Methods in Molecular Biology Yinduo Ji Editor. Methicillin-Resistant Staphylococcus aureus (MRSA) Protocols. Second Edition

Transcription

1 Methods in Molecular Biology 1085 Yinduo Ji Editor Methicillin-Resistant Staphylococcus aureus (MRSA) Protocols Second Edition

2 M ETHODS IN MOLECULAR BIOLOGY Series Editor John M. Walker School of Life Sciences University of Hertfordshire Hat fi eld, Hertfordshire, AL10 9AB, UK For further volumes:

3

4 Methicillin-Resistant Staphylococcus aureus (MRSA) Protocols Second Edition Edited by Yinduo Ji Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN, USA

5 Editor Yinduo Ji Department of Veterinary and Biomedical Sciences College of Veterinary Medicine University of Minnesota St. Paul, MN, USA ISSN ISSN (electronic) ISBN ISBN (ebook) DOI / Springer New York Heidelberg Dordrecht London Library of Congress Control Number: Springer Science+Business Media, LLC 2014 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. Exempted from this legal reservation are brief excerpts in connection with reviews or scholarly analysis or material supplied specifically for the purpose of being entered and executed on a computer system, for exclusive use by the purchaser of the work. Duplication of this publication or parts thereof is permitted only under the provisions of the Copyright Law of the Publisher s location, in its current version, and permission for use must always be obtained from Springer. Permissions for use may be obtained through RightsLink at the Copyright Clearance Center. Violations are liable to prosecution under the respective Copyright Law. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. While the advice and information in this book are believed to be true and accurate at the date of publication, neither the authors nor the editors nor the publisher can accept any legal responsibility for any errors or omissions that may be made. The publisher makes no warranty, express or implied, with respect to the material contained herein. Printed on acid-free paper Humana Press is a brand of Springer Springer is part of Springer Science+Business Media (

6 Pref ace Staphylococcus aureus is one of the major bacterial pathogens that commonly causes superficial skin and soft tissue infections, surgical wood infections, and sometimes-fatal bloodstream infections and pneumonia. The continuing emergence of drug-resistant pathogens, especially multiple-drug-resistant isolates and methicillin-resistant S. aureus (MRSA), is causing serious concerns in the public health due to the limited choice of antibiotics for effective treatment of MRSA infections. The availability of whole genome sequences and advanced high-throughput technologies enables us to develop a specific and rapid diagnosis method, investigate and elucidate mechanisms of bacterial evolution to antibiotic resistance and pathogenicity, and to identify novel targets to develop more potent therapeutic and/or preventive agents. Since the publication of first edition, there have been tremendous advances on S. aureus genomes and technologies, including advanced next-generation RNA sequencing technologies. The aim of this second edition of the MRSA protocol book is to provide an advanced and comprehensive collection of the most up-to-date techniques for the detection, genotyping, and investigation of MRSA. Each chapter starts with a brief introduction to the method and its purpose and then almost immediately goes on to provide very detailed protocols for every step of the analysis. The protocol chapters also contain a section with tips on individual steps that are not usually found in a methods book but that may represent the difference between immediate success and lengthy troubleshooting. This book is an excellent starting point for anyone who wants or needs to set up a new method to study MRSA. Most of the methods are oriented toward routine clinical diagnosis, surveillance, research, and actual practice for treatment of patients infected by MRSA. Importantly, we include several review chapters to allow the scientists and clinicians to better understand the epidemiology of MRSA, overall diagnosis and molecular typing approaches, clinical treatment of MRSA infections, as well as the status of drug discovery for combating MRSA. Although the book mainly focuses on MRSA, it should be a valuable reference for technicians and scientists working on other pathogens. St. Paul, MN Yinduo Ji v

7

8 Contents Preface... Contributors... v ix 1 Clinical, Epidemiologic, and Laboratory Aspects of Methicillin-Resistant Staphylococcus aureus Infections... 1 Elizabeth L. Palavecino 2 Community-Associated Methicillin-Resistant Staphylococcus aureus Case Studies Madeleine G. Sowash and Anne-Catrin Uhlemann 3 Rapid Methods for Detection of MRSA in Clinical Specimens Elizabeth L. Palavecino 4 Immunofluorescence Microscopy for the Detection of Surface Antigens in Methicillin-Resistant Staphylococcus aureus (MRSA) Yekaterina Timofeyeva, Ingrid L. Scully, and Annaliesa S. Anderson 5 Internal Transcribed Spacer (ITS)-PCR Identification of MRSA Shin-ichi Fujita 6 Pulsed-Field Gel Electrophoresis Typing of Staphylococcus aureus Isolates Yiping He, Yanping Xie, and Sue Reed 7 Multilocus Sequence Typing (MLST) of Staphylococcus aureus Nicholas A. Saunders and Anne Holmes 8 Staphylococcal Cassette Chromosome mec (SCCmec) Analysis of MRSA Teruyo Ito, Kyoko Kuwahara-Arai, Yuki Katayama, Yuki Uehara, Xiao Han, Yoko Kondo, and Keiichi Hiramatsu 9 Genetic Interruption of Target Genes for Investigation of Virulence Factors Adhar C. Manna 10 Molecular Analysis of Staphylococcal Superantigens Wilmara Salgado-Pabón, Laura C. Case-Cook, and Patrick M. Schlievert 11 Investigation of Staphylococcus aureus Adhesion and Invasion of Host Cells Junshu Yang and Yinduo Ji 12 Investigation of Biofilm Formation in Clinical Isolates of Staphylococcus aureus James E. Cassat, Mark S. Smeltzer, and Chia Y. Lee vii

9 viii Contents 13 Transcriptomic Analysis of Staphylococcus aureus Using Microarray and Advanced Next-Generation RNA-seq Technologies Ting Lei, Aaron Becker, and Yinduo Ji 14 Proteomic Approach to Investigate Pathogenicity and Metabolism of Methicillin-Resistant Staphylococcus aureus Patrice François, Alexander Scherl, Denis Hochstrasser, and Jacques Schrenzel 15 Metabolomic Investigation of Methicillin-Resistant Staphylococcus aureus Ting Lei, Lei Wang, Chi Chen, and Yinduo Ji 16 Treatment of Infections Due to Resistant Staphylococcus aureus Gregory M. Anstead, Jose Cadena, and Heta Javeri 17 Anti-infective Drug Development for MRSA Anu Daniel 18 Animal Models in Drug Development for MRSA Andrea Marra Index

10 Contributors ANNALIESA S. ANDERSON Pfizer Vaccine Research, Pearl River, NY, USA GREGORY M. ANSTEAD Medicine Service, South Texas Veterans Health Care System, San Antonio, TX, USA; Division of Infectious Diseases, Department of Medicine, University of Texas Health Science Center at San Antonio, San Antonio, TX, USA AARON BECKER Biomedical Genomics Center, University of Minnesota, St. Paul, MN, USA JOSE CADENA Medicine Service, South Texas Veterans Health Care System, San Antonio, TX, USA; Division of Infectious Diseases, Department of Medicine, University of Texas Health Science Center at San Antonio, San Antonio, TX, USA LAURA C. CASE-COOK Center for Pharmaceutical Biotechnology, University of Illinois at Chicago, Chicago, IL, USA JAMES E. CASSAT Division of Pediatric Infectious Diseases, Vanderbilt University Medical Center, Nashville, TN, USA CHI CHEN Department of Food Science and Nutrition, University of Minnesota, St. Paul, MN, USA ANU DANIEL Cubist Pharmaceuticals, Lexington, MA, USA PATRICE FRANÇOIS Service of Infectious Diseases, Genomic Research Laboratory, Geneva, Switzerland SHIN-ICHI FUJITA Department of Laboratory Sciences, School of Health Sciences, Kanazawa University, Kanazawa, Japan XIAO HAN Department of Infection Control Science, Graduate School of Medicine, Juntendo University, Tokyo, Japan YIPING HE Molecular Characterization of Foodborne Pathogens Research Unit, US Department of Agriculture, Agricultural Research Service, Eastern Regional Research Center, Wyndmoor, PA, USA KEIICHI HIRAMATSU Department of Infection Control Science, Graduate School of Medicine, Juntendo University, Tokyo, Japan DENIS HOCHSTRASSER Department of Human Protein Sciences, Faculty of Medicine, Geneva University, Department of Genetic and Laboratory Medicine, Geneva University Hospitals, Geneva, Switzerland ANNE HOLMES Laboratory of HealthCare Associated Infections, Centre for Infections, Health Protection Agency, London, UK TERUYO ITO Department of Infection Control Science, Graduate School of Medicine, Juntendo University, Tokyo, Japan HETA JAVERI Division of Infectious Diseases, Department of Medicine, University of Texas Health Science Center at San Antonio, San Antonio, TX, USA YINDUO JI Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN, USA YUKI KATAYAMA Department of Infection Control Science, Graduate School of Medicine, Juntendo University, Tokyo, Japan ix

11 x Contributors YOKO KONDO Department of Infection Control Science, Graduate School of Medicine, Juntendo University, Tokyo, Japan KYOKO KUWAHARA-ARAI Department of Infection Control Science, Graduate School of Medicine, Juntendo University, Tokyo, Japan CHIA Y. LEE Department of Microbiology and Immunology, University of Arkansas for Medical Sciences, Little Rock, AR, USA TING LEI Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN, USA ADHAR C. MANNA Department of Biological Sciences, Presidency University, Kolkata, WB, India ANDREA MARRA Rib-X Pharmaceuticals, Inc., New Haven, CT, USA ELIZABETH L. PALAVECINO Department of Pathology, Wake Forest School of Medicine, Winston-Salem, NC, USA SUE REED Molecular Characterization of Foodborne Pathogens Research Unit, Eastern Regional Research Center, Agricultural Research Service, United States Department of Agriculture, Wyndmoor, PA, USA WILMARA SALGADO-PABÓN Department of Microbiology, University of Iowa Carver College of Medicine, Iowa City, IA, USA NICHOLAS A. SAUNDERS Communicable Disease Microbiology Services Support Division, Centre for Infections, Health Protection Agency, London, UK ALEXANDER SCHERL Biomedical Proteomics Research Group, Department of Human Protein Sciences, Swiss Center of Applied Human Toxicology, University Medical Center, Geneva, Switzerland PATRICK M. SCHLIEVERT Department of Microbiology, University of Iowa Carver College of Medicine, Iowa City, IA, USA JACQUES SCHRENZEL Genomic Research Laboratory, Division of Infectious Diseases, Geneva University Hospitals, Geneva, Switzerland INGRID L. SCULLY Pfizer Vaccine Research, Pearl River, NY, USA MARK S. SMELTZER Department of Microbiology and Immunology, University of Arkansas for Medical Sciences, Little Rock, AR, USA MADELEINE G. SOWASH Division of Infectious Diseases, Department of Medicine, College of Physicians & Surgeons, Columbia University, New York, NY, USA YEKATERINA TIMOFEYEVA Pfizer Vaccine Research, Pearl River, NY, USA YUKI UEHARA Department of Infection Control Science, Graduate School of Medicine, Juntendo University, Tokyo, Japan ANNE-CATRIN UHLEMANN Division of Infectious Diseases, Department of Medicine, College of Physicians & Surgeons, Columbia University, New York, NY, USA LEI WANG Department of Food Science and Nutrition, University of Minnesota, St. Paul, MN, USA YANPING XIE Molecular Characterization of Foodborne Pathogens Research Unit, Eastern Regional Research Center, Agricultural Research Service, United States Department of Agriculture, Wyndmoor, PA, USA JUNSHU YANG Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN, USA

12 Chapter 1 Clinical, Epidemiologic, and Laboratory Aspects of Methicillin-Resistant Staphylococcus aureus Infections Elizabeth L. Palavecino Abstract Methicillin-resistant Staphylococcus aureus (MRSA) is a major pathogen responsible for both hospital and community onset disease. Resistance to methicillin in S. aureus is mediated by PBP2a, a penicillin-binding protein with low affinity to beta-lactams, encoded by the mec A gene. Accurate susceptibility testing of S. aureus isolates and screening of patients for colonization with MRSA are important tools to limit the spread of this organism. This review focuses on the clinical significance of MRSA infections and new approaches for the laboratory diagnosis and epidemiologic typing of MRSA strains. Key words Staphylococcus aureus, MRSA, HA-MRSA, CA-MRSA, Antimicrobial resistance, Staphylococcal infections, Susceptibility testing, Molecular typing, Virulence 1 Introduction Historically Staphylococcus aureus has been recognized as an important cause of disease around the world and it has become a major pathogen associated with both hospital- and community-acquired infections. Before the availability of antibiotics, invasive infections caused by S. aureus were often fatal. The introduction of penicillin greatly improved the prognosis for patients with severe staphylococcal infections, but after a few years of clinical use, resistance appeared due to production of beta-lactamases. Methicillin was designed to resist beta-lactamase degradation, but MRSA strains, which were resistant to all beta-lactam antibiotics, were identified soon after methicillin was introduced into clinical practice. Until recently, MRSA was predominantly a nosocomial pathogen causing hospital-acquired infections, but MRSA strains are now being increasingly isolated from community-acquired infections as well. Vancomycin has been the antibiotic of choice to treat MRSA infections, and the emergence of vancomycin-non-susceptible Yinduo Ji (ed.), Methicillin-Resistant Staphylococcus aureus (MRSA) Protocols, Methods in Molecular Biology, vol. 1085, DOI / _1, Springer Science+Business Media, LLC

13 2 Elizabeth L. Palavecino S. aureus reported in recent years is a cause of great public health concern and has made therapy of MRSA infections even more challenging for the clinicians. The purpose of this review is to discuss the clinical significance of MRSA infections, to present the mechanisms of antimicrobial resistance to oxacillin and vancomycin, and to comment on the current recommendations for susceptibility testing and rapid detection of MRSA strains. 2 Clinical Significance of MRSA Infections 2.1 Hospital- Associated MRSA (HA-MRSA) Strains 2.2 Community- Acquired MRSA (CA-MRSA) Strains Since the time that methicillin resistance emerged, MRSA has become widespread in hospitals worldwide causing bacteremia, pneumonia, surgical site infections, and other nosocomial infections [ 1 5 ]. Nosocomial MRSA infections represent a burden for both patients and health care systems, because of their association with high morbidity and mortality and increased hospitalization costs [ 6, 7 ]. Recent data from the Centers for Disease Control and Prevention showed that that almost 60 % of all health-care associated S. aureus infections in the USA are due to MRSA [ 8 ]. In a nationwide surveillance study of nosocomial bloodstream infections (BSI), investigators reported that S. aureus was the second most-common organism causing BSI and that the proportion of MRSA isolates increased from 22 % in 1995 to 57 % in 2001 [ 9 ]. Data from Antimicrobial Surveillance Programs have also reported increasing rates of MRSA among S. aureus isolated from ICU patients throughout the world [ 5, 10 ]. Furthermore, investigators have found that over the last 10 years MRSA strains have overtaken and replaced methicillin susceptible S. aureus (MSSA) strains as the leading cause of staphylococcal infections, which in turn have become more prevalent [ 11 ]. In the past decade MRSA strains have emerged in the community setting, causing infections in patients who do not have the risk factors usually associated with HA-MRSA, such as recent hospitalization, chronic diseases, kidney dialysis, HIV infection, and intravenous drug use [ 12, 13 ] Although CA-MRSA strains cause mostly skin abscesses and furunculosis, severe necrotizing pneumonia and shock resulting in death has also been associated with CA-MRSA [ 14, 15 ]. These new CA-MRSA strains are usually resistant to beta-lactams but susceptible to other antimicrobial classes and carry mostly staphylococcal cassette chromosome mec (SCC mec ) type IV, V, or VII. CA-MRSA strains are also more likely to possess unique combinations of virulence factors and seem to be genetically different from HA-MRSA [ 12, ]. Investigators have suggested that CA-MRSA strains have arisen from different genetic backgrounds rather than the worldwide

