FORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence
|
|
- Bertha Jones
- 6 years ago
- Views:
Transcription
1 FORENSIC GENETICS FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS Establishing human corpse identity Crime cases matching suspect with evidence Paternity testing, even after death Missing persons investigations Putting together tissues coming from particular persons in mass disasters FORENSIC GENETICS creating population data frequency used for evaluation of proof value of case report establishing databases of convicted felons used for linking unsolved crime cases with serial offenders establishing databases of missing persons used for identification of unknown human remains Sources of biological evidence DNA in the cell Blood Semen Saliva Urine Hair Teeth Bone Tissue Somatic cell Hair root 3-6 pg DNA DNA profile Sperm cell ( g DNA) 1
2 Cells without nucleus DNA in the Cell chromosome cell nucleus double stranded DNA molecule A T G C Mature red blood cells, hair shaft Individual nucleotides HUMAN GENOME = 3 bilion base pairs Principles of Mendelian inheritance The law of segregation Each individual has two alleles lying opposite to each other in the pair of homological chromosomes, one inherit from the mother and second inherit from the father The law of independent assortment The pair of alleles coding one marker is independent of the pair of alleles coding another marker VNTR DNA POLIMORPHISM Lenght polymorphism - Variable number of tandem repeat Variable number of tandem repeat (VNTR) nucleotides = minisatellites GCTCTTATGACGTATCATGACTAG SNP Sequence polymorphism - Single nucleotide polymorphism The number of repeats can differ between individuals 2
3 Variable number of tandem repeat (VNTR) Variable number of tandem repeat (STR) 2-6 nucleotides = microsatellites = STR (short tandem repeat) 9 repeats 5 repeats locus allele 5,9 genotype 5/9 The number of repeats can differ between individuals Heterozygote = the genotype at the locus has two different alleles Variable number of tandem repeat (STR) 7 repeats 7 repeats locus alleles 7,7 genotype 7/7 Homozygote = the genotype at locus has two copies of the same allele DNA detection in capillary sequencer Schema of a gel electrophoresis system 3
4 MPS massive parallel sequencing VNTR analysis in paternity testing M M 1-allaged father 2- child 3-mother M height marker STR analysis in paternity testing Paternity exclusion principles Arising from Mendelian inheritance rules New feature is present in the child, while it is absent in the alleged father and the mother and or Without exclusion Paternity exclusion The child does not inherit any feature from the alleged father PCR Polymerase chain reaction Enables to produce millions of copies of a specific DNA sequence in approximately two hours Multiplex PCR Multiple STR regions are examined simultaneously Multiplex PCR reaction mix contains multiple primer pairs even more than 20 primer pairs Particular primer pairs are labeled with different fluorescent dyes Classical PCR reaction mix contains template DNA, polymerase, deoxynucleotides and a pair of primers forward primer and reverse one 4
5 STR Genotyping after fluorescent detection Advantages of Multiplex PCR Reduces template required Reduces labour to obtain results Anables analysis of degraded DNA Makes more effective analysis of mixtures Increases the informativeness of the DNA test Y- CHROMOSOME MARKERS specific only for man Y-STR haplotyping after fluorescent detection Haplotype Y - Genetic variation at multiple points along the Y chromosome W h y t h e Y -C h r o m o s o m e? 98% of violent crimes is caused by men Male specific Y- STR markers Applications identificaton of male or male components in mixture istablishing paternity for male offspring paternal lineages testing male gender identification 5
