VALLIAMMAI ENGINEERING COLLEGE
|
|
- Rodney Bernard Booth
- 5 years ago
- Views:
Transcription
1 VALLIAMMAI ENGINEERING COLLEGE SRM Nagar, Kattankulathur DEPARTMENT OF COMPUTER SCIENCE AND ENGINEERING QUESTION BANK VII SEMESTER BM6005 BIO INFORMATICS Regulation 2013 Academic Year Prepared by Dr.L.Karthikeyan AP (Sr.G)/CSE
2 VALLIAMMAI ENGINEERING COLLEGE SRM Nagar, Kattankulathur DEPARTMENT OF COMPUTER SCIENCE AND ENGINEERING SUBJECT SEM / YEAR: VII/VI : Bio informatics QUESTION BANK UNIT I INTRODUCTION Need for Bioinformatics technologies Overview of Bioinformatics technologies Structural bioinformatics Data format and processing Secondary resources and applications Role of Structural bioinformatics - Biological Data Integration System. PART A Q.No Questions BT Level Competence 1. Define Bioinformatics. 2. Describe the two major challenges in the area in the bioinformatics. 3. Explain the different types of database. 4. Define Gene prediction. 5. State the technologies within the Bioinformatics. BTL-3 Apply 6. Explain structure analysis. 7. Describe the key components of PDB. BTL-2 Understand 8. What is PDB format? BTL Differentiate the structure alignment CE and DALI. 10. Prepare and write concept of DIP BTL-6 Create 11. Give the details of secondary resources. BTL-2 Understand 12. Explain the structural domain CATH classifications. 13. Prepare and write the concept of DOCKING. BTL-6 Create 14. Define the Homology modelling. 15. Describe the ligand based design. 16. Give the list of visualization tool. BTL Differentiate the CATH, SCOP and DALI. 18. State the functional prediction. BTL-3 Apply 19. Give the details of computational approach. BTL-2 Understand 20. Examine the Biomoleculer interaction network database BTL-3 Apply PART B 1. i) Define the importance of information technology in Bio informatics.(6) ii) Describe the needs of Bio informatics technology.(7) 2. Discuss the overview of the Bio informatics technology.(13) BTL-2 Understand
3 3. Describe the conceptual organization of resource in structural bio informatics.(13) 4. i) Apply the concept of organization structure bioinformatics(7) BTL-3 Apply ii) write about the primary resources.(6) 5. i)explain the concept of secondary resources (6) ii)explain its application.(7) 6 Assess the concept of structural comparisons (alignment).(13) 7 Discuss in details about the structural classification.(13) BTL-2 Understand 8 Point out the techniques handled in structure prediction.(13) 9 i) Develop and shows the roles informatics plays in the post genomic drug discovery. (8) ii) Design preclinical drug discovery process with neat diagram (5) BTL-6 Create 10 Examine the Functional Assignments in Structural Genomics.(13) 11 Analyze the concept of protein-protein interaction.(13) 12 Express in details of protein-ligrand interaction.(13) BTL-2 Understand 13 Describe Computational approaches used for inferring protein-protein interactions.(13) 14 Solve the Role of Structural Bioinformatics in Systems Biology.(13) BTL-3 Apply PART-C 1 Analyze the visualization tools in the bio informatics filed.(15) 2 (i) Summarize the concept of database for integrating protein (DIP).(10) (ii) Describe in details about Family-depended conservation (5) 3 Formulate the BIND in protein-protein interaction.(15) BTL-6 Create 4 Deduce the concept of gene Fusion.(15)
4 UNIT II DATAWAREHOUSING AND DATAMINING IN BIOINFORMATICS Bio informatics data Data warehousing architecture data quality Biomedical data analysis DNA data analysis Protein data analysis Machine learning Neural network architecture and applications in bioinformatics. PART A Q.No Questions BT Level Competence 1 List the bioinformatics database. 2 Tabulate the information about error and discrepancies. 3 Deduce the KDD. 4 What is bioinformatics data? 5 Apply the data mining concept in bio informatics. BTL-3 Apply 6 Explain the four module of DNA database. 7 Illustrate the DNA component. BTL-3 Apply 8 Define Data quality. BTL -1 9 Differentiate the EMBL and GenBank. 10 Prepare the three major database for protein sequence. BTL-6 Create 11 Give the three steps of transcription. BTL-2 Understand 12 Differentiate the prokaryotes and eukaryotes 13 Develop the example of helix structure of DNA. BTL-6 Create 14 Define transcription. 15 Define the three layer feed forward neural network. 16 Discuss the machine learning and the three phases. BTL-2 17 Explain the neuron model. 18 Discuss the average mutual information. BTL-2 Understand 19 Express the Alignment tools for protein sequence. BTL-2 Understand 20 Show the general structure of amino acid. BTL-3 Apply PART B 1 i) Describe the nature of biological data and problems frequently encountered in managing them(8) ii) Draw the structure of a data warehouse.(5) 2 i) Express data warehousing principles and the basic architecture of a biological data warehouse.(7) ii) Design the Conceptual map of data warehousing process.(6) BTL-2 Understand 3 Describe the transforming data into knowledge using data warehousing.(13) 4 Solve the data quality in area of bio informatics.(13) BTL-3 Apply