14 Laboratory Detection of MRSA Isolates: A Review 3 spread of a single clone [ 20 ] and that more S. aureus lineages have the ability to become CA-MRSA [ 21 ]. Initially, CA-MRSA strains were isolated exclusively from infections acquired in the community and found to be phenotypically and genotypically different from HA-MRSA strains. However, the distinction between HA-MRSA and CA-MRSA has started to fade away, as an increased number of reports have demonstrated that CA-MRSA is now endemic in many US hospitals [ ]. Furthermore, in areas with high prevalence of CA-MRSA clones, such as USA300 in the USA, CA-MRSA strains have emerged as a cause of health care-associated infections and have begun to replace the traditional HA-MRSA strains in many health care systems [ 25, 26 ]. Because CA-MRSA infections can occur in patients with no risk factors, the potential at-risk group for infection is greater than with the traditional HA-MRSA strains. Although it was theorized that CA-MRSA strains would not survive the hospital environment due to their susceptibility to agents other than beta-lactams, it is now apparent that CA-MRSA clones have the potential for acquiring new resistance traits and may become resistant to other classes of antimicrobial agents [ 27 ]. 2.3 Livestock MRSA (LA-MRSA) In recent years there has arisen an increasing awareness of the potential reservoir of MRSA in animals, particularly in pigs. Epidemiological studies in several countries in Europe have shown that a high prevalence of nasal carriage of MRSA strains belong to the MLST type ST398 in human in contact with pigs. This MRSA ST398 strain has also been found in herds of swine in the USA [ 28 ]. Furthermore, human infections caused by the LA-MRSA strain ST398 have been reported in patients that have had contact with pigs [ 29 ]. The LA-MRSA strain has also been isolated in humans without history of animal exposure [ 30 ]. 3 Virulence Factors The pathogenicity and virulence of S. aureus is associated with the capacity of this organism to produce several virulence factors including enterotoxins serotypes A through Q (SEA-SEQ), toxic shock syndrome toxin-1 (TSST-1), cytolytic toxins (alpha and beta hemolysins), exfoliative toxins, Panton Valentine leukocidin (PVL), protein A, and several enzymes [ 31, 32 ]. The enterotoxins and the TSST-1 cause toxic shock and related illnesses though induction of massive cytokine release, both from macrophages and T cells [ 31 ]. Recent CA-MRSA isolates have shown evidence of increased virulence resulting in some increased prevalence of toxic shock cases and more severe soft tissue infections and in many cases increased mortality. However, TSST-1 can be produced by HA-MRSA as well as methicillin-susceptible

15 4 Elizabeth L. Palavecino S. aureus strains and therefore TSST-1 production should not be considered a hallmark of CA-MRSA strains [ 17 ]. Another important virulence factor in S. aureus is the Panton Valentine leukocidin (PVL), a member of the recently described family of synergohymenotropic toxins. PVL damages the membranes of host defense cells through the synergistic activity of two separately secreted, but non-associated, proteins, LukS and LukF causing tissue necrosis [ 32 ]. Although some investigators have suggested that PVL expression does not correlate directly with polymorhonuclear leukocytes lysis [ 33 ], PVL producing CA-MRSA isolates were reported as associated with necrotizing pneumonia and necrotizing cutaneous infections [ 14, 15, 32 ]. Additionally, investigators have found that the presence of PVL alone is sufficient to cause necrotizing pneumonia in a mouse model [ 34 ]. In spite of that, the role of PVL in CA-MRSA pathogenesis has recently been the subject of much debate. Because PVL was found in most CA-MRSA strains, it was initially thought that PVL had an important role in the severity of the CA-MRSA infection process. However, more recent studies based on animal models suggest that PVL does not have a great impact on the virulence and spread of CA-MRSA strains [ 21, 35 ]. In fact, it has been suggested that virulence in CA-MRSA strains is associated with the presence of a phenol-soluble modulin that is able to lyse human neutrophils and impair the cellular response of the host [ 21 ]. This protein has been recently described in USA 300 and USA 400, both clones associated with CA-MRSA strains [ 36 ]. Five major and several minor PVL positive CA-MRSA clones are disseminated worldwide and investigators have expressed concerns of over the dissemination of particular PVL positive clones such as ST 5, which has been associated with severe and even fatal infections [ 21, 34 ]. 4 Mechanisms of Antibiotic Resistance 4.1 Mechanisms of Beta-Lactams Resistance S. aureus became resistant to penicillin due to the production of beta-lactamases that hydrolyze the penicillin. For that reason, penicillins that were resistant to the action of beta-lactamases, such as methicillin, were developed to treat staphylococcal infection caused by beta-lactamases producing strains. However, S. aureus strains resistant to these agents soon appeared [ 37 ]. Although there are three known mechanisms for which S. aureus become resistant to methicillin hyperproduction of betalactamases [ 38 ], modification of normal PBPs [ 39 ], and the presence of an acquired penicillin-binding protein PBP2a [ 40 ] most clinical isolates present the latter mechanism and therefore our discussion will focus on this mechanism. S. aureus strains have four normal PBPs anchored on the cytoplasmic membrane which participate in the cross-linking of the peptidoglycan of the bacterial cell wall. These normal PBPs have

16 Laboratory Detection of MRSA Isolates: A Review 5 activity similar to serine proteases and have high affinity for betalactams agents, and when this binding occurs, the PBPs are not able to functions in the assembly of cell wall, causing bacterial death. PBP2a, on the other hand, is not part of the intrinsic set of PBPs of S. aureus, but is a unique, inducible, acquired protein that has a molecular weight of approximately 76 kda, and it is produced only by methicillin-resistant staphylococci [ 41 ]. PBP2a has low affinity for beta-lactam antibiotics and therefore is capable of substituting the biosynthetic functions of the normal PBPs even in the presence of the beta-lactams, thereby preventing cell lysis. Isolates containing the PBP2a-mediated resistance mechanism are clinically resistant to all available β-lactams, including penicillins, cephalosporins, β-lactam/β-lactamsase inhibitor combinations, monobactams, and carbapenems [ 41, 42 ]. The meca gene, which is not present in methicillin susceptible strains, encodes PBP2a and it is believed to have been acquired from a distantly related species, although the exact origin has not been found yet [ 41, 43 ]. mec A was first sequenced by Song and coworkers in 1987 [ 44 ] and now it is known that this gene is carried on a mobile genetic element, the SCC mec [ 45 ]. In addition of carrying the mec A gene, the SCC contains regulatory genes, the IS431 and IS1272 mec insertion sequences, and the recombinase genes ccr that are responsible for the integration and excision of SCC mec [ 46 ]. The International Working Group on the Staphylococcal Cassette Chromosome elements [ 47 ] has so far identified 11 SCC mec types, labeled types I to XI, in S. aureus strains. SCC mec types are defined by the combination of (1) the type of ccr gene complex, which is represented by ccr gene allotype, and (2) the class of the mec gene complex [ 21, 47 ]. Although types I IV seems to be widely disseminated, SSCmec type V has been mostly found in MRSA strains isolated in Australia, type VI in MRSA strains isolated in Portugal and type VII in MRSA strains isolated in Taiwan [ ]. 4.2 Mechanisms of Vancomycin Resistance Until recently, vancomycin was the only antimicrobial agent that was active against all staphylococci, and therefore vancomycin has been the drug of choice to treat infection caused by MRSA. However, clinical strains of S. aureus considered at that time as intermediate resistant to vancomycin (MIC between 8 and 16 μg/ ml) were reported first from Japan in 1997 [ 51 ]. Since then, 13 vancomycin resistant (MIC 32 μg/ml) S. aureus (VRSA) have been documented in the USA from patients with clinical infections eight unrelated patients from Michigan, three from Delaware, and one each from New York and Pennsylvania [ ]. VRSA have also been reported in India and Iran [ 56, 57 ]. Vancomycin acts in the early stage of cell wall synthesis by binding to the C-terminal of the cell wall precursor pentapeptide complex and preventing it from being used for cell wall synthesis. Vancomycin intermediate S. aureus (VISA) have probably arisen as

17 6 Elizabeth L. Palavecino a result of changes involving the bacterial cell wall as VISA strains have abnormal, thickened cell walls in the presence of vancomycin. Researchers have described two possible mechanism of resistance in these strains: affinity trapping of vancomycin molecules by cell wall monomers and clogging of the outer layer of peptidoglycan by bound vancomycin molecules [ 53, 58 ]. In contract to VISA strains, VRSA strains carry the van A resistance determinant. The first Michigan isolate (MI-VRSA) harbored a 57.9-kilobase multiresistant conjugative plasmid within which the van A transposon, Tn1546, was integrated. The structure of the Tn1546-like plasmid containing the van A resistance gene in the Pennsylvania isolate (PA-VRSA) showed several major differences from the prototypic Tn 1546 seen in the MI-VRSA, including a deletion at the 5 end of the transposon. The differences observed in the plasmids of the MI-VRSA compared to the PA-VRSA may indicate two independent events of interspecies transfer, most likely from enterococci [ 53, 58 ]. The first two VRSA strains from two different sites in the USA contained both the van A and the mec A genes [ 53 ]. Severin and colleagues [ 59 ] investigated the mechanism of expression of highlevel vancomycin resistance using an oxacillin-resistant S. aureus carrying the van A gene complex and with inactivated mec A. They reported that the key penicillin binding protein essential for vancomycin resistance and for the altered cell wall composition characteristic of vancomycin-resistant S. aureus is PBP2. They also concluded that while mec A is essential for oxacillin resistance, it is not involved with the expression of vancomycin resistance [ 59 ]. Investigators have used a new technique to microscopically examine the cell wall and extracellular structures of the bacterial cell without the artifact produced by the fixation step needed for electron microscopy [ 60 ]. This new technique, atomic force microscopy (AFM), has the ability to measure surface topographic features and has proven highly useful for detection and characterization of extracellular matrices, as well as for understanding the mechanical and/or adhesive properties of the bacterial cell [ 61 ]. AFM creates images by mechanically scanning a very sharp probe mounted on a flexible cantilever over the sample surface. The interaction forces between the scanning probe and the sample surface produce signals that are transformed into an image of the surface features [ 62 ]. The overall shape and general topography is shown by non-contact topography mode, in which the scanner adjusts the distance between the cell and cantilever such that the cantilever oscillation amplitude is constant during imaging, and an image is created from the adjustment of the sample height (Fig. 1 ). In order to resolve fine surface features, the sample height is not adjusted and the cantilever oscillation amplitude is used to create an image (Fig. 2 ).

18 Laboratory Detection of MRSA Isolates: A Review 7 Fig. 1 AFM tapping mode topographical image of cells from a clinical MRSA isolate showing cocci arranged in clusters. Tapping mode AFM provides real high resolution topographical information without any fi xation Fig. 2 AFM tapping mode amplitude image of MRSA isolate showed in Fig. 1. The amplitude image of tapping mode permits elucidation of fi ne surface structure not apparent from the topography image

19 8 Elizabeth L. Palavecino Using AFM to investigate the structural and topological characteristics of a VISA strain, researchers found that the VISA strain and its revertant had two parallel circumferential surface rings, while control strains had only one equatorial ring. Furthermore, in vancomycin-susceptible strains, additional rings were formed in the presence of vancomycin [ 63 ]. Additional studies are needed to assess whether these observations are associated with the decreased susceptibility to vancomycin in these strains. 5 Emergence and Evolution of MRSA Many studies have tried to elucidate the origin of MRSA strains and significant advances have been made in recent years. Most researchers seem to agree that MRSA emerged in the early 1960s when it acquired the methicillin resistance gene mec A, which is carried by the genetic element now known as SCC mec [ 43, ]. As described above, the origins of SCC mec are unknown, and although investigators have found that these elements are widely distributed in staphylococci, including S. aureus, they have not been found in any other genera of bacteria [ 21, 43, 64 ]. SCC mec is integrated near the S. aureus origin of replication, and this location might have been critical for providing MRSA the ability to acquire other antibiotic resistant genes [ 21, 43 ]. Crisostomo and colleagues used multilocus sequencing typing (MLST), spa typing and pulsed-field gel electrophoresis (PFGE) to study the similarity of genetic backgrounds in historically early and contemporary European MSSA and MRSA epidemic clones [ 64 ]. They found that early MRSA isolates resembled early MSSA isolates in phenotypic and genetic characteristics, suggesting that these early MSSA tested probably represent the progeny of a strain that served as one of the first S. aureus recipient of the methicillin resistance in Europe. Enright and coworkers [ 65 ] used MLST data and a complex algorithm, denominated BURST analysis, to identify the ancestral MRSA clone and its MSSA ancestor using an international collection of MRSA and MSSA isolates. Based on their analysis, these investigators reported that methicillin resistance has emerged in five phylogenetically distinct lineages and on multiple occasions within a given phylogenetic lineage [ 65, 66 ]. Although the frequency with which SCC mec is acquired is not completely known, most investigators agree that MRSA isolates are not all descendant of a single original clone and that horizontal transfer of SCC into epidemic MSSA isolates of different lineages may have played a significant role in the evolution of MRSA. Investigators have observed that more MSSA than MRSA lineages suggesting that the MSSA strains have a more heterogeneous genetic background [ 21, 67, 68 ]. In addition, many MSSA lineages are different from the lineages from the major MRSA clones

20 Laboratory Detection of MRSA Isolates: A Review 9 distributed worldwide. Investigators suggested that these findings support the hypothesis that some MSSA lineages may not provide the genetic environment for the integration of SCC mec [ 21 ]. Robinson and Enright [ 66 ] proposed evolutionary models of the emergence of MRSA based on the application of MLST and SCC mec typing to an international collection of methicillinresistant and -susceptible S. aureus isolates. On the basis of these models, they proposed that MRSA has emerged at least 20 times upon acquisition of the mec A gene, and that SCC mec IV is the most frequently acquired element by methicillin-susceptible isolates [ 21, 69 ]. The small size of SCC mec IV may facilitate its integration in staphylococci of different lineages. This is very interesting because SCC mec IV has been found in most CA-MRSA isolates. In general, CA-MRSA strains have a greater clonal diversity than HA-MRSA strains suggesting that these clones have a genetic environment that facilitates the integration of the SSC mec. The presence of PVL and SCC mec type IV has been used as marker for CA-MRSA strains in many countries, but this association has not been observed in other areas where PVL negatives CA-MRSA are more common. Pandemic clones associated with nosocomial infections have SCC mec I, II, or III, and the selection and spread of HA-MRSA strains harboring these elements in hospitals probably occurs by antibiotic exposure over time. However, several studies have shown that CA-MRSA strains with different SCC mec types have been increasingly being isolated in hospital environments and in some regions are replacing the HA-MRSA strains in hospital settings [ 21, 69 ]. 6 Molecular Procedures for Epidemiologic Studies The study of the genetic relatedness of isolates obtained from an epidemiologic cluster or during the course of an infection in a single patient is becoming a useful practice in many clinical and infection control laboratories today [ 70 ]. The goal of these techniques is to determine whether isolates recovered from different patients or sources represent a single strain or multiple different strains. Infection control practitioners use the information provided by molecular procedures to complement their epidemiologic investigation, and also to determine whether to initiate such investigations while clinicians may use the information in an individual patient to discriminate between relapse and reinfection. Clinical microbiologists have used phenotypic methods to distinguish isolates of the same species. These phenotypic methods include serotyping, biotyping, bacteriophage typing, antimicrobial susceptibility profile, and MLST. Among these, bacteriophage typing was used in the past in reference laboratories for differentiating unrelated S. aureus isolates, but because of the technical demands