6 GENDER IDENTIFICATION WITH AMELOGENIN VNTR DNA POLIMORPHISM Lenght polymorphism - Variable number of tandem repeat AMG Y (112 bp) AMG X (106 bp) SNP Sequence polymorphism - Single nucleotide polymorphism Single nucleotide polymorphism (SNP) Single nucleotide polymorphism (SNP) Homozygote Homozygote Heterozygote G G A A G A We differ from each other in 1 bp out of every 300 nucleobases Advantage of SNP over VNTR markers Polymorphism of mtdna are abundant and common in the human genome have low mutation rate HV1, HV2 variable control 70 regions type of SNP ANDERSON SEQUENCE due to the small molecular weight they are very useful in analysis of high degraded DNA samples 15 STR = 50 SNP 0,2 ng 0.02 ng HV1 HV bp Extractions of DNA Limited & Old & Degraded samples as in tissues such as - bones & teeth - skeletal remains - hair shafts! 6
7 NON RECOMBINATON MARKERS HAPLOID MARKERS Mitochondrial DNA Y-chromosome DNA Uninparental inheritance Inheritance from only one parent PASSED DOWN from mother to her child from father to his son LINEAGES MARKERS Steps involved in processing forensic DNA samples DNA Extraction Evaluation of DNA quantity and quality PCR amplifiation multiple STR/SNP markers FORENSIC DNA EVIDENCE INTERPRETATION Kinship Analysis paternity testing Separation and detection of DNA alleles PE - POWER OF EXCLUSION It is the percentage of the unjustly sued man who will be excluded as fathers in the course of investigation PE for firstdegreeexpertise as wellas DNA expertise DNA EXPERTISE PE=99,9999% 100% 95% PE determines usefulness for paternity testing The more polymorphic the investigated markers are, the easier it is to exclude paternity of the man using these markers 90% 85% 80% I º EXPERTISE PE=84% ABO PGM Kell ACP MN GLO Rh ESD GM HP STR-Multiplex 15 loci 7
8 AN OPINION IN PATERNITY TESTING I º E X P E R T I S E AN OPINION IN PATERNITY TESTING D N A E X P E R T I S E EXCLUSION LACK OF EXCLUSION? EXCLUSION with 4 ( four ) INDEPENDENT MARKERS CONFIRMATION probability of patrernity = % RECONSTRUCTION OF GENOTYPE OF DEAD PERSON International Society of Forensic Genetic Polish Society of Forensic Medicine and Cryminology RECONSTRUCTION OF GENOTYPE OF DEAD PERSON Paternity testing evidence Paternity Index(PI) Probability of Paternity FORENSIC DNA EVIDENCE INTERPRETATION % 99% 99.9% 99.99% % % personal identification Requirements for issuing a report with a positive weight for paternity PD - POWER OF DISCRIMINATION PD IN PERSONAL IDENTIFICATION Probability that two unrelated individuals will have different sets of genetic alleles PD determines usefulness for personal identification The more polymorphic markers are examined, the greater the chance that two unrelated individuals will not have an identical set of these markers ABO Rh KELL MN GM ESD ACP PGM GLO HP PD 95 % D16S539 D3S1358 D2S1338 D8S1179 D18S51 D12S11 D19S433 vwa TH01 FGA PD = % 8
9 GENETIC IDENTIFICATION CALCULATION OF PROFILE FREQUENCY Comparative analysis of received DNA profile If allele in locus A has frequency a and allele in locus B has frequency b No match Exclusion If match occurs, calculation of DNA profile frequency Match Inclusion Generation of case report with random match probability taking into account assumption of HWE AA = a 2 Genotypes frequency BB = b 2 AB = 2ab EVIDENCE VALUE OF PERSONAL IDENTIFICATION Product of multiplication genotypes frequency = Profile frequency PF PF = GF1 marker x GF2 marker x GF3 marker x... 1 PROFILE FREQUENCY = 1 PROFILE in... persons RANDOM MATCH PROBABILITY The chance that a randomly selected individual from a population will have an identical DNA genotype such as another individual in the population RANDOM MATCH PROBABILITY USING 13 LOCI DNA POLYMORPHISM MOLECULAR DACTYLOSCOPY 9
Genetic Identity. Steve Harris SPASH - Biotechnology
Genetic Identity Steve Harris SPASH - Biotechnology Comparison of Organisms ORGANISM GENES BASE PAIRS Lambda Phage 40 50,000 E.coli 400 5,000,000 Yeast 13,000 15,000,000 Human 20,000 3,000,000,000 (3 billion)
More informationWhat is DNA? Deoxyribonucleic Acid The inherited genetic material that makes us what we are