5 5 i) Explain the three DNA sequence database.(6) ii) Explain the three databases for protein sequence. (7) BTL-4 Analyze 6 i) Explain the software tool that facilitate research in bio informatics.(7) ii) Design the helix of DNA sequence and explain it(6). 7 i) Discuss the sequence comparison and alignment.(7) ii) Design the general structure of amino acid.(6) BTL-2 Understand 8 i) Compare the protein sequences.(6) ii) Analyse the seven protein classes in SCOP.(7) 9 i) Develop the three layer neural network and explain it.(7) ii) Implement the Machine learning in Bioinformatics that research area.(6) 10 Examine the protein structure comparison(13) BTL-4 BTL-6 Analyze Create 11 Explain the neuron model architecture.(13) 12 Discuss Biological neural network and explain it.(13) BTL-2 Understand 13 Describe the training of neural network.(13) 14 Demonstrate the genetic algorithm in bio informatics.(13) PART-C BTL-3 Apply 1 Design your own DNA helix structure and explain it.(15) 2 Summarize the software tools which can be used in protein analysis.(15) 3 Design the neural network for simple calculator.(15) BTL-6 Create 4 Create the machine learning implementation in the bio informatics field.(15)
6 UNIT III MODELING FOR BIOINFORMATICS Hidden Markov modeling for biological data analysis Sequence identification Sequence classification multiple alignment generation Comparative modeling Protein modeling genomic modeling Probabilistic modeling Bayesian networks Boolean networks - Molecular modeling Computer programs for molecular modeling. PART A Q.No Questions BT Level Competence 1. List the three primary of HMM bio logical area 2. What is target sequence? 3. Deduce the TATA box. 4. Define the hierarchical framework for identification 5. Show the flowchart involved in the short sequence identification method. BTL-3 Apply 6. Explain the HMM form analysis. 7. Examine the sample HMM profile. BTL-3 Apply 8. List the major steps used in PHMM generation. BTL Point out the Viterbi algorithm. 10. Design the steps involved in the Viterbi algorithm. BTL-6 Create 11. Develop the steps to be followed to create an experimental framework for protein comparative BTL-6 Create modelling. 12. Design the Boolean cell regulation representation. 13. Distinguish the comparative modelling servers. BTL-2 Understand 14. Define comparative genomics List the two levels of comparative genomics 16. Explain the Bayesian network. BTL Differentiate the program for molecular mechanics. 18. Describe the SCFG. BTL-2 Understand 19. Discuss the different gene expression. BTL-2 Understand 20. Show the basic unit of probabilistic Boolean network. BTL-3 Apply PART B 1 Describe the Hidden Markov Modeling for Sequence Identification. (13) 2 Design Hidden Markov Modeling for Sequence classification.(13) 3 Describe Hidden Markov Modeling for Multiple Alignment Generation (13) 4 i)illustrate Flow Chart for Short Target Sequence Model Development(7) ii)demonstrate the HMM form analysis.(6) 5 i) Explain the concept of protein comparative modelling.(6) ii) Explain in detail the comparative genomic modelling.(7) BTL-2 BTL-3 BTL-4 Understand Apply Analyze
7 6 i) Compare the protein and genomic modelling.(7) ii) Summarize the probabilistic modelling.(6) 7 Discuss the Probabilistic Boolean Networks.(13) BTL-2 Understand 8 Write and Analyse the concept of Molecular and Related Visualization Applications.(13) BTL-4 Analyze 9 Design and development of the following visualization BTL-6 Create techniques: 1. Scatter plots(4) 2. Heat maps(3) 3. Multidimensional(3) 4. Anatomical mapping(3) 10 i)design the key steps for multiple alignment(7) ii) Explain it.(6) 11 Write about Differential gene expression(13) 12 Implement the software in the molecular BTL-2 Understand modelling.(13) 13 Describe about molecular mechanics.(13) 14 Analyze the following i) Homologous Enzymes 1QCQ (6) ii) Homologous Enzymes 2AAK(7) BTL-3 Apply PART-C 1. Analyse the HMM data with realistic data.(15) 2. Assess the detail about comparative modelling with any realistic data.(15) 3. Design the Bayesian network with real time environment. (15) BTL-6 Create 4. Design and explain the software used in molecular modelling.(15) UNIT IV