21 10 Elizabeth L. Palavecino and poor reproducibility, this method is rarely used. The antimicrobial susceptibility profile has been the phenotyping technique most frequently used by clinical microbiology laboratories because the data is readily available. However, the antimicrobial susceptibility typing method has not been very discriminatory for the analysis of nosocomial MRSA because most are resistant to many antibiotic classes and therefore this method does not allow the differentiation of related from unrelated isolated. Due to the poor discriminatory power of the phenotypic techniques, DNA-based, or genotypic techniques are now the strain typing methods of choice for MRSA. Although the most commonly genotypic techniques used for epidemiologic investigation of MRSA has been PGFE, more recently investigators seem to prefer the use of Protein A ( spa ) typing, MLST and SCC mec methods. A brief description of these techniques and their usefulness for the discrimination of MRSA strains is described below. 6.1 PFGE of Chromosomal DNA 6.2 MLST This technique is based on the digestion of bacterial DNA with restriction endonucleases with relatively few restriction sites generating fewer, but much larger fragments than those generated by conventional, constant-field, agarose gel electrophoresis. In PFGE, the orientation of electric filed is changed periodically ( pulsed ) allowing the DNA fragments, embedded in agarose plugs to be separated by size. PGFE analysis provides a restriction pattern of chromosomal DNA composed of well-defined fragments, facilitating the analysis and comparison of multiple isolates. This technique has been widely used for the epidemiologic study of nosocomial and community-acquired MRSA isolates [ ], and the interpretative scheme of PFGE pattern reported by Tenover and colleagues [ 71 ] has been very useful to determine the genetic relatedness of MRSA strains isolated during a relatively short period of time (1 3 months), where presumably, the genetic variability is limited [ 71 ]. PFGE has been tested and compared to several other typing methods and has been reported to be the one of the most discriminatory method available for the epidemiology study of outbreaks in hospitals and communities, and a national data base of MRSA PFGE profiles has been assembled to facilitate the identification of major lineages of MRSA present in the USA [ 72 ]. However, this method lacks international standard protocol, which makes it difficult to compare MRSA strains from different countries [ 73 ]. This technique is gaining popularity among researchers, particularly for studying long-term population relatedness and for understanding the emergence and evolution of MRSA clones [ 64, 65, 67, 74 ]. In MLST, seven loci representing housekeeping genes for S. aureus are amplified by PCR. The PCR product is then sequenced and compared to known alleles, held at the MLST Web

22 Laboratory Detection of MRSA Isolates: A Review 11 site ( ), to obtain an allelic profile. This allelic profile consists of a string of seven numbers, which can be easily consulted over the Internet, unifying and standardizing epidemiology data collected all over the world. Although MLST provides information on strain lineage that is very important for understanding the overall epidemiology of MRSA infections, this technique may not be suitable for outbreak investigation in clinical setting. It also requires performing PCR and sequencing of the PCR product using an automated sequencer, which is not readily available in most clinical laboratories. Due to the high cost, MLST is more suitable for defining lineages than for routine local molecular epidemiologic analysis. 6.3 Arbitrarily Primed PCR (AP-PCR) 6.4 spa Typing The main feature of PCR is the ability to replicate a particular DNA sequence to obtain multiple copies of the target sequence. Among the typing techniques involving PCR, AP-PCR or random amplified polymorphic DNA (RAPD) has been used for the genetic analysis of S. aureus [ 75 ]. This technique involves the amplification of random chromosomal DNA sequences using a small primer (typically 10 bp) with an arbitrary sequence not directed to an specific region of the DNA target, but capable of hybridization at random chromosomal sites. The number and locations of these random sites will vary among different strains, generating a different AP-PCR profile based on the number and sizes of the fragments detected by electrophoresis. This technique has a lower discriminatory power than PFGE for typing of MRSA strains, but, due to its simplicity, it could be useful for rapid differentiation of related from unrelated isolates during an outbreak. The DiversiLab System (Biomerieux, Durham, NC) uses rep-pcr amplification and is now commercially available. This automated system extracts DNA from isolated cultures, amplifies samples using rep-pcr, separates the fragments and analyzes data. The highly reproducible fingerprint pattern can be stored to facilitate comparison [ 76 ]. This technique involves the sequencing of the polymorphic X region, or short sequence repeat (SSR) region of the protein A gene. These regions have a high degree of polymorphism and therefore potentially suitable for discrimination for outbreak investigation. This typing method requires the ability to perform PCR and access to an automated sequencer for sequence typing of PCR products as is also required for MLST. The information used for spa typing is obtained from a single locus, in contrast to MLST, which combines information from seven loci for typing of S. aureus. spa typing has been evaluated for typing wellcharacterized S. aureus strains and compared to PFGE [ 17, 64, 77 ]. The investigators found spa typing to be rapid and apparently easier to perform and interpret than other available molecular techniques. In addition, this technique seems to have excellent

23 12 Elizabeth L. Palavecino reproducibility and the resulting sequences can be analyzed using a commercially available software package making spa typing a good option in infection control [ 73 ]. 6.5 SCCmec 6.6 Gene Chip-Based Techniques This technique involves the use of multiplex PCR to determine the structure of the mec complex and the presence of the different ccr genes [ 78 ]. One of the disadvantages of this method is the complexity of the typing system with several typing and subtyping algorithms. More recently, investigators have focused on the sequencing of the ccrb locus, which has proved beneficial for the determination of SCC mec types I to IV and VI [ 79 ]. SCC mec typing has gained popularity for the epidemiologic and evolution analysis of CA-MRSA strains has these are mostly associated with a specific SCC mec type. However, the SCC mec region is variable and new types and new types are constantly being defined increasing the need for constant update of the of the PCR targets. More recently, investigators have reported the use of Gene Chips for studying the relatedness of MRSA strains. In this case, the investigators used an Affymetric GeneChip that represented predicted open reading frames from six genetically divergent S. aureus strains and novel GenBank entries to analyze the relatedness of MRSA isolates. This new methodology has potential for evaluating MRSA lineages, but its complexity and cost make this technique not suitable for clinical purposes at this time [ 80 ]. Efforts have been made to monitor the global epidemiology of MRSA strains and to standardize the typing methods. There is a need for a consensus regarding typing methodologies and to agree on a nomenclature that would allow the monitoring the molecular epidemiology of MRSA at national and international levels. Recently, an expert panel meeting held by the International Society of Chemotherapy recommended spa and SSC mec typing as the preferred methods for MRSA typing [ 73 ]. 7 Susceptibility Testing Antimicrobial susceptibility of S. aureus against many antibiotics can be analyzed using a variety of standardized manual and commercial methods. Some of these methods are described in the next chapters. According to the Clinical Laboratory Standards Institute [ 81 ], an organism is considered susceptible, intermediate, or resistant according to designed breakpoints. A susceptible interpretation implies that the isolate is inhibited by the usually achievable concentration of the antibiotic when the dosage recommended to treat the site of infection is used [ 81 ]. Breakpoints are determined based on MIC distributions, dosage, and pharmacodynamic and pharmakinetic (PK/PD) parameters of the antimicrobial agent.

24 Laboratory Detection of MRSA Isolates: A Review 13 Table 1 CLSI interpretative breakpoints for disk diffusion (zone diameter) and broth microdilution (MIC) for S. aureus Zone diameter interpretation (mm) MIC interpretation (μg/ml) Agent Disk content S I R S I R Erythromycin 15 μg Clindamycin 2 μg Daptomycin a 1 b Linezolid 30 μg Oxacillin c 1 μg Penicillin 10 Units Vancomycin d Agents listed are those recommended for primary testing [ 81 ] a Disk diffusion is not reliable for susceptibility testing of these agents b The absence or rare occurrence of resistant strains precludes defining any results categories other than susceptible c Cefoxitin (30 μg) disk is used as a surrogate for oxacillin resistance; report oxacillin susceptible or resistant based on cefoxitin result d Disk diffusion does not differentiate vancomycin-susceptible isolates of S. aureus from vancomycin-intermediate isolates. MIC tests should be performed to determine the susceptibility of S. aureus to vancomycin Although beyond the scope of this article, it is important to note that in addition to FDA, the CLSI and the European Committee Antimicrobial susceptibility testing (EUCAST) [ 82 ] can set up breakpoints for use with standard reference methods. CLSI and EUCAST breakpoints may in some occasions differ from those approved by the FDA. In the USA, laboratories using automated antimicrobial susceptibility systems (AST) must use FDA breakpoints if reporting patient results. However, laboratories may decide to use CLSI or EUCAST breakpoints if the appropriate verification is done for the AST in use or if a reference methodology is used. For the purpose of this review, CLSI breakpoints will be used for interpretation of susceptibility results in S. aureus ( see Table 1 ). 7.1 Detection of Oxacillin (Methicillin) Resistance A distinctive characteristic of methicillin resistance is its heterogenous expression, with the majority of cells susceptible to low concentrations of oxacillin, and only a small proportion of cells growing at oxacillin concentration greater than 50 μg/ml. Consequently, in vitro testing has been modified to enhance the expression of oxacillin resistance for detection of resistant strains [ 42, 83 ]. Most of the health-care associated MRSA strains are resistant to multiple classes of antimicrobial agents, including aminoglycosides, clindamycin, macrolides, quinolones, sulfonamides, and tetracycline

25 14 Elizabeth L. Palavecino [ 41, 42 ]. However, as discussed above, most CA-MRSA isolates harboring SCC mec type IV are usually resistant to beta- lactam and macrolide antibiotics, but susceptible to other classes [ 12 ]. Currently, the Clinical and Laboratory Standard Institute (CLSI), formerly NCCLS [ 50 ], has recommendations for several standardized methods for detection of oxacillin resistance in S. aureus, including broth and agar dilution and agar screen methods. All these tests need incubation at temperatures no greater than 35 C and obtaining final readings after a full 24 h of incubation. Supplementation of Mueller-Hinton broth or agar with 2 % NaCl should be done for dilution tests [ 81 ]. The agar screen test has been evaluated in numerous studies and found to be very good for detection of resistant strains and it has been used for screening of colonized patients by infection control laboratories and it is also the recommended method to use in addition to the dilution methods to confirm methicillin resistance in S. aureus [ 81 ]. For disk diffusion (Kirby-Bauer) testing, researchers have demonstrated that cefoxitin disk performs equivalent to oxacillin broth microdilution and it is easier to read than oxacillin disk diffusion [ 84 ]. Based on these findings, the CLSI adopted the use of cefoxitin disk diffusion for predicting mec A-mediated oxacillin resistance in staphylococci, and the current CLSI M100 document states that cefoxitin disk should be used for detecting oxacillin resistance by disk diffusion in mec A positive S. aureus. The results should be reported for oxacillin and not for cefoxitin [ 81 ]. Automated systems, have achieved sensitivity and specificity at detecting staphylococcal oxacillin resistance at a level that is acceptable for clinical laboratory use [ 85 ]. However, because of the heterogeneous nature of the oxacillin resistance, phenotypic methods may not completely reliable and clinical laboratories could consider testing with an alternate method for confirmation of results. 7.2 Detection of Clindamycin Resistance Macrolide, lincosamide, and streptogramin (MLS) resistance mechanisms in staphylococci are ribosomal methylase encoded by erm genes (MLS B phenotype), which could be constitutive and inducible, and efflux pump encoded by msr genes (M Phenotype) [ 12 ]. When MLS B resistance is constitutive, staphylococci are resistant to erythromycin and clindamycin. When the resistance is inducible, the strains are resistant to erythromycin and inducibly resistant to clindamycin. Strains presenting the efflux pump mechanism are resistant to erythromycin and susceptible to clindamycin. Standard susceptibility broth methods cannot separate inducible resistance from susceptibility to clindamycin. Induction can be demonstrated using a disk approximation test by placing a 2 μg clindamycin disk and a 15 μg erythromycin disk spaced mm apart on a standard blood agar or Mueller Hinton plate using a standard inoculum. Following incubation, organisms showing no area of inhibition around the erythromycin and the

26 Laboratory Detection of MRSA Isolates: A Review 15 Fig. 3 Clindamycin resistance phenotypes in S. aureus by disk diffusion using erythromycin and clindamycin disks as described in the text. (1) Isolate constitutively resistant to erythromycin and clindamycin ( a ); (2) Isolate resistant to erythromycin and inducibly resistant to clindamycin D test positive ( b ); and (3) Isolate resistant to erythromycin and susceptible to clindamycin D test negative ( c ) clindamycin disks are constitutively resistant and should be reported as resistant to erythromycin and clindamycin (Fig. 3a ) Organisms that show flattening of the clindamycin zone adjacent to the erythromycin disk, usually described as D-shaped, have inducible resistance and should be considered clindamycin resistant (Fig. 3b ). Organisms that do not show flattening of the clindamycin zone should be reported as clindamycin susceptible (Fig. 3c ). Detection of inducible clindamycin resistance is very important in CA-MRSA because clindamycin is one of antibiotics recommended to treat CA-MRSA infections and clinical laboratories are advised to perform the D test in macrolide resistant MRSA isolates [ 12, 81 ]. 7.3 Detection of Vancomycin Resistance In 2006 the CLSI revised the susceptibility breakpoints for vancomycin and lowered the susceptible breakpoints from 4 to 2 μg/ml. This decision was in response to increasing numbers of

27 16 Elizabeth L. Palavecino reports suggesting that vancomycin was poorly effective against MRSA isolates with a MIC of >2 μg/ml [ 86 ]. Vancomycin susceptibility can be measured by various methodologies. Broth microdilution (BMD) is considered the gold standard for obtaining vancomycin MIC, but this method is time consuming and therefore is rarely used in clinical microbiology laboratories. MIC variation resulting in different susceptibility interpretation has been demonstrated when comparing the vancomycin MICs obtained by commercial and reference susceptibility testing methods [ 87 ]. This variation of vancomycin MIC values between methods has created a controversy about what MIC value can predict satisfactory clinical response. Several institutions have reported an increase in the number of S. aureus with vancomycin MIC of 2 μg/ml [ 88 ]. However, this phenomenon termed MIC creep has not been observed in other institutions [ 89 ]. It has been suggested that the presence of MIC creep could be due to the emergence of a particular clone with higher vancomycin MIC within a particular institution [ 90 ] Detection of Heterogeneous VISA (hvisa) Isolates considered hvisa have an MIC in the susceptible range when tested by routine standard methods, but exhibit a subpopulation of cells with MICs in the intermediate range when analyzed by population analysis. The hvisa phenotype is considered to be a precursor of VISA isolates. Although population analysis profiling is considered the gold standard for detection of hvisa isolates, this method is cumbersome and unsuitable for clinical laboratories. Several other methodologies with variable sensitivity and specificity are available to detect hvisa isolates including the use of agar plates with 4 or 6 μg/ml of vancomycin or teicoplanin, the macromethod, and the glycopeptide resistance Etest [ 58, 91, 92 ]. See Table 2 for description of Etest-based methods. The prevalence of hvisa varies from 0 to 74 % according to different publications [ 91 ]. It is not known if these discrepancies are due to true differences in the epidemiology of these strains according to different geographic locations, to the lack of standardization of the methods of detection or to the instability of the phenotype once the isolates are sub-cultured or frozen and stored. The clinical significance of hvisa isolates has not been clearly demonstrated, but has been associated with clinical failures to vancomycin [ 91, 93, 94 ]. hvisa, VISA, and VRSA could be suspected if the following clinical and laboratory signs are found: long term vancomycin treatment, cultures growing S. aureus despite treatment, atypical small colony morphology, weak catalase reaction, and increased daptomycin MIC [ 91 ]. The existence of clinical hvisa isolates plus the fact that most antimicrobial susceptibility systems, including reference methods, may not accurately differentiate isolates for which the vancomycin