DNA Basic Genetics What is DNA? DNA is Deoxyribonucleic Acid The inherited genetic material that makes us what we are DNA in the Cell Human Genome ~3 billion base pairs of DNA 30,000-35,000 genes Population-each
More informationThe Real CSI: Using DNA to Identify Criminals and Missing Persons
The Real CSI: Using DNA to Identify Criminals and Missing Persons San Jose State University May 2, 2012 Overview Forensic DNA in the media perceptions and reality The power and limitations of nuclear (STR)
More informationDNA Analysis Students will learn:
DNA Analysis Students will learn: That DNA is a long-chain polymer found in nucleated cells, which contain genetic information. That DNA can be used to identify or clear potential suspects in crimes. How
More informationOverview. Background ~30 min. Lab activity ~50 min. DNA profiling Polymerase Chain Reaction (PCR) Gel Electrophoresis PCR
Overview Day 1: Tuesday Introduction to DNA profiling How do we use DNA to solve crimes? Background Polymerase Chain Reaction (PCR) Gel Electrophoresis Set up PCR Day 2: Wednesday Make and Run Agarose
More informationMutations during meiosis and germ line division lead to genetic variation between individuals
Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements
More informationGenetics Lecture 16 Forensics
Genetics Lecture 16 Forensics DNA Forensics Genetics is arguably the most influential science today dramatically affecting technologies in fields as diverse as agriculture, archaeology, medical diagnosis,
More informationDNA, or Deoxyribonucleic Acid, is the genetic material in our cells. No two people (except identical twins) have the
DNA, or Deoxyribonucleic Acid, is the genetic material in our cells. No two people (except identical twins) have the exact same DNA. DNA patterns from four sets of twins which are identical? DNA fingerprinting
More informationSouthern hybridization technique
Southern hybridization technique DNA fingerprint analysis is based on the "Southern" hybridization technique. In this method: DNA fingerprinting, also termed DNA profile analysis is based on the use of
More informationMicrosatellite markers
Microsatellite markers Review of repetitive sequences 25% 45% 8% 21% 13% 3% Mobile genetic elements: = dispersed repeat included: transposition: moving in the form of DNA by element coding for transposases.
More informationReport of Analyzing Short Tandem Repeats for Parentage Testing
1 Alex Michael Tseng Department of Forensic Medicine, College of Medicine, National Taiwan University Report of Analyzing Short Tandem Repeats for Parentage Testing Introduction In the three billion letter
More informationChapter 7 DNA Fingerprinting By the end of this chapter you will be able to:
Chapter 7 DNA Fingerprinting By the end of this chapter you will be able to: explain how crime scene evidence is collected and processed to obtain DNA describe how radioactive probes are used in DNA fingerprinting
More informationGeneral DNA Information
1 Use of this PPT This PPT has lots of information. I may or may not discuss each slide. Use the information to answer questions in your Question Packets. The packets are the study guide for the tests
More informationThe state of Illinois has a grand tradition of corrupt politicians (Re: Former governor Rod Blagojevich.)
Biology 321 May 20, 2011 DNA fingerprinting The state of Illinois has a grand tradition of corrupt politicians (Re: Former governor Rod Blagojevich.) 1 2 Innocence Project http://www.innocenceproject.org/know/
More informationDNA. Evidence. How is DNA be used to solve crimes?
DNA Evidence How is DNA be used to solve crimes? How is DNA used as evidence? Each person s DNA is different from other people (except identical twins). DNA collected from a crime scene can either link
More informationApplication of Biotechnology in DNA Fingerprinting and Forensic Analysis. Copyright 2009 Pearson Education, Inc.