8 PATTERN MATCHING AND VISUALIZATION Gene regulation motif recognition motif detection strategies for motif detection Visualization Fractal analysis DNA walk models one dimension two dimension higher dimension Game representation of Biological sequences DNA, Protein, Amino acid sequences. PART A Q.No Questions BT Level Competence 1 Define motif. 2 Name the Transcription factors 3 Compare the two classes of promoters 4 Define Motif recognition 5 Show the consensus pattern BTL-3 Apply 6 Explain probability matrix 7 Illustrate phylogenetic profiling. BTL-3 Apply 8 List the two major approaches to increasing the statistical power of pattern recognition motif searching algorithms. BTL -1 9 Pointout the central dogma. 10 Design the DNA controls the biological functions BTL-6 Create 11 Classify the kinds of amino acids are found in proteins. BTL-2 Understand 12 Differentiate 13 Generalize the genetic code. BTL-6 Create 14 Define polypeptides. 15 What is detailed HP model? 16 Summarize the attractor of the IFS BTL-2 17 Explain the fractal. 18 Distinguish one dimension and two dimension DNA model BTL-2 Understand 19 Give the higher dimension DNA. BTL-2 Understand 20 Show the chaos game. BTL-3 Apply PART B 1 i) List the motif detection strategic (6) ii) Describe the Gene Regulation. (7) 2 Discuss the Motif Recognition.(13) BTL-2 Understand 3 Examine the Recurrent Iterated Function System Model.(13) 4 Demonstrate the Moment Method to Estimate the Parameters of the IFS.(13) BTL-3 Apply 5 i) Explain Multiracial Analysis (6) ii) Explain One-Dimensional DNA Walk.(7) 6 Assess the Two-Dimensional DNA Walk.(15) 7 Discuss the Game Representation of DNA Sequences.(13) BTL-2 Understand
9 8 Pointout the Game Representation of Protein sequences.(13) 9 Design the Game Representation of Protein Structures.(13) BTL-6 Create 10 Describe Two-Dimensional Portrait Representation of DNA Sequences(13) 11 Design and analyze the Game Representation of Amino Acid Sequences Based on the Detailed HP Model.(13) 12 Discuss the Measure Representation of Complete Genomes.(13) 13 Describe the Measure Representation of Linked Protein Sequences (13) 14 Illustrate Measure Representation of Protein Sequences Based on Detailed HP Model (13) BTL-2 Understand BTL-3 Apply PART-C 1 Analyze the concept of Pattern Matching for Motifs(15) 2 Deduce the Fractal Analysis of Biological Sequences(15) 3 Generalize the Chaos Game Representation of Biological Sequences(15) BTL-6 Create 4 the Chaos Game Representation of Protein Structures (15) UNIT V MICROARRAY ANALYSIS Microarray technology for genome expression study image analysis for data extraction preprocessing segmentation gridding spot extraction normalization, filtering cluster analysis gene network analysis Compared Evaluation of Scientific Data Management Systems Cost Matrix Evaluation model - Benchmark Tradeoffs. PART A Q.No Questions BT Level Competence 1 Define Microarray deals. 2 Name hybridization technique. 3 Assess the steps involved in a cdna microarray experiment. 4 Define Block segmentation. 5 Apply Automatic Gridding. BTL-3 Apply 6 Explain Spot Extraction. 7 Illustrate Cluster Analysis BTL-3 Apply 8 List the main advantages of the BHC clustering algorithm. BTL -1 9 Point out Original gene expression data
10 10 formulate Expression data after BHC clustering BTL-6 Create 11 Express Self-Splitting and Merging Competitive Learning Clustering BTL-2 Understand 12 Infer one-prototype-take-one-clusters. 13 Generalize Singular Value Decomposition. BTL-6 Create 14 Define Genome expression 15 Tell about the cdna 16 Summarize background correction. BTL-2 17 infer data normalization? 18 How the data filtering in microarray. BTL-2 Understand 19 Interpret missing values estimation. BTL-2 Understand 20 Show the TIFF format. BTL-3 Apply PART B 1 Describe Microarray Technology for Genome Expression Study.(13) 2 Summarize the Image Analysis for Data Extraction.(13) BTL-2 Understand 3 Describe the Temporal Expression Profile Analysis and Gene Regulation.(13) 4 Apply Gene Regulatory Network Analysis.(13) BTL-3 Apply 5 Explain the schematic of the cdna microarray technique.(13) 6 Summarize image processing in microarray technique.(13) BTL-4 Analyze 7 Discuss about the Data normalization and filtering.(13) BTL-2 Understand 8 Analyze the missing value analysis. (13) 9 Formulate the BHC cluster analysis.(13) BTL-6 Create 10 Examine the benchmark for gene network analysis.(13) 11 Explain Compared Evaluation of Scientific Data Management Systems.(13) 12 Discuss the cost matrix for gene network analysis. (13) BTL-2 Understand 13 Describe the trade off about gene network analysis.(13) 14 Explain the evolution model for gene network analysis.(13) PART-C 1 Analysis the genome expression study with real time data.(15) 2 the DNA structure with multi array technique(15) 3 Design the your data with BHC cluster analysis(15) BTL-6 Create 4 Summarize the concept of gene network analysis(15)
