FORENSIC GENETICS. DNA in the cell FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS. Sources of biological evidence

Transcription

1 FORENSIC GENETICS FORENSIC GENETICS PERSONAL IDENTIFICATION KINSHIP ANALYSIS FORENSIC GENETICS Establishing human corpse identity Crime cases matching suspect with evidence Paternity testing, even after death Missing persons investigations Putting together tissues coming from particular persons in mass disasters FORENSIC GENETICS creating population data frequency used for evaluation of proof value of case report establishing databases of convicted felons used for linking unsolved crime cases with serial offenders establishing databases of missing persons used for identification of unknown human remains Sources of biological evidence DNA in the cell Blood Semen Saliva Urine Hair Teeth Bone Tissue Somatic cell Hair root 3-6 pg DNA DNA profile Sperm cell ( g DNA) 1

2 Cells without nucleus DNA in the Cell chromosome cell nucleus double stranded DNA molecule A T G C Mature red blood cells, hair shaft Individual nucleotides HUMAN GENOME = 3 bilion base pairs Principles of Mendelian inheritance The law of segregation Each individual has two alleles lying opposite to each other in the pair of homological chromosomes, one inherit from the mother and second inherit from the father The law of independent assortment The pair of alleles coding one marker is independent of the pair of alleles coding another marker VNTR DNA POLIMORPHISM Lenght polymorphism - Variable number of tandem repeat Variable number of tandem repeat (VNTR) nucleotides = minisatellites GCTCTTATGACGTATCATGACTAG SNP Sequence polymorphism - Single nucleotide polymorphism The number of repeats can differ between individuals 2

3 Variable number of tandem repeat (VNTR) Variable number of tandem repeat (STR) 2-6 nucleotides = microsatellites = STR (short tandem repeat) 9 repeats 5 repeats locus allele 5,9 genotype 5/9 The number of repeats can differ between individuals Heterozygote = the genotype at the locus has two different alleles Variable number of tandem repeat (STR) 7 repeats 7 repeats locus alleles 7,7 genotype 7/7 Homozygote = the genotype at locus has two copies of the same allele DNA detection in capillary sequencer Schema of a gel electrophoresis system 3

4 MPS massive parallel sequencing VNTR analysis in paternity testing M M 1-allaged father 2- child 3-mother M height marker STR analysis in paternity testing Paternity exclusion principles Arising from Mendelian inheritance rules New feature is present in the child, while it is absent in the alleged father and the mother and or Without exclusion Paternity exclusion The child does not inherit any feature from the alleged father PCR Polymerase chain reaction Enables to produce millions of copies of a specific DNA sequence in approximately two hours Multiplex PCR Multiple STR regions are examined simultaneously Multiplex PCR reaction mix contains multiple primer pairs even more than 20 primer pairs Particular primer pairs are labeled with different fluorescent dyes Classical PCR reaction mix contains template DNA, polymerase, deoxynucleotides and a pair of primers forward primer and reverse one 4

5 STR Genotyping after fluorescent detection Advantages of Multiplex PCR Reduces template required Reduces labour to obtain results Anables analysis of degraded DNA Makes more effective analysis of mixtures Increases the informativeness of the DNA test Y- CHROMOSOME MARKERS specific only for man Y-STR haplotyping after fluorescent detection Haplotype Y - Genetic variation at multiple points along the Y chromosome W h y t h e Y -C h r o m o s o m e? 98% of violent crimes is caused by men Male specific Y- STR markers Applications identificaton of male or male components in mixture istablishing paternity for male offspring paternal lineages testing male gender identification 5