Application of Biotechnology in DNA Fingerprinting and Forensic Analysis Introduction to DNA Fingerprinting and Forensics Forensic science intersection of law and science Historic examples Early 1900s
More informationDNA analysis. Anja Bye Post doktor. K.G. Jebsen Senter for Hjertetrening. Institutt for Sirkulasjon og Bildediagnostikk Det Medisinske Fakultet NTNU
DNA analysis Anja Bye Post doktor K.G. Jebsen Senter for Hjertetrening Institutt for Sirkulasjon og Bildediagnostikk Det Medisinske Fakultet NTNU Focus of this lecture What is DNA? Comparing DNA from different
More informationAnalysis in Forensic Science
Chapter 16 Gene Cloning & DNA Analysis in Forensic Science 1. DNA analysis in identification of crime suspects 2. Studying kinship by DNA profiling 3. Sex identification by DNA analysis Forensic science
More informationGenerating Forensic DNA Profiles
Wright State University CORE Scholar Biological Sciences Faculty Publications Biological Sciences 12-2012 Generating Forensic DNA Profiles Dan E. Krane Wright State University - Main Campus, dan.krane@wright.edu
More informationDNA: THE INDISPENSIBLE FORENSIC SCIENCE TOOL
Chapter 9 DNA: THE INDISPENSIBLE TOOL By Richard Saferstein Upper Saddle River, NJ 07458 1 Chapter 9 DNA Fingerprinting By the end of this chapter you will be able to: explain how crime scene evidence
More informationForensic DNA Testing. Forensic DNA Testing. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, HI (M) DNA from no two individuals except identical twins is alike. The person to person differences in DNA can be discovered by PCR amplification and genomic sequencing. The
More informationEnhanced Resolution and Statistical Power Through SNP Distributions Within the Short Tandem Repeats
Enhanced Resolution and Statistical Power Through SNP Distributions Within the Short Tandem Repeats John V. Planz, Ph.D. Associate Professor, Associate Director UNT Center for Human Identification UNT
More informationBiology 445K Winter 2007 DNA Fingerprinting
Biology 445K Winter 2007 DNA Fingerprinting For Friday 3/9 lab: in your lab notebook write out (in bullet style NOT paragraph style) the steps for BOTH the check cell DNA prep and the hair follicle DNA
More informationLaboratory Exercise 4. Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis.
Laboratory Exercise 4 4 Multiplex PCR of Short Tandem Repeats and Vertical Polyacrylamide Gel Electrophoresis B A C K G R O U N D The human genome contains over 3000 million base pairs, which are distributed
More informationJanuary 07, (adenine, guanine, cytosine, thymine)
(adenine, guanine, cytosine, thymine) DNA at Work - DNA is used to make proteins - proteins are made by linking amino acids (there are 20 possible amino acids) - sequence of amino acids determines shape/function
More informationForensic DNA Evidence: Collection, Mixtures, and Degradation
Wright State University CORE Scholar Biological Sciences Faculty Publications Biological Sciences 10-28-2004 Forensic DNA Evidence: Collection, Mixtures, and Degradation Dan E. Krane Wright State University
More informationDNA Technology. Dr. Saleh Alaifan
DNA Technology Dr. Saleh Alaifan Watson and Crick discovered the double helix In April 1953, James Watson and Francis Crick shook the scientific world with an elegant double-helical model for the structure
More informationBENG 183 Trey Ideker. Genotyping. To be covered in one 1.5 hr lecture
BENG 183 Trey Ideker Genotyping To be covered in one 1.5 hr lecture Genetic variation: Some basic definitions Allele Alternative form of a genetic locus inherited separately from each parent Polymorphism
More information4.1. Genetics as a Tool in Anthropology
4.1. Genetics as a Tool in Anthropology Each biological system and every human being is defined by its genetic material. The genetic material is stored in the cells of the body, mainly in the nucleus of
More informationProduct Catalog 2012 AmplGen Ltd.
Professional solutions for Genetic Human Identification and Molecular Diagnostics Product Catalog 2012 AmplGen Ltd. Riga, Lativa 2 Catalog AmplGen 2012, ver. #02 Dear colleagues, AmplGen is new European
More informationBasic Steps of the DNA process
As time pasted technology has improve the methods of analyzing DNA. One of the first methods for the analysis of DNA is known as Restriction Fragment Length Polymorphism (RFLP). This technique analyzed
More informationPCR. What is PCR? What is PCR? Why chain? What is PCR? Why Polymerase?
What is PCR? PCR the swiss army knife Claudia Stäubert, Institute for biochemistry PCR is an exponentially progressing synthesis of the defined target DNA sequences in vitro. It was invented in 1983 by
More informationDNA is contained in the nucleus of every cell in your body. Cell Nucleus
DNA is contained in the nucleus of every cell in your body Cell Nucleus 1 DNA has a spiral staircase-like structure. The steps are formed by the nitrogen bases of the nucleotides where adenine pairs with
More informationFrom Forensic Genetics to Genomics Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal Investigations
From Forensic Genetics to Genomics Perspectives for an Integrated Approach to the Use of Genetic Evidence in Criminal Investigations Peter M. Schneider Institute of Legal Medicine University of Cologne
More informationPart I: Predicting Genetic Outcomes
Part I: Predicting Genetic Outcomes Deoxyribonucleic acid (DNA) is found in every cell of living organisms, and all of the cells in each organism contain the exact same copy of that organism s DNA. Because
More informationDNA FINGERPRINTING.