11
BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM)
BIOINFORMATICS AND SYSTEM BIOLOGY (INTERNATIONAL PROGRAM) PROGRAM TITLE DEGREE TITLE Master of Science Program in Bioinformatics and System Biology (International Program) Master of Science (Bioinformatics
More informationBioinformatics & Protein Structural Analysis. Bioinformatics & Protein Structural Analysis. Learning Objective. Proteomics
The molecular structures of proteins are complex and can be defined at various levels. These structures can also be predicted from their amino-acid sequences. Protein structure prediction is one of the
More informationThis place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic
More informationMARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305
MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 UNIT-1 MARINE GENOMICS AND PROTEOMICS 1. Define genomics? 2. Scope and functional genomics? 3. What is Genetics? 4. Define functional genomics? 5. What
More informationBIOINFORMATICS Introduction
BIOINFORMATICS Introduction Mark Gerstein, Yale University bioinfo.mbb.yale.edu/mbb452a 1 (c) Mark Gerstein, 1999, Yale, bioinfo.mbb.yale.edu What is Bioinformatics? (Molecular) Bio -informatics One idea
More informationVALLIAMMAI ENGINEERING COLLEGE
VALLIAMMAI ENGINEERING COLLEGE SRM Nagar, Kattankulathur 603 203 DEPARTMENT OF MECHANICAL ENGINEERING QUESTION BANK II SEMESTER PD5251 / INTEGRATED PRODUCT DESIGN AND PROCESS DEVELOPEMENT Regulation 2017
More informationHidden Markov Models. Some applications in bioinformatics
Hidden Markov Models Some applications in bioinformatics Hidden Markov models Developed in speech recognition in the late 1960s... A HMM M (with start- and end-states) defines a regular language L M of
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationBioinformatics Practical Course. 80 Practical Hours
Bioinformatics Practical Course 80 Practical Hours Course Description: This course presents major ideas and techniques for auxiliary bioinformatics and the advanced applications. Points included incorporate
More informationTextbook Reading Guidelines
Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: May 1, 2009 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science
More informationTextbook Reading Guidelines
Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: January 16, 2013 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science
More informationECS 234: Introduction to Computational Functional Genomics ECS 234
: Introduction to Computational Functional Genomics Administrativia Prof. Vladimir Filkov 3023 Kemper filkov@cs.ucdavis.edu Appts: Office Hours: M,W, 3-4pm, and by appt. , 4 credits, CRN: 54135 http://www.cs.ucdavis.edu~/filkov/234/
More information3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
More informationThis practical aims to walk you through the process of text searching DNA and protein databases for sequence entries.
PRACTICAL 1: BLAST and Sequence Alignment The EBI and NCBI websites, two of the most widely used life science web portals are introduced along with some of the principal databases: the NCBI Protein database,
More informationMachine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
More informationBIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis
BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology Lecture 2: Microarray analysis Genome wide measurement of gene transcription using DNA microarray Bruce Alberts, et al., Molecular Biology
More informationFollowing text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005
Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of
More informationECS 234: Introduction to Computational Functional Genomics ECS 234
: Introduction to Computational Functional Genomics Administrativia Prof. Vladimir Filkov 3023 Kemper filkov@cs.ucdavis.edu Appts: Office Hours: Wednesday, 1:30-3p Ask me or email me any time for appt
More informationThe application of hidden markov model in building genetic regulatory network
J. Biomedical Science and Engineering, 2010, 3, 633-637 doi:10.4236/bise.2010.36086 Published Online June 2010 (http://www.scirp.org/ournal/bise/). The application of hidden markov model in building genetic
More informationStudy on the Application of Data Mining in Bioinformatics. Mingyang Yuan
International Conference on Mechatronics Engineering and Information Technology (ICMEIT 2016) Study on the Application of Mining in Bioinformatics Mingyang Yuan School of Science and Liberal Arts, New
More informationCENTER FOR BIOTECHNOLOGY
CENTER FOR BIOTECHNOLOGY Keith A. McGee, Ph.D., Program Director Math and Science Building, 3 rd Floor 1000 ASU Drive #870 Phone: 601-877-6198 FAX: 601-877-2328 Degree Offered Required Admission Test M.