28 Laboratory Detection of MRSA Isolates: A Review 17 Table 2 Testing recommendations and interpretation criteria for Etest-based methods for detection of hvisa Isolates [ 91, 92 ] Method Medium Inoculum E test strip Incubation MIC interpretative criteria for hvisa Macromethod BHI agar plate McFarland 2.0 Vancomycin and teicoplanin strips 35 C for h Vancomycin and teicoplanin MIC 8 μg/ml or an MIC 12 μg for teicoplanin alone Glycopeptide resistance detection Mueller- Hinton with blood McFarland 0.5 GRD strip 35 C for h Vancomycin or teicoplanin MIC 8 μg/ml and standard vancomycin MIC 4 μg/ml is between 2 and 4 μg/ml make detection of S. aureus nonsusceptible to vancomycin by clinical laboratories extremely challenging. No method has been proved to be clearly acceptable for identifying hvisa in the clinical laboratory. The disk diffusion test does not differentiate vancomycinsusceptible from VISA isolates and therefore CLSI no longer recommend the use of disk diffusion for vancomycin susceptibility testing in S. aureus [ 81 ]. The vancomycin screen plate test is insensitive for the detection of VISA, but performs well for detection of VRSA isolates (Swenson). Currently, the CLSI document states that VRSA strains with MICs 8 μg/ml are reliable detected by broth microdilution reference method using Mueller-Hinton Broth and 24 h incubation at 35 C [ 81 ]. Automated systems have shown variable sensitivity for detection of VISA and VRSA isolates and the use of alternate methods, such as Etest, as been recommended for confirmation of VISA and VRSA [ 87 ]. Any staphylococci determined to have an elevated MIC for vancomycin (MIC 8 μg/ml) should be sent to a reference laboratory for confirmation [ 81 ]. 7.4 Detection of Resistance to Linezolid and Daptomycin Linezolid Linezolid resistance, although rare, has been reported in S. aureus [ 95 ]. The CLSI has defined susceptibility breakpoints for disk diffusion ( 21 mm) and MIC testing ( 4 μg/ml) in staphylococci ( see Table 1 ). However, susceptibility testing of Linezolid can be problematic. Disk diffusion produces poorly defined inhibition zones that are hard to read and should be examined under transmitted light. Organisms with resistant results by disk diffusion should be confirmed using an MIC method [ 81 ]. Furthermore, linezolid MICs have been noted to vary among laboratories even when the

29 18 Elizabeth L. Palavecino same testing method is used and even more worrisome is the reported inability of susceptibility tests to detect linezolid resistant strains making it very difficult to obtain reliable results [ 96 ] Daptomycin 7.5 Cephalosporins with Anti-MRSA Activity CLSI currently provides only a susceptible category for daptomycin in staphylococci (MIC 1 μg/ml) and recommends confirmation of non-susceptible isolates by a second method [ 81 ]. Disk diffusion testing is not reliable for testing daptomycin and a poor daptomycin MIC correlation has been found between Etest, automated systems, and reference methods [ 97, 98 ]. To reliably perform susceptibility testing of daptomycin, the medium needs to contain a higher concentration of calcium than the usual concentration of most media. To overcome this issue, Etest strips are overlaid with a constant level of calcium equivalent to 40 μg/ml. Etest MIC results vary according to the medium used for testing and MIC in the non-susceptible range even with use of the most optimal medium, should be confirmed by a reference method [ 98 ]. Automated susceptibility systems, which are used commonly in clinical laboratories, can also give false daptomycin non-susceptible results [ 97 ]. These findings highlight the problems associated with performing accurate susceptibility testing of daptomycin in clinical laboratories. As discussed above, beta-lactams antibiotics have too low affinity for PBP2a to be efficacious at clinically achievable concentrations, but in contrast to the other cephalosporins, the newer cephalosporins have the ability to bind to PBP2a and have antimicrobial activity against S. aureus including MRSA. Among these, ceftobiprole was the first to complete Phase II clinical trials but has not obtained FDA approval yet. Ceftaroline is a new, advanced generation cephalosporin with expanded gram-positive activity that was recently approved by the FDA. The antimicrobial activity of ceftaroline extends to hvisa, VISA, and VRSA and daptomycin non- susceptible isolates [ 99, 100 ]. Although CLSI designated ceftaroline as a member of a new beta-lactam agents group, the cephalosporins with anti-mrsa activity, CLSI breakpoints have not yet been designated [ 81 ]. The FDA susceptible breakpoint is 1 μg/ml. One study showed that the ceftaroline MIC 90 for MSSA was 0.25 μg/ml and 1 μg/ml for MRSA. No isolates with MIC 2 μg/ml were found [ 101 ]. Avibactam is a novel investigational non-beta-lactam beta-lactamase inhibitor that is being evaluated for possible use in combination with ceftaroline in the USA. In vitro studies showed that S. aureus strains, including MRSA with different SCC mec types, were predominantly (99.1 %) inhibited by ceftaroline-avibactam at 2 μg/ml [ 102 ].

30 Laboratory Detection of MRSA Isolates: A Review 19 8 Rapid Methods for Detection of MRSA Strains Antimicrobial susceptibility test methods such as disk diffusion, broth microdilution, and oxacillin screen plate require 24 h of incubation after having the organism growing in pure culture. Rapid and accurate identification of MRSA isolates is essential not only for patient care, but also for effective infection control programs to limit the spread of MRSA. In the last few years, several commercial rapid tests for detection of MRSA directly from nasal swabs and blood cultures have been developed for use in clinical laboratories. Real-time PCR and other molecular tests are gaining popularity as MRSA screening tests to identify patients who are candidates for contact precaution at the time of admission decreasing the risk for nosocomial transmission. These new methodologies are described in detail in a separate chapter of this book. 9 Conclusions It is clear that the emergence of CA-MRSA and VRSA isolates is changing the management of clinical infections potentially caused by S. aureus. Rapid methods for accurate detection of MRSA are needed to promptly identify patients and implement contact precautions as well as appropriate treatment. Molecular genotyping techniques have an important role in evaluating possible outbreaks and for understanding of the emergence and evolution of MRSA strains. Acknowledgments I thank my research collaborators, Faith Coldren and David Carroll for providing the AFM images, and Carlos A. Fasola for helpful suggestions to the manuscript. References 1. Panlilio AL, Culver DH, Gaynes RP et al (1992) Methicillin-resistant Staphylococcus aureus in U.S. hospitals, Infect Control Hosp Epidemiol 13: Stefani S, Varaldo PE (2003) Epidemiology of methicillin-resistant staphylococci in Europe. Clin Microbiol Infect 9: Kuehnert MJ, Hill HA, Kupronis BA et al (2005) Methicillin-resistant- Staphylococcus aureus hospitalizations, United States. Emerg Infect Dis 11: Mera RM, Suaya JA, Amrine-Madsen H et al (2011) Increasing role of Staphylococcus aureus and community-acquired methicillinresistant Staphylococcus aureus infections in the United States: a 10-year trend of replacement and expansion. Microb Drug Resist 17: Rosenthal VD, Bijie H, Maki DG et al (2012) International Nosocomial Infection control consortium (INICC) report, data summary of 36 coutries, for Emerg Infect Dis 18:

31 20 Elizabeth L. Palavecino 6. Cosgrove SE, Qi Y, Kaye KS et al (2005) The impact of methicillin resistance in Staphylococcus aureus bacteremia on patient outcomes: mortality, length of stay, and hospital charges. Infect Control Hosp Epidemiol 26: Abramson MA, Sexton DJ (1999) Nosocomial methicillin-resistant and methicillinsusceptible Staphylococus aureus primary bacteremia: at what costs? Infect Control Hosp Epidemiol 20: Hidron AI, Edwards JR, Patel J et al (2008) HHSN annual update: antimicrobial-resistant pathogens associated with Health-careassociated infections: annual summary of data reported to the National Healthcare Safety Network at the Centers for Disease Control and Prevention, Infect Control Hosp Epidemiol 29: Wisplinghoff H, Bischoff T, Tallent SM, Seifert H, Wenzel RP, Edmond MB (2004) Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clin Infect Dis 39: Jones ME, Draghi DC, Thornsberry C, Karlowsky JA, Sahm DF, Wenzel RP (2004) Emerging resistance among bacterial pathogens in the intensive care unit a European and North American Surveillance study ( ). Ann Clin Microbiol Antimicrob 29(3): O Hara FP, Amrine-Madsen H, Mera RM et al (2012) Molecular characterization of Staphylococcus aureus in the United States reveals the rapid expansion of USA 300 among inpatients and outpatients. Microb Drug Resist 18: Palavecino E (2004) Community-acquired methicillin-resistant Staphylococcus aureus infections. Clin Lab Med 24: Herold BC, Immergluck LC, Maranan MC et al (1998) Community-acquired methicillinresistant Staphylococcus aureus in children with no identified predisposing risk. JAMA 279: Francis JS, Doherty MC, Lopatin U et al (2005) Severe community-onset pneumonia in healthy adults caused by methicillinresistant Staphylococcus aureus carrying the Panton-Valentine leukocidin genes. Clin Infect Dis 40: Miller LG, Perdreau-Remington F, Rieg G et al (2005) Necrotizing fasciitis caused by community-associated methicillin-resistant Staphylococcus aureus in Los Angeles. N Engl J Med 352: Naimi TS, LeDell KH, Como-Sabetti K et al (2003) Comparison of community- and health care-associated methicillin-resistant Staphylococcus aureus infection. JAMA 290: Fey PD, Said-Salim B, Rupp ME et al (2003) Comparative molecular analysis of community- or hospital-acquired methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 47: Mulvey MR, MacDougall L, Cholin B et al (2005) Community-associated methicillinresistant Staphylococcus aureus, Canada. Emerg Infect Dis 11: Vandenesch F, Naimi T, Enright MC et al (2003) Community-acquired methicillinresistant Staphylococcus aureus carrying Panton- Valentine leukocidin genes: worldwide emergence. Emerg Infect Dis 9: Okuma K, Iwakawa K, Turnidge JD et al (2002) Dissemination of new methicillinresistant Staphylococcus aureus clones in the community. J Clin Microbiol 40: Deurenberg RH, Stobberingh EE (2008) The evolution of Staphylococcus aureus. Infect Genet Evol 8: Moran GJ, Krishnadasan A, Gorwitz RJ et al (2006) Methicillin-resistant S aureus infections among patients in the emergency department. N Engl J Med 355: Gonzalez BE, Rueda AM, Shelburne SA III et al (2006) Community-associated strains of methicillin-resistant Staphylococcus aureus as the cause of healthcare-associated infection. Infect Control Hosp Epidemiol 27: Maree CL, Daum RS, Boyle-Vavra S et al (2007) Community-associated methicilin resistant Staphylococcus aureus isolates causing health-care associated infections. Emerg Infect Dis 13: Valsesia G, Rossi M, Bertschy S et al (2010) Emergence of SCCmec type IV and SCCmec type V methicillin-resistant Staphylococcus aureus containing the Panton-Valentine leukocidin genes in a large academic teaching hospital in central Switzerland: external invaders or persisting circulators? J Clin Microbiol 48: Otter JA, French GL (2011) Communityassociated meticillin-resistant Staphylococcus aureus strains as a cause of healthcareassociated infection. J Hosp Infect 79: Varga M, Kuntova L, Pantucek R et al (2012) Efficient transfer of antibiotic resistance plasmids by transduction within methicillinresistant Staphylococcus aureus USA 300 clone. FEMS Microbiol Lett 332: Molla B, Byrne M, Abley M et al (2012) Epidemiology and genotypic characteristics of

32 Laboratory Detection of MRSA Isolates: A Review 21 methicillin-resistant Staphylococcus aureus strains of porcine origen. J Clin Microbiol 50: Krziwanek K, Metz-Gercek S, Mittermayer H (2009) Methicillin-resistant Staphylococcus aureus ST398 from human patients, upper Austria. Emerg Infect Dis 15: Mammina C, Cala C, Plano MR, Bonura C, Vella A, Monastero R, Palma DM (2010) Ventilator-associated pneumonia and MRSA ST398, Italy. Emerg Infect Dis 16: McCormick JK, Yarwood JM, Schlievert PM (2001) Toxic shock syndrome and bacterial superantigens: an update. Annu Rev Microbiol 55: Lina G, Piemont Y, Godail-Gamot F et al (1999) Involvement of Panton-Valentine leukocidin- producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infect Dis 29: Said-Salim B, Mathena B, Braughton K et al (2005) Differential distribution and expression of Panton-Valentine leucocidin among community-acquired methicillin-resistant Staphylococcus aureus strains. J Clin Microbiol 43: Labandeira-Rey M, Couzon F, Boisset S et al (2007) Staphylococcus aureus Panton- Valentine leukocidin causes necrotizing pneumonia. Science 315: Voyich JM, Otto M, Mathema B et al (2006) Is Panton-Valentine leukocidin the major virulence determinant in community-associated methicillin-resistant Staphylococcus aureus disease? J Infect Dis 194: Wang R, Braugton KR, Kretschmer D et al (2007) Identification of novel cytolytic peptides as key virulence determinants for community- associated MRSA. Nat Med 13: Barber M (1961) Methicillin-resistant staphylococci. J Clin Pathol 14: McDougal LK, Thornsberry C (1986) The role of beta-lactamase in staphylococcal resistance to penicillinase-resistant penicillins and cephalosporins. J Clin Microbiol 23: Tomasz A, Drugeon HB, de Lencastre HM et al (1989) New mechanism for methicillin resistance in Staphylococcus aureus : clinical isolates that lack the PBP 2a gene and contain normal penicillin-binding proteins with modified penicillin-binding capacity. Antimicrob Agents Chemother 33: Ubukata K, Yamashita N, Konno M (1985) Occurrence of a beta-lactam-inducible penicillin- binding protein in methicillin- resistant staphylococci. Antimicrob Agents Chemother 27: Chambers HF (1997) Methicillin resistance in staphylococci: molecular and biochemical basis and clinical implications. Clin Microbiol Rev 10: Fasola EL, Peterson LR (1992) Laboratory detection and evaluation of antibioticresistant Staphylococcus aureus nosocomial infections. Advances in pathology and laboratory medicine, vol 5. Mosby-Year Book, Inc., Chicago, IL, pp Hiramatsu K, Cui L, Kuroda M et al (2001) The emergence and evolution of methicillinresistant Staphylococcus aureus. Trends Microbiol 9: Song MD, Wachi M, Doi M et al (1987) Evolution of an inducible penicillin-target protein in methicillin-resistant Staphylococcus aureus by gene fusion. FEBS Lett 221: Katayama Y, Ito T, Hiramatsu K (2000) A new class of genetic element, staphylococcus cassette chromosome mec, encodes methicillin resistance in Staphylococcus aureus. Antimicrob Agents Chemother 44: Ito T, Katayama Y, Asada K et al (2001) Structural comparison of three types of staphylococcal cassette chromosome mec integrated in the chromosome in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 45: International Working Gropu on the Staphylococcal Cassette Chromosome elements. SCC_TypesEN.html. Accessed 26 Oct Ito T, Ma XX, Takeuchi F et al (2004) Novel type V staphylococcal cassette chromosome mec driven by a novel cassette chromosome recombinase, ccrc. Antimicrob Agents Chemother 48: Oliveira DC, Milheirico C, de Lencastre H (2006) Redefining a structural variant of staphylococcal cassette chromosome mec, SCC type VI. Antimicrob Agents Chemother 50: Takano T, Higuchi W, Otsuka T et al (2008) Novel Characteristics of community-acquired methicillin-resistant Staphylococcus aureus belonging to multilocus sequence type 59 in Taiwan. Antimicrob Agents Chemother 52: Hiramatsu K, Hanaki H, Ino T et al (1997) Methicillin-resistant Staphylococcus aureus clinical strain with reduced vancomycin