DNA FINGERPRINTING http://news.bbc.co.uk/media/images/38250000/gif/_38250230_dna_generic300.gif DNA: Deoxyribonucleic Acid - biological equivalent of fingerprints - < 1% of nonviolent crimes yield DNA
More informationDNA FINGERPRINTING MADE EASY FOR FORENSICS
DNA FINGERPRINTING MADE EASY FOR FORENSICS Presented by Eilene Lyons The St. Louis Community College Florissant Valley Biotechnology Program Some slides are from a downloaded PPT presentation from The
More informationBook chapter appears in:
Mass casualty identification through DNA analysis: overview, problems and pitfalls Mark W. Perlin, PhD, MD, PhD Cybergenetics, Pittsburgh, PA 29 August 2007 2007 Cybergenetics Book chapter appears in:
More informationDNA Expert Witness. Nuclear DNA 10/23/14. Adams County Bar Association. DNA found in the nucleus of the cell is called nuclear DNA.
Adams County Bar Association DNA Expert Witness Jenifer Smith, PhD Forensic Science Program Eberly College of Science Adams County Bench Bar Conference 10/31/14 Nuclear DNA DNA found in the nucleus of
More informationRFLP s with VNTR analysis
RFLP s with VNTR analysis The most powerful and awesome tool acquired by humans since the splitting of atoms The Time Magazine (U.S.A) INTRODUCTION DNA profiling (also called DNA testing, DNA typing, or
More information..C C C T C A T T C A T T C A T T C A T T C A..
Polymerase Chain Reaction Lab: a Forensic Application INTRODUCTION PCR (polymerase chain reaction) is a technique that scientists use to amplify particular segments of DNA. This process can produce large
More informationSTR DNA Data Analysis. Genetic Analysis
STR DNA Data Analysis Genetic Analysis Once a DNA profile is generated, how does one interpret the data? DNA data analysis is based on alleles detected DNA data analysis rarely can tell you time of deposit
More informationDNA Profiling with PCR
Name: DNA Profiling with PCR OBJECTIVES To review the structure and function of DNA. Understand and perform the polymerase chain reaction (PCR) To gain experience using the micropipettes, thermocycler,
More informationIntroduction to some aspects of molecular genetics
Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...
More informationUnit 4-DNA Analysis Review Guide
Name: KEY Match the term on the right with the definition on the left. Unit 4-DNA Analysis Review Guide 1. A procedure used to determine the order of the base pairs that make up a DNA molecule E 2. These
More informationDNA. Shape = Double Helix (twisted ladder) The purpose of each cell having DNA is to have directions for the cell to make proteins
DNA DNA Deoxyribo- Nucleic Acid Shape = Double Helix (twisted ladder) The purpose of each cell having DNA is to have directions for the cell to make proteins Parts = nucleotide 1. Sugar (deoxyribose) 2.