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Changhui (Charles) Yan Old Main 401 F http://www.cs.usu.edu www.cs.usu.edu/~cyan 1 How Old Is The Discipline? "The term bioinformatics is a relatively recent invention, not
More informationClassification and Learning Using Genetic Algorithms
Sanghamitra Bandyopadhyay Sankar K. Pal Classification and Learning Using Genetic Algorithms Applications in Bioinformatics and Web Intelligence With 87 Figures and 43 Tables 4y Spri rineer 1 Introduction
More informationBiology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
More informationCMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS
CMSE 520 BIOMOLECULAR STRUCTURE, FUNCTION AND DYNAMICS (Computational Structural Biology) OUTLINE Review: Molecular biology Proteins: structure, conformation and function(5 lectures) Generalized coordinates,
More informationMATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 1 Intro to Molecular Biology Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/14 Announcements Homework 1 due next Tuesday
More informationExamination Assignments
Bioinformatics Institute of India H-109, Ground Floor, Sector-63, Noida-201307, UP. INDIA Tel.: 0120-4320801 / 02, M. 09818473366, 09810535368 Email: info@bii.in, Website: www.bii.in INDUSTRY PROGRAM IN
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Dortmund, 16.-20.07.2007 Lectures: Sven Rahmann Exercises: Udo Feldkamp, Michael Wurst 1 Goals of this course Learn about Software tools Databases Methods (Algorithms) in
More informationCSC 2427: Algorithms in Molecular Biology Lecture #14
CSC 2427: Algorithms in Molecular Biology Lecture #14 Lecturer: Michael Brudno Scribe Note: Hyonho Lee Department of Computer Science University of Toronto 03 March 2006 Microarrays Revisited In the last
More informationadvanced analysis of gene expression microarray data aidong zhang World Scientific State University of New York at Buffalo, USA
advanced analysis of gene expression microarray data aidong zhang State University of New York at Buffalo, USA World Scientific NEW JERSEY LONDON SINGAPORE BEIJING SHANGHAI HONG KONG TAIPEI CHENNAI Contents
More informationVALLIAMMAI ENGNIEERING COLLEGE SRM Nagar, Kattankulathur
VALLIAMMAI ENGNIEERING COLLEGE SRM Nagar, Kattankulathur 603203. DEPARTMENT OF COMPUTER SCIENCE AND ENGINEERING Year & Semester : III & VI Section : CSE 1 Subject Code : IT6004 Subject Name : SOFTWARE
More informationRepresentation in Supervised Machine Learning Application to Biological Problems
Representation in Supervised Machine Learning Application to Biological Problems Frank Lab Howard Hughes Medical Institute & Columbia University 2010 Robert Howard Langlois Hughes Medical Institute What
More informationAC Algorithms for Mining Biological Sequences (COMP 680)
AC-04-18 Algorithms for Mining Biological Sequences (COMP 680) Instructor: Mathieu Blanchette School of Computer Science and McGill Centre for Bioinformatics, 332 Duff Building McGill University, Montreal,
More informationGrundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1
More informationGene Identification in silico
Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction
More informationBioinformatics. Microarrays: designing chips, clustering methods. Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute
Bioinformatics Microarrays: designing chips, clustering methods Fran Lewitter, Ph.D. Head, Biocomputing Whitehead Institute Course Syllabus Jan 7 Jan 14 Jan 21 Jan 28 Feb 4 Feb 11 Feb 18 Feb 25 Sequence
More informationInferring Gene Networks from Microarray Data using a Hybrid GA p.1
Inferring Gene Networks from Microarray Data using a Hybrid GA Mark Cumiskey, John Levine and Douglas Armstrong johnl@inf.ed.ac.uk http://www.aiai.ed.ac.uk/ johnl Institute for Adaptive and Neural Computation
More informationRESEARCH METHODOLOGY, BIOSTATISTICS AND IPR
MB 401: RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR Objectives: The overall aim of the course is to deepen knowledge regarding basic concepts of Biostatistics, the research process in occupational therapy
More informationData Mining for Biological Data Analysis
Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han
More informationand Promoter Sequence Data
: Combining Gene Expression and Promoter Sequence Data Outline 1. Motivation Functionally related genes cluster together genes sharing cis-elements cluster together transcriptional regulation is modular
More informationNagahama Institute of Bio-Science and Technology. National Institute of Genetics and SOKENDAI Nagahama Institute of Bio-Science and Technology