33 22 Elizabeth L. Palavecino susceptibility. J Antimicrob Chemother 40: Center for Disease Control and Prevention. CDC reminds clinical laboratories and healthcare preventionists of their role in the search and containment of vancomycin-resistant Staphylococcus aureus. HAI/settings/lab/vrsa_lab_search_contaiment.html. Accessed 23 July Appelbaum PC (2007) Reduced glycopeptides susceptibility in methicillin-resistant Staphylococcus aureus (MRSA). Int J Antimicrob Agents 30: Sievert DM, Rudrik JT, Patel JB et al (2008) Vancomycin-resistant Staphylococcus aureus in the United States, Clin Infect Dis 46: Finks J, Wells E, Dyke TL et al (2009) Vancomycin-resistant Staphylococcus aureus, Michigan, USA, Emerg Infect Dis 15: Tiwari HK, Sen MR (2006) Emergence of vancomycin resistant Staphylococcus aureus (VRSA) from a tertiary care hospital from northern part of India. BMC Infect Dis 26: Azimiam A, Havaei SA, Faseli H et al (2012) Genetic characterization of a vancomycinresistant Staphylococcus aureus isolate from the respiratory tract of a patient in a University Hospital in Northeastern Iran. J Clin Microbiol 50: Tenover FC, McDonald LC (2005) Vancomycin-resistant staphylococci and enterococci: epidemiology and control. Curr Opin Infect Dis 18: Severin A, Wu SW, Tabei K et al (2004) Penicillin-binding protein 2 is essential for expression of high-level vancomycin resistance and cell wall synthesis in vancomycinresistant Staphylococcus aureus carrying the enterococcal van A gene complex. Antimicrob Agents Chemother 48: Coldren FM, Palavecino E, Carroll DL (2005) Atomic force microscopy as a potential diagnostic technique in staphylococcal infections. Microsc Microanal 11(Suppl 2): Coldren FM, Palavecino EL, Levi- Polyachenko NH et al (2009) Encapsulated Staphylococcus aureus strains vary in adhesiveness assessed by atomic force microscopy. J Biomed Mater Res A 89: Tollersrud T, Berge T, Andersen SR et al (2001) Imaging the surface of Staphylococcus aureus by atomic force microscopy. APMIS 109: Boyle-Vavra S, Hahm J, Sibener SJ et al (2000) Structural and topological differences between a glycopeptide-intermediate clinical strain and glycopeptide-susceptible strains of Staphylococcus aureus revealed by atomic force microscopy. Antimicrob Agents Chemother 44: Crisostomo MI, Westh H, Tomasz A et al (2001) The evolution of methicillin resistance in Staphylococcus aureus : similarity of genetic backgrounds in historically early methicillinsusceptible and -resistant isolates and contemporary epidemic clones. Proc Natl Acad Sci USA 98: Enright MC, Robinson DA, Randle G et al (2002) The evolutionary history of methicillin- resistant Staphylococcus aureus (MRSA). Proc Natl Acad Sci USA 99: Robinson DA, Enright MC (2003) Evolutionary models of the emergence of methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 47: Feil EJ, Cooper JE, Grundmann H et al (2003) How clonal is Staphylococcus aureus? J Bacteriol 11: Oliveira DC, Tomasz A, de Lencastre H (2002) Secrets of success of a human pathogen: molecular evolution of pandemic clones of methicillin-resistant Staphylococcus aureus. Lancet Infect Dis 2: Bartel MD, Boye K, Rhod LA (2007) Rapid increase of genetically diverse methicillinresistant Staphylococcus aureus, Copenhagen, Denmark. Emerg Infect Dis 13: Peterson LR, Petzel RA, Clabots CR et al (1993) Medical technologists using molecular epidemiology as part of the infection control team. Diagn Microbiol Infect Dis 16: Tenover F, Arbeit R, Goering RV et al (1995) Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 33: McDougal LK, Steward CD, Killgore GE et al (2003) Pulsed-field gel electrophoresis typing of oxacillin-resistant Staphylococcus aureus isolates from the United States: establishing a national database. J Clin Microbiol 41: Stefani S, Chung DR, Lindsay JA (2012) Meticillin-resistant Staphylococcus aureus (MRSA): global epidemiology and harmonisation of typing methods. Int J Antimicrob Agents 39:

34 Laboratory Detection of MRSA Isolates: A Review Enright MC, Day NP, Davies CE et al (2000) Multilocus sequence typing for characterization of methicillin-resistant and methicillinsusceptible clones of Staphylococcus aureus. J Clin Microbiol 38: van Belkum A, Kluytmans J, van Leeuwen W et al (1995) Multicenter evaluation of arbitrarily primed PCR for typing of Staphylococcus aureus strains. J Clin Microbiol 33: Babouee B, Frei R, Schultheiss E et al (2011) Comparison of the DiversiLab repetitive element PCR system with spa typing and pulsed- field gel electrophoresis for clonal characterization of methicillin-resistant Staphylococcus aureus. J Clin Microbiol 49: Shopsin B, Gomez M, Montgomery SO et al (1999) Evaluation of protein A gene polymorphic region DNA sequencing for typing of Staphylococcus aureus strains. J Clin Microbiol 37: Milheirico C, Oliveira DC, de Lencastre H (2007) Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrob Agents Chemother 51: Oliveira DC, Milheirico C, Vinga S et al (2006) Assessment of allelic variation in the ccrab locus in methicillin-resistant Staphylococcus aureus clones. J Antimicrob Chemother 58: Dunman PM, Mounts W, McAleese F et al (2004) Uses of Staphylococcus aureus GeneChips in genotyping and genetic composition analysis. J Clin Microbiol 42: CLSI (2012) Performance standards for antimicrobial susceptibility testing; Twentieth informational supplement. CLSI document M100-S22. Clinical Laboratory Standard Institute, Wayne, PA 82. European Committee on Antimicrobial Susceptibility Testing (EUCAST). Clinical Breakpoints. Accessed 23 Sept Chambers HF, Hackbarth CJ (1987) Effect of NaCl and nafcillin on penicillin-binding protein 2a and heterogeneous expression of methicillin resistance in Staphylococcus aureus. Antimicrob Agents Chemother 31: Swenson JM, Tenover FC, Cefoxitin Disk Study Group (2005) Results of disk diffusion testing with cefoxitin correlate with presence of meca in Staphylococcus spp. J Clin Microbiol 43: Swenson JM, Williams PP, Killgore G et al (2001) Performance of eight methods, including two new rapid methods, for detection of oxacillin resistance in a challenge set of Staphylococcus aureus organisms. J Clin Microbiol 39: Tenover FC, Moellering RC (2007) The rationale for revising the Clinical and Laboratory Standards Institute vancomycin minimal inhibitory concentration interpretative criteria for Staphylococcus aureus. Clin Infect Dis 44: Swenson JM, Anderson KF, Lonsway DR et al (2009) Accuracy of Commercial and reference susceptibility testing methods for detecting vancomycin-intermediate Staphylococcus aureus. J Clin Microbiol 47: Steinkraus G, White R, Friedrich L (2007) Vancomycin MIC creep in non-vancomycinintermediate Staphylococcus aureus (VISA), vancomycin-susceptible clinical methicillinresistant S aureus (MRSA) blood isolates from J Antimicrob Chemother 60: Holmes RL, Jorgensen JH (2008) Inhibitory activities of 11 antimicrobial agents and bactericidal activities of vancomycin and daptomycin against invasive methicillin-resistant Staphylococcus aureus isolates obtained from 1999 through Antimicrob Agents Chemother 52: Sader HS, Fey PD, Fish DN et al (2009) Evaluation of Vancomycin and Daptomycin Potency Trends (MIC Creep) against Methicillin-Resistant Staphylococcus aureus Isolates Collected in Nine U.S. Medical Centers from 2002 to Antimicrob Agents Chemother 53: Howden BP, Davies JK, Johnson PDR et al (2010) Reduced vancomycin susceptibility in Staphylococcus aureus, including vancomyicnintermediate strains: resistance mechanisms, laboratory detection, and clinical implications. Clin Microbiol Rev 23: Hsu DI, Hidayat LK, Quist R et al (2008) Comparison of method-specific vancomycin minimum inhibitory concentration values and their predictability for treatment outcome of methicillin-resistant Staphylococcus aureus (MRSA) infections. Int J Antimicrob Agents 32: Charles PG, Ward PB, Johnson PD et al (2004) Clinical features associated with bacteremia due to heterogeneous vancomycinintermediate Staphylococcus aureus. Clin Infect Dis 38:

35 24 Elizabeth L. Palavecino 94. Howden BP, Ward PB, Charles PG et al (2004) Treatment outcomes for serious infections caused by methicillin-resistant Staphylococcus aureus with reduced vancomycin susceptibility. Clin Infect Dis 38: Gu B, Kelesidis T, Tsiodras S et al (2013) The emerging problem of linezolid-resistant Staphylococcus. J Antimicrob Chemother 68:4. doi: /jac/dks Tenover FC, Williams PP, Stocker S et al (2007) Accuracy of six antimicrobial susceptibility methods for testing linezolid against staphylococci and enterococci. J Clin Microbiol 45: Palavecino EL, Burnell JM (2013) False daptomycin non-susceptible MIC results by Microscan panel PC29 compared to Etest in Staphylococcus aureus and enterococci. J Clin Microbiol 51:281. doi: /JCM Friedrich L, Thorne G, Steenbergen JN et al (2009) Evidence for daptomycin Etest lotrelated MIC elevations for Staphylococcus aureus. Diagn Microbiol Infect Dis 65: Steed ME, Rybak MJ (2010) Ceftaroline: a new cephalosporin with activity against resistant gram-positive pathogens. Pharmacotherapy 30: Jones ME (2007) In vitro profile of a new beta-lactam, ceftobiprole, with activity against methicillin-resistant Staphylococcus aureus. Clin Microbiol Infect 13(Suppl 2): Farrell DJ, Castanheira M, Mendes RE et al (2012) In vitro activity of ceftaroline against multidrug-resistant Staphylococcus aureus and Streptococcus pneumoniae: a review of published studies and the AWARE Surveillance Program ( ). Clin Infect Dis 55(Suppl 3):S206 S Castanheira M, Sader HS, Farrel DJ et al (2012) Activity of ceftaroline-avibactam tested against Gram-negative organism populations, including strains expressing one or more β-lactamases and methicillin-resistant Staphylococcus aureus carrying various staphylococcal cassette chromosome mec types. Antimicrob Agents Chemother 56:

36 Chapter 2 Community-Associated Methicillin-Resistant Staphylococcus aureus Case Studies Madeleine G. Sowash and Anne-Catrin Uhlemann Abstract Over the past decade, the emergence of community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA) has changed the landscape of S. aureus infections around the globe. Initially recognized for its ability to cause disease in young and healthy individuals without healthcare exposures as well as for its distinct genotype and phenotype, this original description no longer fully encompasses the diversity of CA-MRSA as it continues to expand its niche. Using four case studies, we highlight a wide range of the clinical presentations and challenges of CA-MRSA. Based on these cases we further explore the globally polygenetic background of CA-MRSA with a special emphasis on generally less characterized populations. Key words Methicillin-resistant Staphylococcus aureus (MRSA), Methicillin-susceptible S. aureus (MSSA), Community-associated (CA)-MRSA, Hospital associated (HA)-MRSA 1 Introduction Staphylococcus aureus is a major human pathogen and colonizer in approximately % of individuals on mucosal surfaces and the skin [ 1 ]. S. aureus causes a wide spectrum of disease including skin and soft tissue infections (SSTI), pneumonia, bacteremia, endocarditis, and osteomyelitis [ 2 ]. Although S. aureus is often associated with antimicrobial drug resistance, large outbreaks of S. aureus predate the advent of widespread resistance. Methicillin resistance, conferred by a large transmissible staphylococcal cassette chromosome mec (SCC mec ), first emerged in 1961 and for the first 30 years became endemic as hospital-associated (HA)-MRSA affecting patients with underlying comorbidities or exposure to the healthcare setting [ 3 ]. The earliest reported MRSA infections acquired from the community date back to the 1980s when outbreaks of invasive infections occurred in intravenous drug users in Detroit [ 4, 5 ]. Nearly in parallel, first reports of MRSA infections acquired from the community emerged from indigenous populations in Yinduo Ji (ed.), Methicillin-Resistant Staphylococcus aureus (MRSA) Protocols, Methods in Molecular Biology, vol. 1085, DOI / _2, Springer Science+Business Media, LLC

37 26 Madeleine G. Sowash and Anne-Catrin Uhlemann remote areas in Western Australia [ 6 ]. These strains initially were genetically diverse and distinct from other clones circulating in Australia. By the late 1990s, MRSA infections acquired from the community were recognized as a distinct clinical entity [ 7 ] owing to their emergence among young and healthy individuals without the traditional healthcare risk factors as well as their distinct genetic background and relatively preserved antimicrobial susceptibility patterns. However, the epidemiology and definition of these community- associated (CA)- and HA-MRSA are evolving as CA-MRSA lineages are increasingly invading the healthcare system, contributing to nosocomial infections [ 8, 9 ], and accumulating greater drug resistance. This case series aims to highlight recent insights into the global molecular epidemiology of communityassociated S. aureus and in particular MRSA infections. 2 Methods The definition of what constitutes CA-MRSA remains poorly delineated. This term has been used interchangeably to indicate the source of the infection, the S. aureus genotype and antibiotic phenotype. Classical CA-MRSA presents as community-onset, retains susceptibility to non-β-lactam antibiotics, harbors smaller SCC mec cassettes IV and V and frequently carries the luksf-pv genes, encoding for the Panton Valentine leukocidin toxin (PVL). Although several definitions for CA-MRSA have been proposed, the Centers for Disease Control and Prevention (CDC) definition of CA-MRSA is the most widely used (see below). 2.1 CDC Definition of CA-MRSA Infection 1. Positive culture for MRSA as an outpatient or within 48 h of hospital admission. 2. No medical devices or indwelling catheters that are permanently placed though the skin. 3. No history of MRSA infections. 4. No recent history of hospitalization or residence in nursing home or long-term care facility. For the purpose of this case series we will use this epidemiological definition of CA-MRSA and consider it as a unique disease entity. Although HA-MRSA strains are rarely transmitted in the community, genetic lineages of CA-MRSA have penetrated into the healthcare system making a distinction of CA- and HA-MRSA based on genotype obsolete. Nevertheless, recognition of the unique genetic features of these lineages is important in understanding some of the clinical properties and antibiotic phenotypes for optimizing treatment and preventive efforts. An additional limitation in comparing molecular epidemiology studies on

38 CA-MRSA Case Studies 27 CA-MRSA is the wide variety of genotyping techniques and epidemiological definitions that are being used. For example, several groups have used genotypic methods only to identify CA-MRSA, in particular by employing the presence of SCC mec types IV or V as a signature for CA-MRSA. However, the utility of this method relies on the strict association of CA-MRSA and SCC mec types IV and V, which in light of the changing epidemiology of CA-MRSA in many cases is not a reliable assumption anymore. For the purpose of this review we have used MLST results as the primary mode of describing S. aureus clones and comparing them between studies. We have added additional genotyping information, as it was available or relevant. The most commonly used genotyping techniques include: Multi-locus sequence typing (MLST) [ 10 ]. Sequencing of internal fragments of specific housekeeping genes. Seven gene loci are compared in S. aureus carbamate kinase ( arcc ), shikimate dehydrogenase ( aroe ), glycerol kinase ( glpf ), guanylate kinase ( gmk ), phosphate acetyltransferase ( pta ), triosephosphate isomerase ( tpi ), and acetyl coenzyme A acetyltransferase ( yqil ). Sequence differences in each gene are considered alleles and the seven gene loci create an allelic profile by which the sequence type is determined. Pulse Field Gel Electrophoresis (PFGE) [ 10 ]. Genomic DNA isolated from S. aureus is digested by Sma I and run through a gel matrix by alternating electric currents. Banding pattern created is based on size of each fragment. Banding pattern is compared to reference strains to determine PFGE type. Spa-typing [ 10 ]. Highly polymorphic staphylococcal protein A (spa) is amplified and sequenced. Sequencing of single gene locus is more efficient and costeffective than MLST. Ridom SpaServer ( ) and egenomics ( ) are used to compare sequence and number of repeats. SCC mec typing [ 11 ]. The mec gene encoding methicillin resistance is found within a mobile genetic element called staphylococcal cassette chromosome mec (SCC mec ).