More informationCrash-course in genomics
Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is
More informationL. GORGAN. However, even in sexually reproducing species, not all DNA is inherited from both parents. There are two important exceptions, the uniparen
International Journal of Criminal Investigation Volume 1 Issue 2 103-107 DNA SOURCE OF FORENSIC EVIDENCE Lucian GORGAN * 1) Al.I. Cuza University of Iasi, Faculty of Biology, 22, Blvd. Carol I, 700506,
More informationSTUDY OF VNTR HUMAN POLYMORPHISMS BY PCR
STUDY OF VNTR HUMAN POLYMORPHISMS BY PCR Ref. PCR1 1. OBJECTIVE OF THE EXPERIMENT The objective of this experiment is to introduce students to the principles and practice of Polymerase Chain Reaction (PCR)
More informationImplementation of MPS into a Specialist Casework Laboratory. David Ballard
Implementation of MPS into a Specialist Casework Laboratory David Ballard DNA Evidence to Investigative Insights Berlin, 16 Outline ForenSeq STR Validation SNP Validation Relationship/Identification Specialist
More informationAuthors: Vivek Sharma and Ram Kunwar
Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be
More informationA critical review for DNA polymorphic markers and blood group markers in paternity testing
International Congress Series 1239 (2003) 749 753 A critical review for DNA polymorphic markers and blood group markers in paternity testing A. Sawaguchi*, X. Wang, T. Sawaguchi Department of Legal Medicine,
More informationIntroduction to Mitochondrial DNA Analysis
Introduction to Mitochondrial DNA Analysis Leslie D. McCurdy, Ph.D. Federal Bureau of Investigation DNA Analysis Unit II Deoxyribonucleic Acid Nuclear DNA (nucdna) Biparental inheritance Can achieve unique
More informationCentre of Forensic Sciences
Centre of Forensic Sciences Technical Information Sheets DNA Information Introduction DNA is the genetic blueprint of life and is packaged into paired structures known as chromosomes. One from each pair
More informationUnit 2- DNA Analysis
Unit 2- DNA Analysis Discovery of DNA structure 1950 s Rosalind Franklin & Maurice Wilkins photograph DNA using x-ray diffraction 1 Discovery of DNA structure 1953 James Watson & Francis Crick develop
More informationUniparental disomy (UPD) analysis of chromosome 15
YOUR INNOVATIVE RESEARCH Analysis of UPD by STR-PCR Uniparental disomy (UPD) analysis of chromosome 15 Applied Biosystems 3500xL Genetic Analyzer Introduction Researchers at the Laboratory of Medical Genetics
More informationB. Incorrect! 64% is all non-mm types, including both MN and NN. C. Incorrect! 84% is all non-nn types, including MN and MM types.
Genetics Problem Drill 23: Population Genetics No. 1 of 10 1. For Polynesians of Easter Island, the population has MN blood group; Type M and type N are homozygotes and type MN is the heterozygous allele.
More informationOverview. Introduction
Genetics 101: Introduction Overview Important terminology DNA extraction, gel electrophoresis, PCR Allozymes (Protein electrophoresis) RFLP AFLP Sequencing Microsatellites SNPs Costs, Sample Collection
More informationConcepts: What are RFLPs and how do they act like genetic marker loci?
Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th
More informationPopulation Genetics (Learning Objectives)
Population Genetics (Learning Objectives) Define the terms population, species, allelic and genotypic frequencies, gene pool, and fixed allele, genetic drift, bottle-neck effect, founder effect. Explain
More informationData Quality Worth Sharing
Product Bulletin Human Identification AmpFlSTR NGM and NGM SElect PCR Amplification Kits Next generation amplification chemistries including the 5 new loci from the expanded European Standard Set Enhanced
More informationEvaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications
Ranajit Chakraborty, Ph.D. Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications Overview Some brief remarks about SNPs Haploblock structure of SNPs in the human genome Criteria
More informationShort Tandem Repeat (STR) Analysis
Maj Gen (R) Suhaib Ahmed, HI (M) Short tandem repeats (STR) are randomly distributed DNA sequences in which 2-6bp are tandemly repeated. These are scattered on all chromosomes including the autosomes as
More informationDNA stands for deoxyribose nucleic acid DNA is a very large molecule made up of a long chain of sub-units The sub-units are called nucleotides Each
1 DNA stands for deoxyribose nucleic acid DNA is a very large molecule made up of a long chain of sub-units The sub-units are called nucleotides Each nucleotide is made up of a sugar called deoxyribose
More informationCSI TEST. Ref. PCR detectives (4 practices) 1. EXPERIMENT OBJETIVE 2. BACKGROUND INFORMATION
CSI TEST Ref. PCR detectives (4 practices) 1. EXPERIMENT OBJETIVE This practice introduces students to using DNA and PCR to simulate how DNA obtained from a hair or saliva sample from a crime scene can
More informationForensic genetics: New frontiers
Forensic genetics: New frontiers Dennis McNevin (CRICOS) #00212K DNA profiles First application of DNA profiling : The Enderby murder case A single locus minisatellite probe was used to analyze the following