A Large-scale Batch-learning Self-organizing Map for Function Prediction of Poorly-characterized Proteins Progressively Accumulating in Sequence Databases Project Representative Toshimichi Ikemura Authors
More informationGene Expression Data Analysis
Gene Expression Data Analysis Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu BMIF 310, Fall 2009 Gene expression technologies (summary) Hybridization-based
More informationGenBank Growth. In 2003 ~ 31 million sequences ~ 37 billion base pairs
Gene Finding GenBank Growth GenBank Growth In 2003 ~ 31 million sequences ~ 37 billion base pairs GenBank: Exponential Growth Growth of GenBank in billions of base pairs from release 3 in April of 1994
More informationScoring Alignments. Genome 373 Genomic Informatics Elhanan Borenstein
Scoring Alignments Genome 373 Genomic Informatics Elhanan Borenstein A quick review Course logistics Genomes (so many genomes) The computational bottleneck Python: Programs, input and output Number and
More informationBIRKBECK COLLEGE (University of London)
BIRKBECK COLLEGE (University of London) SCHOOL OF BIOLOGICAL SCIENCES M.Sc. EXAMINATION FOR INTERNAL STUDENTS ON: Postgraduate Certificate in Principles of Protein Structure MSc Structural Molecular Biology
More informationNNvPDB: Neural Network based Protein Secondary Structure Prediction with PDB Validation
www.bioinformation.net Web server Volume 11(8) NNvPDB: Neural Network based Protein Secondary Structure Prediction with PDB Validation Seethalakshmi Sakthivel, Habeeb S.K.M* Department of Bioinformatics,
More informationPéter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS
Péter Antal Ádám Arany Bence Bolgár András Gézsi Gergely Hajós Gábor Hullám Péter Marx András Millinghoffer László Poppe Péter Sárközy BIOINFORMATICS The Bioinformatics book covers new topics in the rapidly
More information2/19/13. Contents. Applications of HMMs in Epigenomics
2/19/13 I529: Machine Learning in Bioinformatics (Spring 2013) Contents Applications of HMMs in Epigenomics Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2013 Background:
More informationBioinformatics : Gene Expression Data Analysis
05.12.03 Bioinformatics : Gene Expression Data Analysis Aidong Zhang Professor Computer Science and Engineering What is Bioinformatics Broad Definition The study of how information technologies are used
More informationApplications of HMMs in Epigenomics
I529: Machine Learning in Bioinformatics (Spring 2013) Applications of HMMs in Epigenomics Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2013 Contents Background:
More informationGiri Narasimhan. CAP 5510: Introduction to Bioinformatics. ECS 254; Phone: x3748
CAP 5510: Introduction to Bioinformatics Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs07.html 2/8/07 CAP5510 1 Pattern Discovery 2/8/07 CAP5510 2 What we have
More informationBIOINFORMATICS THE MACHINE LEARNING APPROACH
88 Proceedings of the 4 th International Conference on Informatics and Information Technology BIOINFORMATICS THE MACHINE LEARNING APPROACH A. Madevska-Bogdanova Inst, Informatics, Fac. Natural Sc. and
More informationNeural Networks and Applications in Bioinformatics. Yuzhen Ye School of Informatics and Computing, Indiana University
Neural Networks and Applications in Bioinformatics Yuzhen Ye School of Informatics and Computing, Indiana University Contents Biological problem: promoter modeling Basics of neural networks Perceptrons
More informationComputers in Biology and Bioinformatics
Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors of organisms, how species and individuals come
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationNeural Networks and Applications in Bioinformatics
Contents Neural Networks and Applications in Bioinformatics Yuzhen Ye School of Informatics and Computing, Indiana University Biological problem: promoter modeling Basics of neural networks Perceptrons
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationEngineering Genetic Circuits
Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art
More informationProtein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)
Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical
More informationKlinisk kemisk diagnostik BIOINFORMATICS
Klinisk kemisk diagnostik - 2017 BIOINFORMATICS What is bioinformatics? Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological,
More informationWhat s New in Discovery Studio 2.5.5
What s New in Discovery Studio 2.5.5 Discovery Studio takes modeling and simulations to the next level. It brings together the power of validated science on a customizable platform for drug discovery research.
