To be used with the MLPA General Protocol. Version D2. Catalogue numbers: P438-025R: SALSA MLPA Probemix P438 HLA, 25 reactions. P438-050R: SALSA MLPA Probemix

More information

Expand your forensics workflow with the Precision ID NGS System for human identification

Expand your forensics workflow with the Precision ID NGS System for human identification Expand your forensics workflow with the Precision ID NGS System for human identification Integrate NGS into your forensic DNA lab workflow The Applied Biosystems Precision ID NGS System for human identification

More information

Forensic STR profiling using Oxford Nanopore Technologies MinION sequencer

Forensic STR profiling using Oxford Nanopore Technologies MinION sequencer Forensic STR profiling using Oxford Nanopore Technologies MinION sequencer Senne Cornelis 1,2 *, Sander Willems 1, Christophe Van Neste 1, Olivier Tytgat 1,2, Jana Weymaere 1, Ann-Sophie Vander Plaetsen

More information

Artifacts Identified Post-Developmental Validation: AmpFLSTR Identifiler Plus PCR Amplification Kit

Artifacts Identified Post-Developmental Validation: AmpFLSTR Identifiler Plus PCR Amplification Kit March 29, 2018 TECHNICAL NOTE Artifacts Identified Post-Developmental Validation: AmpFLSTR Identifiler Plus PCR Amplification Kit The purpose of this document is to assist with data interpretation by providing

More information

Axiom mydesign Custom Array design guide for human genotyping applications

Axiom mydesign Custom Array design guide for human genotyping applications TECHNICAL NOTE Axiom mydesign Custom Genotyping Arrays Axiom mydesign Custom Array design guide for human genotyping applications Overview In the past, custom genotyping arrays were expensive, required

More information

Validation of the X chromosomal STR DXS7424 which is closely linked to DXS101

Validation of the X chromosomal STR DXS7424 which is closely linked to DXS101 International Congress Series 1239 (2003) 393 398 Validation of the X chromosomal STR DXS7424 which is closely linked to DXS101 Jeanett Edelmann a, *, Sandra Hering b, Erich Kuhlisch c, Reinhard Szibor

More information

NEW TECHNOLOGIES - AN INTRODUCTION

NEW TECHNOLOGIES - AN INTRODUCTION NEW TECHNOLOGIES - AN INTRODUCTION Niels Morling, MD DMSc Professor of Forensic Genetics Chairman & Director of the Department of Forensic Medicine Faculty of Health and Medical Sciences University of

More information

High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays

High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays Ali Pirani and Mohini A Patil ISAG July 2017 The world leader in serving science

More information

4.1. Genetics as a Tool in Anthropology

4.1. Genetics as a Tool in Anthropology 4.1. Genetics as a Tool in Anthropology Each biological system and every human being is defined by its genetic material. The genetic material is stored in the cells of the body, mainly in the nucleus of

More information

High-Throughput Genotyping of Forensic STRs and SNPs Using Time-of-Flight Mass Spectrometry

High-Throughput Genotyping of Forensic STRs and SNPs Using Time-of-Flight Mass Spectrometry High-Throughput Genotyping of Forensic STRs and SNPs Using Time-of-Flight Mass Spectrometry John M. Butler and Christopher H. Becker GeneTrace Systems Inc., 1401 Harbor Bay Parkway, Alameda, CA 94502 ½¾½¾½¾½¾½¾½¾½¾½¾½¾½¾½¾½¾½¾½¾½¾

More information

Development of a Global STR Multiplex for Human Identification Analysis. Julio Mulero, Ph. D. R&D Group Human Identification, Life Technologies

Development of a Global STR Multiplex for Human Identification Analysis. Julio Mulero, Ph. D. R&D Group Human Identification, Life Technologies Development of a Global STR Multiplex for Human Identification Analysis Julio Mulero, Ph. D. R&D Group Human Identification, Life Technologies Agenda Why a global multiplex? Multiplex Configuration Strategy

More information

Converge Software. A comprehensive forensic analysis platform that integrates answers for you

Converge Software. A comprehensive forensic analysis platform that integrates answers for you PRODUCT BULLETIN Human identification Converge Software A comprehensive forensic analysis platform that integrates answers for you Key features and benefits Analyze next-generation sequencing data from

More information

DYF399S1: A Unique Three-Copy Short Tandem Repeat on the Human Y Chromosome

DYF399S1: A Unique Three-Copy Short Tandem Repeat on the Human Y Chromosome Journal of Genetic Genealogy 1:8-11, 2005 DYF399S1: A Unique Three-Copy Short Tandem Repeat on the Human Y Chromosome Gareth Ll. C. Henson A recent paper (Kayser et al. 2004) reported 166 new Y Chromosome

More information