More informationName Date Class CHAPTER 13. DNA Fingerprinting
Real-World Biology: Analysis DNA Fingerprinting Genetic Prints Help Solve Mystery of Girls Switched at Birth. Murder Conviction Overturned by DNA Testing: Prisoner Released. Headlines such as these have
More informationDNA Profiling. (DNA fingerprinting)
DNA Profiling (DNA fingerprinting) Background Information: Restriction Enzymes Restriction Enzymes Evolved by bacteria to protect against viral DNA infection. Also called Endonucleases. They cleave DNA
More informationAllele frequencies in Azuay Population in Ecuador
Allele frequencies in Azuay Population in Ecuador P.P. Orellana 1, C.F. Andrade 1, C.L. Arciniegas 2 and G.C. Iannacone 3 1 Academic Unit of Health and Welfare, Odontology Career, Laboratory of Molecular
More informationPOPULATION GENETICS studies the genetic. It includes the study of forces that induce evolution (the
POPULATION GENETICS POPULATION GENETICS studies the genetic composition of populations and how it changes with time. It includes the study of forces that induce evolution (the change of the genetic constitution)
More informationY chromosomal STRs in forensics
Haplotype and mutation analysis for newly suggested Y-STRs in Korean father-son pairs Yu Na Oh, Hwan Young Lee, Eun Young Lee, Eun Hey Kim, Woo Ick Yang, Kyoung-Jin Shin Department of Forensic Medicine
More informationHuman Chromosomes Section 14.1
Human Chromosomes Section 14.1 In Today s class. We will look at Human chromosome and karyotypes Autosomal and Sex chromosomes How human traits are transmitted How traits can be traced through entire families
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationAmpFlSTR Identifiler PCR Amplification Kit
Product Bulletin Human Identification AmpFlSTR Identifiler PCR Amplification Kit Fifteen STR (short tandem repeat) loci and Amelogenin co-amplified in a single tube Incorporation of the same proven, reliable
More informationDNA 101. DNA 101:Kate Philpott and Jennifer Friedman
DNA 101 DNA 101:Kate Philpott and Jennifer Friedman DNA found in cells of your body cell nucleus DNA Found in cells once they leave your body too CONSIDER THE SOURCE Blood* Semen* Hair Bone Saliva* Urine*
More informationExpand your forensics workflow with the Precision ID NGS System for human identification
Expand your forensics workflow with the Precision ID NGS System for human identification Integrate NGS into your forensic DNA lab workflow The Applied Biosystems Precision ID NGS System for human identification
More informationProcedure for Casework DNA Interpretation
Procedure for Casework DNA Interpretation 1.0 Purpose The purpose of this document is to provide guidelines for the interpretation of autosomal DNA results when amplified with Identifiler Plus. 2.0 Scope
More informationForensic Applications of CE and MPS
Forensic Biology Polymorphic Enzyme Single Locus PCR RFLP Massively Parallel Sequencing (MPS) Ion Chef System Ion S5 System Ion Chef System Prepare barcoded DNA libraries with Applied Biosystems Precision
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background PCR Amplify= Polymerase Chain Reaction (PCR) Invented in 1984 Applications Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off
More informationPopulation Genetics (Learning Objectives)
Population Genetics (Learning Objectives) Define the terms population, species, allelic and genotypic frequencies, gene pool, and fixed allele, genetic drift, bottle-neck effect, founder effect. Explain
More informationBasic Concepts of Human Genetics
Basic Concepts of Human Genetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. One pair is called sex chromosomes
More informationHow about the genes? Biology or Genes? DNA Structure. DNA Structure DNA. Proteins. Life functions are regulated by proteins:
Biology or Genes? Biological variation Genetics This is what we think of when we say biological differences Race implies genetics Physiology Not all physiological variation is genetically mediated Tanning,
More informationJohn M. Butler and Peter M. Vallone National Institute of Standards and Technology
DNA Biometrics: i Standards and Technology John M. Butler and Peter M. Vallone National Institute of Standards and Technology NDIA Biometrics Conference (Arlington VA) NDIA Biometrics Conference (Arlington,
More informationMohammed Sanaullah Qaseem, Syed Abdul Wahab Asif, Zeeshan Fatima Armeen, Israr Ahmed Qureshi
.Advancement In DNA As Source Of Biometric Authentication Mohammed Sanaullah Qaseem, Syed Abdul Wahab Asif, Zeeshan Fatima Armeen, Israr Ahmed Qureshi Associate Professor, Nizam Institute of Engineering
More informationPUBH 8445: Lecture 1. Saonli Basu, Ph.D. Division of Biostatistics School of Public Health University of Minnesota
PUBH 8445: Lecture 1 Saonli Basu, Ph.D. Division of Biostatistics School of Public Health University of Minnesota saonli@umn.edu Statistical Genetics It can broadly be classified into three sub categories:
More informationDNA profiling and Genome Structure The state of Illinois has a grand tradition of corrupt politicians (Re: Former governor Rod Blagojevich.