6 GENDER IDENTIFICATION WITH AMELOGENIN VNTR DNA POLIMORPHISM Lenght polymorphism - Variable number of tandem repeat AMG Y (112 bp) AMG X (106 bp) SNP Sequence polymorphism - Single nucleotide polymorphism Single nucleotide polymorphism (SNP) Single nucleotide polymorphism (SNP) Homozygote Homozygote Heterozygote G G A A G A We differ from each other in 1 bp out of every 300 nucleobases Advantage of SNP over VNTR markers Polymorphism of mtdna are abundant and common in the human genome have low mutation rate HV1, HV2 variable control 70 regions type of SNP ANDERSON SEQUENCE due to the small molecular weight they are very useful in analysis of high degraded DNA samples 15 STR = 50 SNP 0,2 ng 0.02 ng HV1 HV bp Extractions of DNA Limited & Old & Degraded samples as in tissues such as - bones & teeth - skeletal remains - hair shafts! 6

7 NON RECOMBINATON MARKERS HAPLOID MARKERS Mitochondrial DNA Y-chromosome DNA Uninparental inheritance Inheritance from only one parent PASSED DOWN from mother to her child from father to his son LINEAGES MARKERS Steps involved in processing forensic DNA samples DNA Extraction Evaluation of DNA quantity and quality PCR amplifiation multiple STR/SNP markers FORENSIC DNA EVIDENCE INTERPRETATION Kinship Analysis paternity testing Separation and detection of DNA alleles PE - POWER OF EXCLUSION It is the percentage of the unjustly sued man who will be excluded as fathers in the course of investigation PE for firstdegreeexpertise as wellas DNA expertise DNA EXPERTISE PE=99,9999% 100% 95% PE determines usefulness for paternity testing The more polymorphic the investigated markers are, the easier it is to exclude paternity of the man using these markers 90% 85% 80% I º EXPERTISE PE=84% ABO PGM Kell ACP MN GLO Rh ESD GM HP STR-Multiplex 15 loci 7

8 AN OPINION IN PATERNITY TESTING I º E X P E R T I S E AN OPINION IN PATERNITY TESTING D N A E X P E R T I S E EXCLUSION LACK OF EXCLUSION? EXCLUSION with 4 ( four ) INDEPENDENT MARKERS CONFIRMATION probability of patrernity = % RECONSTRUCTION OF GENOTYPE OF DEAD PERSON International Society of Forensic Genetic Polish Society of Forensic Medicine and Cryminology RECONSTRUCTION OF GENOTYPE OF DEAD PERSON Paternity testing evidence Paternity Index(PI) Probability of Paternity FORENSIC DNA EVIDENCE INTERPRETATION % 99% 99.9% 99.99% % % personal identification Requirements for issuing a report with a positive weight for paternity PD - POWER OF DISCRIMINATION PD IN PERSONAL IDENTIFICATION Probability that two unrelated individuals will have different sets of genetic alleles PD determines usefulness for personal identification The more polymorphic markers are examined, the greater the chance that two unrelated individuals will not have an identical set of these markers ABO Rh KELL MN GM ESD ACP PGM GLO HP PD 95 % D16S539 D3S1358 D2S1338 D8S1179 D18S51 D12S11 D19S433 vwa TH01 FGA PD = % 8

9 GENETIC IDENTIFICATION CALCULATION OF PROFILE FREQUENCY Comparative analysis of received DNA profile If allele in locus A has frequency a and allele in locus B has frequency b No match Exclusion If match occurs, calculation of DNA profile frequency Match Inclusion Generation of case report with random match probability taking into account assumption of HWE AA = a 2 Genotypes frequency BB = b 2 AB = 2ab EVIDENCE VALUE OF PERSONAL IDENTIFICATION Product of multiplication genotypes frequency = Profile frequency PF PF = GF1 marker x GF2 marker x GF3 marker x... 1 PROFILE FREQUENCY = 1 PROFILE in... persons RANDOM MATCH PROBABILITY The chance that a randomly selected individual from a population will have an identical DNA genotype such as another individual in the population RANDOM MATCH PROBABILITY USING 13 LOCI DNA POLYMORPHISM MOLECULAR DACTYLOSCOPY 9