39 28 Madeleine G. Sowash and Anne-Catrin Uhlemann SCC mec elements are typed I XI based on structural organization and genetic content, particularly the sequence of the mec and ccr gene complexes. SCC mec subtypes are based on variation in regions other than the mec and ccr gene complexes. HA-MRSA traditionally carries SCCmec types I, II, or III, while CA-MRSA was initially characterized by SCCmec type IV and V. International Working Group on the Classification of Staphylococcal Cassette Chromosome ( ). 3 Case Studies 3.1 An Outbreak of CA-MRSA Skin and Soft Tissue Infections in the USA Current Characteristics and Global Burden of CA-MRSA SSTIs From August to September 2003, an outbreak of USA300 community- associated MRSA causing SSTIs was documented amongst a California collegiate football team [ 15 ]. 11 members from a team of 107 players presented almost exclusively with a boil on their elbows during the start-of-season training camp, a 2-week period of rigorous physical activity when many players lived in close proximity. During the preceding season in 2002, two players had already encountered USA300 CA-MRSA SSTIs. To identify the source of these infections, 99 players were screened for S. aureus nasal carriage, and 8 (8 %) of the players were colonized with MRSA. One of these MRSA carriers was previously infected, occupied the locker directly across from the index case of the 2003 outbreak, and shared a room with another case during the training camp. The clustering of cases and carriers by locker room assignments was also more generally observed. Multivariate analysis identified the sharing of soap and towels as a significant risk factor for both CA-MRSA infection and carriage. Four MRSA isolates from culture confirmed cases were analyzed by pulse-field gel electrophoresis (PFGE). These PFGE patterns were identical to each other, the two 2002 season SSTI cases, and the USA300 strain isolated from other SSTI outbreaks in Los Angeles County. Despite the implementation of numerous infection control measures, including hexachlorophene showers, decolonization efforts, and hygiene education, an additional outbreak of four SSTI cases occurred from October to November 2003 and a single recurrent case occurred during the 2004 season. Tracking the incidence of CA-MRSA SSTI in this college football team from 2002 to 2004 illustrates the high rate of recurrence at the individual and group level and the difficulty of eradication in the athletic setting. This case highlights a number of unique features of CA-MRSA, in particular the frequent presentation as SSTIs, the potential for recurrent infections, the role of close physical contact and

40 CA-MRSA Case Studies 29 Fig. 1 Global distribution of major CA-MRSA lineages by multi-locus sequence typing contaminated objects as well as the propensity to cause outbreaks among young and healthy athletes. Initially, CA-MRSA was mainly recognized during outbreaks and was found to disproportionally involve athletes [ ], military personnel [ 16 ], prisoners [ 16 ], children in day-care centers [ 17 ], indigenous populations [ 18 ], and Pacific Islanders [ 19 ]. Since their initial recognition, polygenetic lineages of CA-MRSA have become endemic in communities worldwide (Fig. 1 ) and mainly contribute to an epidemic of SSTIs, but invasive disease with unfavorable outcomes occur in a substantial number of cases. It is difficult to estimate the current global burden of CA-MRSA in part because studies on the prevalence of MRSA from many parts of the world are still lacking [ 20 ]. Nevertheless, based on currently available data, 5 of about 20 distinct genetic lineages are globally prevalent, including ST1-IV (WA-1, USA400), ST8-IV (USA300), ST30-IV (South West Pacific clone), ST59-IV/V/V T (USA1000, Taiwan clone), and ST80-IV (European clone). In particular ST8-IV and ST30-IV have been relatively frequently reported from every continent and can be considered pandemic clones [ 21 ]. This co-emergence of multiple CA-MRSA lineages is striking and no single genetic or epidemiological factor has been identified that accounts for the extraordinary success of some genetically distinct clones. However, it has been generally accepted that the smaller SCC mec cassettes IV and V that are typically seen in CA-MRSA may provide a fitness advantage based on their increased growth rate compared to the larger elements I III seen in traditional HA-MRSA lineages [ 22 ].

41 30 Madeleine G. Sowash and Anne-Catrin Uhlemann USA300: Prototype of CA-MRSA In general, it appears that the USA carries some of the highest burden of CA-MRSA conferred by a single clone, whereas Europe has a lower prevalence and a higher genetic diversity of CA-MRSA [ 20 ]. The initial wave of CA-MRSA in the USA was attributed to USA400 (MW2), which was rapidly replaced by a seemingly unrelated clone, PFGE-type USA300-ST8-SCC mec IV. In 2005, based on data from San Francisco, it was estimated that ~90 % of all MRSA infections were community-associated with USA300 predominating [ 23 ]. Since, this single clone has accounted for the majority of all CA-MRSA infections in the 48 contiguous states of the USA. USA300 is currently the single most widely reported CA-MRSA clone and has been described from every continent except Antarctica [ 24 ]. CA-MRSA, in particular USA300, has been the most common cause of SSTIs in urban emergency departments in the USA over the past few years [ 25, 26 ]. These CA-MRSA infections precipitate a significant economic burden on the individual and societal level [ 27 ]. The basis for this tremendous success remains only partially understood. On the basis of CA-MRSA outbreak data, the Centers for Disease Control and Prevention developed a conceptual model incorporating epidemiological risk factors. This Five Cs of CA-MRSA Transmission model suggests that MRSA infection results from: (1) Contact, direct skin to skin; (2) lack of Cleanliness; (3) Compromised skin integrity; (4) Contaminated object surfaces and items; and (5) Crowded living conditions [ 28 ]. Observational research has also recognized the household as a potentially important transmission setting for S. aureus. Several reports document the spread of CA-MRSA within households and the potential for these strains to ping pong and cause recurrent infections among family members [ 29 ]. Close personal contact with household members who have a skin infection may also increase the risk of transmission and young children appear to be particularly important as reservoirs and potential vectors for CA-MRSA [ 30, 31 ]. Several studies have also commented on the increase in nasal and extra-nasal colonization with CA-MRSA strains [ 32 ] and the potential of household surfaces as sources for transmission or of recurrent infections [ 28, 30, 33 ]. However, in many cases, including outbreak (epidemic) and non-outbreak (endemic) CA-MRSA, it is often impossible to identify an endogenous source of the infection, such as nasal colonization, despite the increased risk for subsequent infection in nasal carriers. The resolution of the whole genome sequence of USA300 revealed five large genetic elements on the chromosome and three plasmids [ 34 ]. USA300 contains SCC mec IVa, the arginine catabolic mobile genetic element (ACME), a novel pathogenicity island SAPi5 encoding two enterotoxins Seq and Sek as well as prophages ϕsa2usa (encoding PVL) and ϕsa3usa containing staphylokinase and chemotaxis-inhibiting protein. ACME is present in about 85 % of USA300 isolates. Recently, it has been found that the

42 CA-MRSA Case Studies 31 spermidine acetyltransferase gene ( spe G) may play a major role in protecting USA300 from polyamines, which S. aureus in general is very susceptible to [ 35 ]. This could explain in part the apparently increased colonization and transmission capacities of USA Putative Virulence Factors of CA-MRSA 3.2 A Case of CA-MRSA Necrotizing Pneumonia from Australia At the beginning of the CA-MRSA epidemic, a strong relationship was noted between the presence of bacteriophage encoded cytolytic toxin PVL and the observed clinical virulence of the strains, in particular its association with furunculosis, a type of skin infection [ 36 ]. Moreover, this bi-component toxin, encoded by the luks and lukf genes, was generally absent from traditional HA-MRSA [ 36 ]. However, CA-MRSA clones that lack PVL and remain comparably virulent have been observed, and isogenic PVL gene deletion mutants lacked a substantial shift in virulence in animal models [ 37 ]. Investigations have been hampered by the fact that PVL only lyses neutrophils of humans and rabbits, but not those of many other common animal models [ 38 ]. Studies in rabbit infection models have suggested that PVL may contribute significantly to particular types of infections, such as severe lung infections and osteomyelitis [ ]. However, in a rabbit skin infection model, PVL was not found to contribute to the virulence of USA300, whereas α-toxin, phenol-soluble modulin-alpha peptides (PSMα), and accessory gene regulator (Agr) did [ 42 ]. In light of these differences, the debate continues about the exact role of PVL in the CA-MRSA epidemic. Therefore, PSM or core-genome virulence factors such as α-toxin have been implicated in the documented increased virulence of CA-MRSA compared to HA-MRSA [ 37, ]. The α-toxin significantly contributes to CA-MRSA virulence in the skin and lung infection models [ 42, 43 ]. Furthermore, a core-genome encoded toxin, SEIX, contributed to lethality in a necrotizing pneumonia model [ 45 ]. PSMs are small cytolytic peptides that appear to express much stronger in CA-MRSA than in HA-MRSA [ 37 ]. A variant, PSM-mec, is encoded on select SCC mec elements and when present contributes significantly to S. aureus virulence [ 46 ]. In addition, the activity of the global regulator Agr, contributes to expression of toxins [ 47 ]. A 23-year-old woman presented to an emergency department with acute radicular lower back pain and was discharged despite tachycardia and fever [ 48 ]. 2 days later, she presented again with continued back pain, shortness of breath, vomiting, myalgia, fever, sweating, dry cough, and anterior pleuritic chest pain. The patient was noted to have an erythematous lesion on her left elbow and a family history of recurrent furunculosis. Upon admission to the hospital, she was again tachycardic and febrile but also hypotensive and tachypnic requiring a non-rebreather. Her exam was notable for a furuncle on her left elbow, midline and left paraspinal tenderness over T8/9,

43 32 Madeleine G. Sowash and Anne-Catrin Uhlemann as well as tenderness in the right upper quadrant of her abdomen. Blood work showed a predominantly neutrophilic leukocytosis, thrombocytopenia, coagulopathy, renal dysfunction, an elevated creatinine level, and her chest X-ray showed bilateral multilobar consolidation. Her initial treatment included empirical IV antibiotics (ticarcillin/clavulanate, gentamicin, and azithromycin), fluid resuscitation, a noradrenaline infusion, and IV hydrocortisone, and subsequently also 2 g dicloxacillin. 6 h after admission, the patient s respiratory status deteriorated and precipitated intubation and mechanical ventilation. Circulatory deterioration continued despite the addition of activated protein C and vasopressin and high-dose noradrenaline and adrenaline infusions. 14 h after admission, Staphylococcus was identified in an initial blood culture, and IV vancomycin 1,000 mg was added. At 16 h after admission, the patient first went into ventricular tachycardia and despite attempts of resuscitation the patient died 1 h later. Thereafter, blood cultures, endotracheal aspirates, and furuncle swabs and biopsies all returned positive for MRSA. The MRSA isolates were sensitive to multiple antibiotics, including erythromycin, clindamycin, gentamicin, tetracycline, ciprofloxacin, and vancomycin. All isolates were Panton Valentine Leukocidin positive and resembled ST93-IV ( Queensland clone ) CA-MRSA. Subsequently, nasal swabs collected from three family members, including two who suffered from recurrent furunculosis, were also positive for the Queensland clone CA-MRSA Burden of CA-MRSA in Australia CA-MRSA became endemic in Northern Australian indigenous communities in the 1990s and was caused by a remarkable diversity of genetic backgrounds. These included the pandemic CC1, CC5, CC45, and CC8 backgrounds as well as the smaller CC298 lineage [ 49 ]. Notably, all but one of these CCs was PVL negative. Since then, the molecular landscape of S. aureus infections across the country has changed considerably. Based on national surveys of CA- S. aureus infections since 2000 a steady increase in CA-MRSA from 6.6 % in 2000 to 11.5 % in 2010 has been documented, which was mainly accounted for by the emergence of ST93-IV PVL + [ 50 ]. In 2010, this strain constituted 41 % of all CA-MRSA, 28 % of all MRSA and 4.9 % of all S. aureus community-onset infections [ 51 ]. In addition, many diverse types contribute to CA-MRSA, including ST1-IV-PVL-negative (WA-1) and South West Pacific ST30-IV-PVL-positive, which account for about 15 % of CA-MRSA each, whereas the multidrug resistant ST239-III still dominates as the most common HA-MRSA strain in Australia [ 52 ]. International CA-MRSA lineages such as PVL-positive ST30-IV, ST8-IV, ST59-IV, ST80-IV, and ST772-V (Bengal Bay) have also increased in prevalence [ 53 ]. For example, USA300-like West Australian (WA) MRSA-12 clone was noted in the area near Perth and by a combination of MLST, PFGE, and PVL-typing as

44 CA-MRSA Case Studies 33 well as by prevalence of ACME [ 33 ], found to be indistinguishable from the North American USA300 [ 54 ]. Infections with ST93-MRSA predominantly manifest as SSTI, but an enhanced clinical virulence as evidenced by reports of severe invasive infection such as necrotizing pneumonia, deep-seated abscess, osteomyelitis, septic arthritis, and septicemia has also been suggested [ 48, 52 ]. ST93 has now also been described in New Zealand and the UK and many of these cases could be epidemiologically linked to Australia [ 55 ]. ST93 initially carried few antibiotic resistance determinants except for erm C, which was identified in several early MSSA and MRSA (parallel to USA300). More recently, additional resistance determinants such as msr (A) and tet K have been reported in some ST93 isolates [ 50 ]. By MLST analysis ST93, most frequently associated with SCC mec IV (2B) and PVL positive, represents a singleton and is distinct from other S. aureus clones and unlikely related to the early Australian CA-MRSA clones. However, a high prevalence of ST93 MSSA carrying PVL was noted in studies in Aboriginal communities in the 1990s, giving rise to the idea that these isolates may have served as the direct precursor [ 56 ]. It has been suggest that the overall heavy burden of MRSA and MSSA in Aboriginal communities in Northern Australia, which includes a phylogenetically distinct lineage ST75 [ 57 ], may continue to give rise to novel MRSA clones [ 58 ]. As with USA300 the apparent increased virulence of ST93 in its clinical presentation is mirrored in increasing virulence in a model system, namely, the wax moth larvae and mouse skin in vivo models [ 59 ]. In the latter, ST93 was even more virulent than USA300 [ 59 ]. Based on whole-genome sequencing, both strains contain α-hemolysin, PVL, and α-type phenol soluble modulins but no overt novel virulence determinant has been identified in ST93. This suggests changes in gene expression or subtle genetic alterations. 3.3 The Invasion of CA-MRSA into the Healthcare Setting In 2006, a 46-year-old male presented to an emergency department with severe lower abdominal pain, fever, and chills [ 60 ]. The patient had a history of diabetes mellitus, end-stage liver disease due to hepatitis C infection, and benign prostatic hypertrophy and had been admitted 3 weeks prior to a different hospital for a urinary tract infection. This infection was treated with intravenous ciprofloxacin and vancomycin as well as an indwelling Foley catheter. In the emergency department, the patient was again diagnosed with a urinary tract infection and acute renal failure, admitted to the hospital and treatment with empirical levofloxacin and vancomycin was initiated. 2 days after presentation, blood and urine cultures revealed the presence of MRSA and further workup revealed a 2 cm vegetation on the non-coronary cusp of the aortic valve, consistent with MRSA endocarditis. Despite continued vancomycin