DNA profiling and Genome Structure The state of Illinois has a grand tradition of corrupt politicians (Re: Former governor Rod Blagojevich.) 2 Citing Issue of Fairness, Governor Clears Out Death Row in
More informationPart A for Using genetic data in the Add Health Sample
Part A for email Using genetic data in the Add Health Sample Andrew Smolen and Brett Haberstick Institute for Behavioral Genetics, University of Colorado at Boulder Add Health Users Workshop, July 2010
More informationOverview of Human Genetics
Overview of Human Genetics 1 Structure and function of nucleic acids. 2 Structure and composition of the human genome. 3 Mendelian genetics. Lander et al. (Nature, 2001) MAT 394 (ASU) Human Genetics Spring
More informationAmpF STR NGM PCR Amplification Kit - Overview
AmpF STR NGM PCR Amplification Kit - Overview The most advanced STR kits optimized for analysis of forensic casework and database samples in Europe Data Quality Worth Sharing! 9/7/2011 Life Technologies
More informationDETERMINATION OF THE Rh FACTOR BY PCR
DETERMINATION OF THE Rh FACTOR BY PCR Ref.: PCR2 1. EXPERIMENT OBJECTIVE The aim of this experiment is to introduce students to the principles and practice of the Polymerase Chain Reaction (PCR) by studying
More informationMolecular studies (SSR) for screening of genetic variability among direct regenerants of sugarcane clone NIA-98
Molecular studies (R) for screening of genetic variability among direct regenerants of sugarcane clone NIA-98 Dr. Imtiaz A. Khan Pr. cientist / PI sugarcane and molecular marker group NIA-2012 NIA-2010
More informationMitochondrial analysis in Forensic Scienses
Mitochondrial analysis in Forensic Scienses 2011 Classification of human genome Genome 3.2 Gb Genic and related (25 %) Coding and regulatory (1.5 %) Non-coding (23.5% - introns, pseudogenes) Extragenic
More informationLecture 8: Sequencing and SNP. Sept 15, 2006
Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics
More informationSTR Profiling Matching Criteria: Establishment and Importance of a Cell Line Database
STR Profiling Matching Criteria: Establishment and Importance of a Cell Line Database Margaret Kline Applied Group Biochemical Science Division Chemical Science and Technology Laboratory National Institute
More informationMidterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
More informationDNA typing of human cell lines: historical perspective Yvonne Reid, PhD Collection/Research Scientist ATCC Cell Biology
DNA typing of human cell lines: historical perspective Yvonne Reid, PhD Collection/Research Scientist ATCC Cell Biology Outline Molecular techniques for the authentication of human cell lines Mechanism
More informationAnthro 101: Human Biological Evolution. Lecture 3: Genetics & Inheritance. Prof. Kenneth Feldmeier feldmekj.weebly.
Anthro 101: Human Biological Evolution Lecture 3: Genetics & Inheritance Prof. Kenneth Feldmeier feldmekj@lavc.edu feldmekj.weebly.com What is Genetics??? Genetics is the scientific study of heredity.
More informationSTR Interpretation Guidelines
Introduction: STR Interpretation Guidelines The interpretation of results in casework is necessarily a matter of professional judgment and expertise. Not every situation can or should be covered by a pre-set
More informationAnthro 101: Human Biological Evolution. Lecture 3: Genetics & Inheritance. Prof. Kenneth Feldmeier feldmekj.weebly.
Anthro 101: Human Biological Evolution Lecture 3: Genetics & Inheritance Prof. Kenneth Feldmeier feldmekj@lavc.edu feldmekj.weebly.com What is Genetics??? Genetics is the scientific study of heredity.
More informationMathematics of Forensic DNA Identification
Mathematics of Forensic DNA Identification World Trade Center Project Extracting Information from Kinships and Limited Profiles Jonathan Hoyle Gene Codes Corporation 2/17/03 Introduction 2,795 people were
More information