More informationEstimating Cell Cycle Phase Distribution of Yeast from Time Series Gene Expression Data
2011 International Conference on Information and Electronics Engineering IPCSIT vol.6 (2011) (2011) IACSIT Press, Singapore Estimating Cell Cycle Phase Distribution of Yeast from Time Series Gene Expression
More informationPREDICTING EMPLOYEE ATTRITION THROUGH DATA MINING
PREDICTING EMPLOYEE ATTRITION THROUGH DATA MINING Abbas Heiat, College of Business, Montana State University, Billings, MT 59102, aheiat@msubillings.edu ABSTRACT The purpose of this study is to investigate
More informationA New Database of Genetic and. Molecular Pathways. Minoru Kanehisa. sequencing projects have been. Mbp) and for several bacteria including
Toward Pathway Engineering: A New Database of Genetic and Molecular Pathways Minoru Kanehisa Institute for Chemical Research, Kyoto University From Genome Sequences to Functions The Human Genome Project
More information2/10/17. Contents. Applications of HMMs in Epigenomics
2/10/17 I529: Machine Learning in Bioinformatics (Spring 2017) Contents Applications of HMMs in Epigenomics Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2017 Background:
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationOur view on cdna chip analysis from engineering informatics standpoint
Our view on cdna chip analysis from engineering informatics standpoint Chonghun Han, Sungwoo Kwon Intelligent Process System Lab Department of Chemical Engineering Pohang University of Science and Technology
More informationBIMM 143: Introduction to Bioinformatics (Winter 2018)
BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST
More informationVolume 3, Issue 10, October 2015 International Journal of Advance Research in Computer Science and Management Studies
Volume 3, Issue 10, October 2015 International Journal of Advance Research in Computer Science and Management Studies Research Article / Survey Paper / Case Study Available online at: www.ijarcsms.com
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationPCA and SOM based Dimension Reduction Techniques for Quaternary Protein Structure Prediction
PCA and SOM based Dimension Reduction Techniques for Quaternary Protein Structure Prediction Sanyukta Chetia Department of Electronics and Communication Engineering, Gauhati University-781014, Guwahati,
More informationChapter 8 Data Analysis, Modelling and Knowledge Discovery in Bioinformatics
Chapter 8 Data Analysis, Modelling and Knowledge Discovery in Bioinformatics Prof. Nik Kasabov nkasabov@aut.ac.nz http://www.kedri.info 12/16/2002 Nik Kasabov - Evolving Connectionist Systems Overview
More informationLecture 10. Ab initio gene finding
Lecture 10 Ab initio gene finding Uses of probabilistic sequence Segmentation models/hmms Multiple alignment using profile HMMs Prediction of sequence function (gene family models) ** Gene finding ** Review
More informationPerspectives on the Priorities for Bioinformatics Education in the 21 st Century
Perspectives on the Priorities for Bioinformatics Education in the 21 st Century Oyekanmi Nash, PhD Associate Professor & Director Genetics, Genomics & Bioinformatics National Biotechnology Development
More informationBioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University
Bioinformatics: Sequence Analysis COMP 571 Luay Nakhleh, Rice University Course Information Instructor: Luay Nakhleh (nakhleh@rice.edu); office hours by appointment (office: DH 3119) TA: Leo Elworth (DH
More informationIntroduction. CS482/682 Computational Techniques in Biological Sequence Analysis
Introduction CS482/682 Computational Techniques in Biological Sequence Analysis Outline Course logistics A few example problems Course staff Instructor: Bin Ma (DC 3345, http://www.cs.uwaterloo.ca/~binma)
More informationState of Texas Assessments of Academic Readiness (STAAR ) Performance Level Descriptors Biology
State of Texas Assessments of Academic Readiness (STAAR ) Biology Scientific process skills are not assessed in isolation but are incorporated into questions that assess the biology content. These process
More informationTowards Gene Network Estimation with Structure Learning
Proceedings of the Postgraduate Annual Research Seminar 2006 69 Towards Gene Network Estimation with Structure Learning Suhaila Zainudin 1 and Prof Dr Safaai Deris 2 1 Fakulti Teknologi dan Sains Maklumat
More informationAdvanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018
Advanced Bioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2018 Anthony Gitter gitter@biostat.wisc.edu www.biostat.wisc.edu/bmi776/ These slides, excluding third-party
More informationBioinformatics. Ingo Ruczinski. Some selected examples... and a bit of an overview
Bioinformatics Some selected examples... and a bit of an overview Department of Biostatistics Johns Hopkins Bloomberg School of Public Health July 19, 2007 @ EnviroHealth Connections Bioinformatics and
More informationGenetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
More informationBIOLOGY 200 Molecular Biology Students registered for the 9:30AM lecture should NOT attend the 4:30PM lecture.