45 34 Madeleine G. Sowash and Anne-Catrin Uhlemann treatment, MRSA was still recovered from blood cultures on days 7, 10, and 11 after presentation. These isolates were susceptible to chloramphenicol, clindamycin, daptomycin, gentamicin, linezolid, rifampin, tetracycline, and trimethoprim-sulfamethoxazole. They were also intermediate to levofloxacin and had a vancomycin MIC of 1 μg/ml. On day 12, antibiotic therapy was switched from vancomycin to daptomycin due to worsening renal failure. The patient was transferred to the original hospital for cardiovascular surgery on day 18, and MRSA with an intermediate resistance to vancomycin (MIC = 8 μg/ml) and non-susceptible to daptomycin (increased MIC from 0.5 to 4 μg/ml) were identified in cultures from day days after his presentation, the patient died. Molecular typing revealed that he had been infected with a PFGE-type USA300 strain carrying the SCC mec IVa element and the PVL gene. This case illustrates a patient with traditional risk factors for HA-MRSA being infected with a prototype of CA-MRSA as well as the ability to develop glycopeptide resistance in CA-MRSA isolates CA-MRSA and Nosocomial Infections One of the early defining features of the CA-MRSA epidemic was the lack of traditional nosocomial risk factors in affected patients. Since, nosocomial outbreaks of CA-MRSA strains have been observed in numerous countries around the world, including Australia, the UK, the USA, Japan, Israel, and Italy [ ], as well as the establishment of CA-MRSA genotypes as primary hospital- associated infections [ 9, 68 ]. Only shortly after the recognition of CA-MRSA in Australia, the first report of a single-strain outbreak with EMRSA-WA95/1 in an urban Western Australian hospital occurred in the mid-1990s [ 61 ]. The two index patients originated from a remote region of Western Australia. A subsequent analysis of S. aureus carriage examining multiple body sites revealed a high prevalence of MRSA colonization in their two communities (39 and 17 %) with isolates that were indistinguishable from the outbreak strain by molecular typing [ 61 ]. As in this case most of the reported nosocomial CA-MRSA outbreaks have only involved a small number of patients. To date the apparently largest documented outbreak involved the spread of ST22-PVL + and ST80-PVL + in 10 healthcare institutes in southern Germany. This resulted in 75 cases, including 52 patients, 21 healthcare workers, and 2 private contacts [ 66 ]. Many of the reported nosocomial CA-MRSA outbreaks have been related to neonatal or maternity units, such as in New York City with two outbreaks of MW2/USA400-IV-PVL+ [ 62, 63 ], in the UK with Australian WA-MRSA-1 (ST1-IV-PVL-) [ 64 ] and ST30-IVc- PVL + involving several Filipino healthcare workers [ 65 ], in Israel in a neonatal ICU with ST45-PVL [ 67 ], and in Italy related to USA300 [ 69 ]. These occurrences frequently involved asymptomatic colonization of either close family contacts or healthcare workers.

46 CA-MRSA Case Studies 35 Nosocomial outbreaks with USA300 were also encountered in Japan [ 70, 71 ]. However, already early on in the USA300 epidemic there was evidence that this clone rapidly started to contribute to the burden of MRSA in the hospital setting [ 23 ]. More recently, USA300 was found to account for 28 % of healthcareassociated bloodstream infections (contact with healthcare facility within year prior to admission) and 20 % of nosocomial infections (positive blood culture more than 48 h after admission)[ 9 ]. In parallel, an increase in colonization with strains consistent with USA300 was also noted in pediatric ICU patients from 2001 to 2009, where in % colonization isolates had a spa -type consistent with USA300 and 29 % of isolates were PVL positive [ 72 ]. Likewise, other CA-MRSA such as ST93 and ST30 in Australia are now more likely to be acquired in the hospital than in the community [ 68 ]. This remarkable success of USA300 and other CA-MRSA strains also in the hospital setting is contrasted by investigations that have suggested that CA-MRSA might be less successful than HA-MRSA in the hospital environment because of their generally higher susceptibility to a variety of antibiotics [ 73 ]. In a comparison of CA-MRSA and HA-MRSA transmission in four Danish hospitals, the nosocomial transmission rate of HA-MRSA was estimated to be 9.3 times higher than for CA-MRSA (defined as USA300-ST8, the SW Pacific clone ST30, USA400, and the European clone ST80). All other genotypes were classified as HA-MRSA [ 73 ]. In addition, in some instances CA-MRSA clones present in the general population may be less capable of infiltrating the healthcare environment as shown in a Spanish pediatric hospital [ 74 ]. However, as CA-MRSA clones have spread and diversified, we have seen a steady rise in antibiotic resistance among CA-MRSA isolates [ 26, 50 ], which may in part account for their increasing resilience in the hospital setting. In that context, the occurrence of a decreased susceptibility to vancomycin in USA300 isolates is not surprising [ 72, 75 ], but the prospect of multidrug resistance in strains with increased virulence is a source of great concern. 3.4 CA-MRSA and Travel In March 2006, a 47-year-old Caucasian man presented to a dermatology outpatient unit in Switzerland [ 76 ]. The patient had recently returned from a 1-week scuba diving trip in the Philippines (Bohol Island and Negros Island), and two skin abscesses were noted on the patient s right forearm. Upon returning from the trip, the patient had noticed two insect bite-like lesions on his right forearm. Within 2 days, the lesions were red and itchy. Despite the use of corticoid treatment, the lesions progressed to become abscesses and were accompanied by edema of the forearm and the back of the hand. He was prescribed topical fucidin cream and oral amoxicillin/clavulanic acid therapy, but the abscesses continued to worsen. The larger abscess measured 2 cm in diameter, and

47 36 Madeleine G. Sowash and Anne-Catrin Uhlemann green- yellowish discharge was observed. No fever, adenopathy, or other symptoms were documented. Upon presentation, a PVLpositive ST30 CA-MRSA with resistance only to β-lactam antibiotics was recovered. Following hospitalization, the abscesses were drained and a 5-day course of oral trimethoprim-sulfamethoxazole and topical mupirocin and ichthammol was commenced. The lesions began to resolve within a few days. ST30, also known as the South West Pacific clone, is a prominent CA-MRSA clone in the Philippines and is very rarely found in Switzerland, supporting the Philippines as the origin of this infection. The combination of minor skin abrasions from the patient s scuba diving activities and exposure to a local CA-MRSA clone resulted in deep-seated abscesses requiring hospitalization and drainage International Molecular Epidemiology A number of studies have directly or indirectly documented that returning international travelers with MRSA infections have contracted strains specific to their country of vacation [ ]. Furthermore, it has been suggested that PVL + MSSA, often detected at high frequency in parts of Africa, may have acted as a reservoir for CA-MRSA [ 80, 81 ]. The emergence of methicillinresistance is to not exclusively linked PVL-positive MSSA as for example USA300 appears to have evolved from a USA500 progenitor where the acquisition of PVL was one of the last steps in this process [ 82 ]. Nevertheless, the high frequency of pandemic lineages associated with MRSA in Africa is striking, but relatively little is known about the S. aureus population structure as most S. aureus molecular epidemiology studies were carried out in the USA, Australia (both discussed above), and Europe. In general, it is considered that Europe has a lesser burden of CA-MRSA than the USA with perhaps the exception of Greece [ 83 ]. A variety of international S. aureus strains are present, which mainly include ST80, ST1, ST8, ST30, and ST59 on the continent as well as ST93 in England. In addition, sporadic ST152 MRSA isolates have been recovered in Central Europe, the Balkan, Switzerland and Denmark and it has also been speculated that these may have derived from African ST152 MSSA strains [ 84 ]. Previously, ST80 (European clone) was predominant, but now USA300 is also emerging as major clone [ 83 ]. The European MRSA epidemiology was recently reviewed by Otter and French and will not be further discussed here [ 83 ]. The following section aims to highlight recent advances on the burden and molecular epidemiology of S. aureus in Asia, Africa, Middle East, and Latin America. In light of the paucity of data from some more remote parts of the world, a number of studies were included that lacked detailed genotyping, but that nevertheless provide valuable information in estimating the burden of MRSA in select remote geographic regions (Tables 1 and 2 ).

48 Table 1 Molecular epidemiology of S. aureus infections in diverse geographic regions Number Patients Number S. aureus Region Year Source and Population MSSA MRSA (%) CA-MRSA (% of MRSA) Molecular typing Comments Africa African towns [ 98 ] Cameroon Morocco Niger Senegal Madagascar Tunisia [ 95 ] Tunisia [ 124, 125 ] Algeria [ 96 ] Egypt [ 97 ] Clinically suspected S. aureus infections at five African tertiary care centers Case series of invasive CA-MRSA Outpatients mainly with SSTIs Inpatients and Outpatients Private clinic Zagazug City, all sites 542/555 isolates (15 %) 9 (10.5 %) by epidemiology MRSA: ST239 / 241 (40 %), ST88 (28 %), ST5 (21 %); also ST8, ST30, ST1289; 20 (23 % of MRSA) PVL+ CA-MRSA (%): ST88 [ 45 ], ST5 [ 45 ], ST8 [ 10 ], all SCC mec IV Overall low prevalence of MRSA and minimal evidence for significant CA-MRSA N.A. 14 (100 %) All None Increasing CA-MRSA N.A. 64 (100 %) All All ST80 -IV - t044 - PVL + Some minor variation on PFGE (33 %) Unknown 61 MRSA selected (20 CA-MRSA) ST80 most common in HA- and CA-MRSA; also ST5 N.A. 21 (100 %) 4 (19 %) by epidemiology CA-MRSA ( n = 4): ST80, ST30, ST1010, all PVL+ Single clone with low drug resistance PVL + 72 %, multidrug resistance ST80 distinct to European ST80 as tetracycline, fusidic acid sensitive (continued)

49 Table 1 (continued) Region Year Source and Population Number Patients Number S. aureus MSSA MRSA (%) CA-MRSA (% of MRSA) Molecular typing Comments Nigeria South West [ 103 ] South West [ 104 ] South West [ 126 ] South West and North East [ 127 ] Clinical (1.4 %) Unknown 45 PFGE types, 9 wide spread, major type = 23 % Patients admitted to two hospitals (70 % wounds, 21 % ENT) Before 2012 Tertiary hospital patients ,300/346 S. aureus (20 %) 33 (47 %) by epidemiology (41 %) 8 (17 %) by PBP4 typing MRSA: 3/4 ST8 MSSA: ST5 (28 %), ST7 (16 %), ST121 (13 %), ST30 (11 %), ST8 (9 %), other ST1, ST15, ST508, ST80, ST25, ST72 MRSA: ST88 - IV (47 %); ST241-IV (10 %), ST250-I (43 %) No clonal typing 28 (41 %) of MSSA PVL+ All MRSA PVL- Hospital infections (16 %) Unknown MSSA: CC15 (32 %), CC8 (14 %), CC30 (5 %), CC121 (14 %), CC5, CC1; PVL + 40 % Student carriage (0 %) MRSA: ST241 -III - t037 (55 %), ST8 - V - t064 / t451 (27 %), ST94- IV-t008 (CC8), ST5- V-t002, all PVL- Rare MRSA, no evidence for CA-MRSA CA-MRSA (all ST88) with ophthalmologic and auricular infections Low prevalence of CA-MRSA High resistance to tetracycline, cotrimoxazole (70 %)

50 North East [ 84 ] Togo, Lome [ 128 ] Gabon [ 105 ] South Africa South Africa [ 109 ] Capetown [ 108 ] 2007 Clinical specimens six tertiary care hospitals Outpatients with SSTIs Patients with SSTIs (31), bacter-emia (11) Nationwide survey of invasive and non-invasive MRSA MRSA from five city hospitals (13 %) Unknown All MRSA ST241 - III - PVL - No evidence for CA-MRSA Diverse MSSA, ST152 Most ST152 MSSA (19 %), CC8 (25 %), CC121 (13 %), CC1 (13 %), one isolate (6 %) each: CC5, CC9, CC15, CC30, CC80 PVL (36 %) All None 42 % with impetigo (11 %) Unknown MSSA: ST15 (33 %), ST88 (17 %), ST1 (15 %), ST152 (12 %), <10 %: ST5, ST8, ST1746 MRSA ( n = 6): all ST % PVL N.A. 320 (100 %) Unknown 31 PFGE types and 31 spa types, spacc64 - IV - ST612 (25 %) spa-cc12- II-ST36 (24 %), spa-cc37- III-ST239 (21 %), t045-i-st5 N.A. 100 (100 %) 10 (10 %) by epidemiology ST612 -MRSA - IV (CC8, 40 %) ST5-MRSA-I (37 %) ST239-MRSA- III ST36-MRSA-II First MRSA national surveillance ST612 with multidrug resistance (continued)

51 Table 1 (continued) Region Year Source and Population Number Patients Number S. aureus MSSA MRSA (%) CA-MRSA (% of MRSA) Molecular typing Comments Middle East Israel [ 129 ] National survey, five general hospitals 315 N.A. 315 (100 %) 160 (51 %) by epidemiology Mostly t001 - I (31 %), t002-ii (26 %), t008-iv (7 %) SCC mec IV and V among HA-MRSA ~50 % invasive and wound infections Lebanon [ 130 ] Kuwait [ 114, 131 ] Kuwait [ 132 ] Random selection of S. aureus isolates from inpatients and outpatients National survey from seven hospitals Surveillance of 13 hospitals with 1,765 inpatients and 81 outpatients 130 1,457 1, (75 %) Not defined MRSA: t044 -ST80 - IVc - PVL + (38 %), ST30-IVc, ST97-V, ST8-IVc, ST6-IVc, ST22-IVc, ST5-IVc, ST239-III; PVL + 62 % MSSA: ST5, ST30, ST121, ST1, ST80; PVL + 20 % 1, (5.2 %) 26 (34 %) by SCC mec type 1, (32 %) 101 (17 %) by SCC mec type and non-mdr phenotype MRSA: ST80 - IV (26 %), ST30 - IV (31 %), also ST8-IV, ST5-IV, ST728-IV; PVL + 77 % SSTIs due to ST80 No clonal typing Stable MRSA prevalence; possible increase in CA-MRSA Iran Tehran [ 133 ] Hospital (36 %) 2 (2 %) by SCC mec typing Only 2 % carried SCC mec IV 98 % SCC mec III SCC mec III isolates MDR

52 Tehran [ 134 ] Isfahan [ 115 ] Saudi Arabia [ 135 ] Bahrain [ 136 ] Latin America Cuba [ 137 ] Martinique, Dominican Republic [ 79 ] 2009 Teaching hospital 140 N.A. 140 (100 %) Unknown Five PFGE types: ST239 (82 %), ST1238 (15 %), ST8 (1 %) No evidence for CA-MRSA 2010 Hospital, consecutive S. aureus infections (20 %) 2 (12 %) MRSA: ST15, ST25, ST239 (41 %), ST291, ST (26 %) CA-MSSA MSSA: Majority (76 %) due to ST8, ST22, ST30, ST6 No significant evidence for CA-MRSA, ST8-MSSA-PVL as HA-SA Tertiary care hospital Diverse MRSA isolates N.R. 107 (100 %) Unknown High diversity of MRSA, ST239 -III (21 %), CC22 -IV (28 %), CC80-IV (18 %), CC30-IV (12 %) N.A. 53 (100 %) 7 (13.3 %) by SCC mec type 54 % PVL+ No clonal typing SCC mec III isolates 13.3 % SCC mec IV (5/7 were MDR PVL+) 87 % SCC mec III Putative MRSA from three hospitals and national reference center Reference laboratory DR Hospital outpatients MQ (59 %) Unknown MRSA: spa t149 (60 %, historically ST5), t008 (20 %), t037 (15 %), t4088, t2029 All t008 PVL (20 %) Unknown MSSA: ST30 (33 %), ST5 (8 %), ST398 (8 %), ST8 MRSA: ST72 (23 %), ST30 (27 %), ST5 (18 %) (39 %) Unknown MSSA: diverse; ST152 (15 %), ST398 (10 %), ST5 MRSA: ST8 -IVc - t304 (80 %) 41 % discrepancy between phenotyping and genotyping (meca) MRSA 80 % with SCC mec IVa Older patients, possible HA-MRSA (continued)