BIOLOGY 200 Molecular Biology Students registered for the 9:30AM lecture should NOT attend the 4:30PM lecture. Midterm date change! The midterm will be held on October 19th (likely 6-8PM). Contact Kathy
More informationMachine learning applications in genomics: practical issues & challenges. Yuzhen Ye School of Informatics and Computing, Indiana University
Machine learning applications in genomics: practical issues & challenges Yuzhen Ye School of Informatics and Computing, Indiana University Reference Machine learning applications in genetics and genomics
More informationONLINE BIOINFORMATICS RESOURCES
Dedan Githae Email: d.githae@cgiar.org BecA-ILRI Hub; Nairobi, Kenya 16 May, 2014 ONLINE BIOINFORMATICS RESOURCES Introduction to Molecular Biology and Bioinformatics (IMBB) 2014 The larger picture.. Lower
More informationStructural Analysis of the EGR Family of Transcription Factors: Templates for Predicting Protein DNA Interactions
Introduction Structural Analysis of the EGR Family of Transcription Factors: Templates for Predicting Protein DNA Interactions Jamie Duke, Rochester Institute of Technology Mentor: Carlos Camacho, University
More informationComputational DNA Sequence Analysis
Micah Acinapura Senior Seminar Fall 2003 Survey Paper Computational DNA Sequence Analysis Introduction While all the sciences help people expand their knowledge of our universe, biology holds as special
More informationHomework 4. Due in class, Wednesday, November 10, 2004
1 GCB 535 / CIS 535 Fall 2004 Homework 4 Due in class, Wednesday, November 10, 2004 Comparative genomics 1. (6 pts) In Loots s paper (http://www.seas.upenn.edu/~cis535/lab/sciences-loots.pdf), the authors
More informationECS 234: Genomic Data Integration ECS 234
: Genomic Data Integration Heterogeneous Data Integration DNA Sequence Microarray Proteomics >gi 12004594 gb AF217406.1 Saccharomyces cerevisiae uridine nucleosidase (URH1) gene, complete cds ATGGAATCTGCTGATTTTTTTACCTCACGAAACTTATTAAAACAGATAATTTCCCTCATCTGCAAGGTTG
More informationIntroduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
More informationGene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
More informationWhat is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases.
What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. Bioinformatics is the marriage of molecular biology with computer
More informationExploring Similarities of Conserved Domains/Motifs
Exploring Similarities of Conserved Domains/Motifs Sotiria Palioura Abstract Traditionally, proteins are represented as amino acid sequences. There are, though, other (potentially more exciting) representations;
More informationComputational Methods for Protein Structure Prediction and Fold Recognition... 1 I. Cymerman, M. Feder, M. PawŁowski, M.A. Kurowski, J.M.
Contents Computational Methods for Protein Structure Prediction and Fold Recognition........................... 1 I. Cymerman, M. Feder, M. PawŁowski, M.A. Kurowski, J.M. Bujnicki 1 Primary Structure Analysis...................
More informationEE550 Computational Biology
EE550 Computational Biology Week 1 Course Notes Instructor: Bilge Karaçalı, PhD Syllabus Schedule : Thursday 13:30, 14:30, 15:30 Text : Paul G. Higgs, Teresa K. Attwood, Bioinformatics and Molecular Evolution,
More informationMolecular Modeling 9. Protein structure prediction, part 2: Homology modeling, fold recognition & threading
Molecular Modeling 9 Protein structure prediction, part 2: Homology modeling, fold recognition & threading The project... Remember: You are smarter than the program. Inspecting the model: Are amino acids
More informationLecture 1. Bioinformatics 2. About me... The class (2009) Course Outcomes. What do I think you know?
Lecture 1 Bioinformatics 2 Introduction Course Overview & Assessment Introduction to Bioinformatics Research Careers and PhD options Core topics in Bioinformatics the central dogma of molecular biology
More informationKEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected
Section 1: Identifying DNA as the Genetic Material KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage MAIN IDEA: Griffith finds a transforming
More informationBioinformatics 2. Lecture 1
Bioinformatics 2 Introduction Lecture 1 Course Overview & Assessment Introduction to Bioinformatics Research Careers and PhD options Core topics in Bioinformatics the central dogma of molecular biology
More information