53 Table 1 (continued) Region Year Source and Population Number Patients Number S. aureus MSSA MRSA (%) CA-MRSA (% of MRSA) Columbia, Ecuador, Peru, Venezuela [ 138 ] tertiary care hospitals, consecutive isolates 1, (41 %) Peru 62 %, Colombia 45 %, Ecuador 28 %, Venezuela 17 % 174 (27 %) by PFGE, SCC mec, PVL genotyping Uruguay [ 139 ] Uruguay [ 140 ] Inpatient and outpatient at two hospital centers, mainly SSTIs 125 N.A. 125 (100 %) 97 (78 %) by epidemiology Outpatients SSTI (42 %) 90 (42 %) by epidemiology Argentina [ 117 ] 2005, 2006 S. aureus inpatients and outpatients in 14 hospitals (41 %) 22 (6 %) by epidemiology Colombia, Bogota [ 141 ] Clinical infections 15 hospitals 154 N.A. 154 (100 %) 154 (100 %) by SCC mec Molecular typing MRSA: ST8 -IVc - ACME (21 %), ST5-variant, ST6, ST22, ST923 SCC mec IVc isolates with 41 % tetracycline resistance Analysis of 68 isolates: PFGE-A/S T30 -IVc - PVL + (75 %), ST5, ST72, ST97, ST1, ST45 MRSA: six PFGE types, 90 % Uruguay clone, 96 % PVL+ ST5 (89 % in CA-MRSA), mainly t311, SCC mec IVa, PVL+; low prevalence ST917/CC8, ST100, ST918 CA-MSSA: ST5, ST8, ST30 ST8 - IVc -PVL+, ACME (90 %), ST8- IVa-t1635 (5.2 %), also ST923 Comments CA-MRSA USA300 variant established in South America, including as HA-MRSA Outbreak Uruguay clone Possible outbreak Low frequency of CA-MRSA (16 % of CA-SA), more in children with SSTI Emergence of new CA-MRSA clone

54 Columbia, Medellin [ 142 ] Asia Malaysia [ 143 ] Malaysia [ 144, 145 ] Malaysia [ 146 ] Malaysia [ 147 ] Three tertiary care hospitals Invasive isolates from a large public hospital Tertiary hospital in Kuala Lumpur Sensitive MRSA in hospital Survey of MRSAs from nine hospitals , (nine analyzed) 628 N.A. 538 (100 %) 68 (13 %) by epidemiology 243 (45 %) HA-community onset N.A. 36 (100 %) 2 (5.6 %) by epidemiology 2,393 1,887 (44 %) 21/389 (5.3 %) by genotyping N.A (15 %) by epidemiology N.A (1.4 %) by epidemiology ST8 - MRSA - IVc (55 %, spa t1610, t008, t024), ST5-MRSA-I (32 %) SCC mec -IVc in 92 % of CA-MRSA ST239 - MRSA - III t037 (83 %), SCC mec V PVL + in on each ST772 and ST1 MRSA (389 genotyped): ST239 - MRSA - III (92.5 %), ST1, ST188, ST22, ST7, ST1283 CA-MRSA ( n = 21): ST188-V-PVL + (38 %), ST1-V-PVL + (43 %), ST7-V (19 %) HA-MRSA ( n = 11): ST6, ST30, ST22, ST1179 CA-MRSA ( n = 2): ST6, ST30 All SCCmec IV CA-MRSA: ST30 - PVL + (89 %), ST80-PVL (11 %) HA-MRSA: Diverse ST30 (18 %), 1 each: ST45, ST188, ST22, ST101, ST CA-MRSA genotypes circulating in hospitals, Tetracycline resistance (46 %) in ST8 No significant CA-MRSA ST239 isolates all MDR Not MDR 7/9 SSTI Nine HA-MRSA with SCC mec IV All CA-MRSA were SSTIs (continued)

55 Table 1 (continued) Region Year China Wenzhou [ 86 ] Beijing [ 148 ] Beijing [ 149 ] Mainland [ 87 ] Source and Population SSTIs at a teaching hospital Impetigo cases at children s hospital SSTIs at four Beijing hospitals 8 regional pediatric hospitals Number Patients of 1,263 cases 164 of 501 cases 435 Number S. aureus CA-MRSA (% of MRSA) Molecular typing Comments MSSA MRSA (%) (54 %) 48 (43 %) CA-SA (MSSA and MRSA) (1.1 %) 11 (1 %) by SCC mec -typing 32 PFGE types, MRSA mainly ST239 - III (32 %), ST1018-III (17 %), ST88 (10 %) CA-SA: ST1018 MRSA ( 15 %); 8 % each: ST88, ST188, ST239 ST239 and ST1018 spread between community and hospital No clonal typing CA-MRSA SCC mec IV-PVL + 54 % uncommon (3 %) 5 (3 %) MSSA: ST398 PVL + (17 %), ST7 (12 %), ST1 (7 %), ST59, ST5, ST6 MRSA ( n = 5): ST6, ST8, ST59, ST (55 %) 163 (68 %) by epidemiology MRSA with 14 MLSTs: ST1, ST7, ST45, ST59 (50 %) ST88, ST217, ST239, ST338, ST398, ST509, ST910, ST965, ST1349, ST1409 S. aureus accounted for 33 % of SSTIs, rare CA-MRSA ~50 % MDR in CA-MRSA

56 Chengdu [ 150 ] Hong Kong [ 151 ] Taiwan [ 152 ] Japan [ 153 ] Japan [ 154 ] Japan [ 91 ] Pediatric infections (20 %) 7 (70 %) 20 STs (eight absent from carriage): ST121 (14 %), ST88 (15 %), ST398 (12 %), ST5, ST Children nasal carriage SSTIs at six Emergency Departments of 298 cases 40 (78 %) CA-SA Diverse CA-MRSA: STs 5, 20, 88, 121, 188, 573, (100 %) MSSA 26 STs: CC (34 %), ST50 (10 %), ST398 (8 %), ST944, ST15, ST573 MRSA: 6/9 ST59, ST398, ST30, ST942 No ST59 in disease MRSA s No evidence for significant CA-MRSA clone 19 (15 %) Not defined None CA-MRSA in all SSTIs represents rise to prior National Taiwan University Hospital National survey of 16 institutions Outpatients in Hokkaido ,015 N.A. 42 (100 %) 25 (59 %) by epidemiology N.A. 857 (100 %) 117 (14 %) defined as outpatients CA-MRSA: ST59-V T - PVL + and variants (96 %), ST30 (4 %) HA-MRSA: ST239 (41 %), ST59 (24 %), ST5 No clonal typing. SCC mec II (74 %), SCC mec IV 20 % SCC mec I (6 %) (19 %) Not defined MRSA: ST5 -II- PVL (83 %), ST6/ ST59, SCC mec IV 6.9 %, V 3.2 % Potential spread of clones Increase in SCC mec IV as possible rise of CA-MRSA Potential emergence of CA-MRSA 2008 Collection of MRSA isolates from outpatients with SSTIs at teaching hospital in Tokyo 57 N.A. 57 (100 %) 17 (30 %) defined by SCCmec IV SCC mec IV isolates: CC8 (59 %), ST59 (12 %), ST89 (12 %), ST88 (6 %), ST93 (6 %), ST764 (6 %); 29 % PVL+ 68 % SCCmec II 11 % PVL+ (continued)

57 Table 1 (continued) Region Year Source and Population India India [ 155 ] India [ 156 ] All S. aureus infections at private district hospital Random collection of MRSA at tertiary care hospital 61 % inpatient 39 % outpatient Mumbai [ 157 ] Community SSTIs ( n = 820) Bengaluru, Mumbai, Hyderbad, Delhi [ 158 ] Carriers Infectious Number Patients Number S. aureus CA-MRSA (% of MRSA) Molecular typing Comments MSSA MRSA (%) (66 %) 77 (57 %) None Suggests MRSA replacing MSSA in CA-SA infections (96 %) 154 (39 %) by epidemiology (0 %) All CA-SA by epidemiology (26 %) 18 (60 %) No CA-MRSA Not defined Not defined Of 55 MRSA isolates typed: ST22-MRSA-IV- PVL + (53 %) ST772-MRSA-V- PVL + (24 %) ST239-MRSA-III- PVL (24 %) all HA-SA None Fifteen STs, ST22, ST772 MRSA: ST22, ST772; ST30, ST672, ST % PVL+, Increase in SCC mec IV/V and SSTIs over time No evidence of CA-MRSA All SCC mec IV or V

58 Karachi, Pakistan [ 159 ] Patients with MRSA infection N.A. 37 (100 %) 126 (100 %) Unknown 19 (15 %) by epidemiology HA-MRSA: ST239 -III (56 %), ST8 -IV (44 %) CA-MRSA: five PFGE types, ST8-IV (67 %), ST239 (16.7 %) Pakistan [ 160 ] Siem Reap, Cambodia [ 161 ] Before Four tertiary hospitals (three in Pakistan, one in India) Pediatric inpatients and outpatients with MRSA N.A. 60 (100 %) Unknown PFGE/SIRU: CC8 (95 %), CC30-IV = PVL (3 %) N.A. 17 (100 %) 16 (94 %) by epidemiology MLST of CC8s ( n = 14): ST239 - II / III (64 %), ST8-IV (21 %), and ST113-IV (14 %) ST834 -IV-PVL (88 %), ST121-IV-PVL+ South Korea [ 89 ] South Korea [ 90 ] Random selection of infection and colonization S. aureus isolates MRSA BSI at five hospitals Not defined MRSA: ST5 (48 %), ST239 (23 %), ST72 (7 %), ST1 (5 %), ST254 (3 %), ST30 (3 %) MSSA: ST1 (22 %), ST6 (12 %), ST30 (9 %), ST59 (7 %); less than 5 %: ST5, ST580, ST15, ST72 N.A. 76 (100 %) 4 (5.3 %) by epidemiology HA-MRSA: ST5 (61 %), ST239 (13 %), ST72-IV (25 %), ST1 CA-MRSA ( n = 4): ST72-IV (50 %), ST5-II (50 %) STs in bold represent most frequent clone, BSI = blood stream infections, MDR = multidrug resistance, >3 classes of antibiotics Overlap of CA- and HA-MRSA clones SIRU = staphylococcal interspersed repeat units First report of (CA)-MRSA in Cambodia Emergence of ST72 over period of study CA-MRSA ST72 invading the hospital

59 48 Madeleine G. Sowash and Anne-Catrin Uhlemann Table 2 Molecular epidemiology of S. aureus carriage in diverse geographic regions Region Year Population N S. aureus carriage MRSA carriage a Molecular Typing Comments Africa Mali [ 102 ] 2005 Patients for emergency surgery at tertiary care hospital 448 Nigeria [ 162 ] Before 2007 Medical students 182 Nigeria [ 163 ] 2009 Gabon [ 105 ] Gabon [ 81 ] Middle East Israel [ 164 ] West Bank [ 165 ] Palestine [ 166 ] Healthy villagers University students Healthy carriers from community, healthcare (20 %) 1 (0.22 %) MSSA: 20 STs, ST15 (27 %), ST152 - PVL + (24 %), also ST5, ST8, ST291, ST88, ST30, ST1 Low resistance, except to penicillin and tetracycline MRSA isolate: ST88 Presence of pandemic clones 26 (14 %) 0 (0 %) None No MRSA carriage 17 (43 %) 10 (8.3 %) None 23 (58 %) 163 (30 %) 6 (1.1 %) MSSA: ST15 (46 %), ST508 (8.5 %), ST152 (6 %), ST1 (5 %), <5 %: ST5, ST6, ST88, ST7, ST72, ST9 MRSA: ST88 (67 %); ST 8, ST Babongo Pygmies (33 %) None 34 isolates: ST30 (24 %), ST15, ST72, ST80, ST88 (each 12 %) 2002 Children at clinic Parents ,768 1, (17 %) 5 (0.15 %) MSSA: ST45 (25 %) MRSA ( n = 5): ST247, ST5, ST45 21 (53 %) MDR 10 (91 %) of MRSA isolates MDR 3 (7.5 %) pan-sensitive 41 % PVL+ Remote indigenous population 56 % PVL+, Low resistance Two CA-MRSA by epidemiology Inpatients (26 %) 17 (2.0 %) None No prior healthcare exposure, low resistance to non-β-lactams Students (24 %) 8 (2.2 %) No clonal typing All MRSA SCC mec IVa Nearly 35 % of isolates resistant to two or more non-β-lactam antibiotics

60 CA-MRSA Case Studies 49 Gaza-Strip [ 116 ] Hamadan Iran, [ 167 ] Lebanon [ 168 ] Latin America Gioania Central Brazil [ 169 ] Amazonian rainforest [ 118 ] Bolivia, Peru [ 170 ] 2009 Children (<5.5 years) (28 %) 50 (13 %) MSSA (40 isolates analyzed): ST291 (21 %), ST1278 (18 %), ST15 (18 %), ST22 (13 %) Parents (28 %) 44 (12 %) MRSA: ST22 (73 %), ST78 (7 %), ST80 (5 %); 8.5 % PVL+ 64 % of MRSA isolates were ST22-MRSA- IVa- PVL (susceptible to all non-b-lactam antibiotics) Before 2011 Daycare children Students and employees (30 %) 6 (1.2 %) None Age range 1 6 years, no MRSA no risk factors 193 (38 %) 8 (1.6 %) None Age 6 65 years Highest carriage rate in children Daycare children aged years Adult Wayampi Amerindians 1, (31 %) 14 (1.2 %) MRSA: ST239 (57 %), ST121 (21 %), ST30 (7 %), ST12 (7 %), ST1120 (7 %) SCC mec IIIA, IV, and V detected All PVL negative 65 (42 %) None ST1 (25 %), ST188 (20 %), ST1223 (19 %), ST15 (15 %), ST5 (14 %), <5 %: ST97, ST30, ST398, ST1292, ST (58 %) ST1223 (35 %), ST5 (17 %), ST1 (15 %), ST188 (13 %), ST97 (6 %), <5 %: ST72, ST30, ST718, ST432, ST14, ST15, ST398 7 (50 %) of MRSA were MDR MRSA carriers with prior hospitalization or antibiotics Isolated population in French Guiana, increased in S. aureus incidence in Healthy volunteers 585 N.R. 3 (0.5 %) All MRSA ST1649 -IV (CC6) One urban area, one small village, two native communities, one person recently hospitalized 2008 (continued)

61 50 Madeleine G. Sowash and Anne-Catrin Uhlemann Table 2 (continued) Region Year Population N S. aureus carriage MRSA carriage a Molecular Typing Comments Asia Japan South [ 171 ] Tokyo [ 172 ] Japan [ 173 ] Sado Island [ 174 ] 1999 Daycare children (18 %) 12 (7.7 %) None Age range years 2007 Tertiary hospital 267 N.R. 30 (11 %) None Used PCR and culture admissions Pediatric outpatients (29 %) 3 (0.7 %) ST88-IV, ST5-II, ST857-II All MRSA considered CA by epidemiology Healthy children (40 %) 5 (3.7 %) ST8-IV ( n = 2), ST764-II, ST22-I, ST380-IV Pediatric outpatients 3,939 N.R. 15 (0.4 %) MRSA: ST8 -IV/I (20 %), ST5 -II/IV (17 %), ST764-II (15 %), ST92-IV (12 %), Healthy children, <15 1,333 Healthy children 136 All PVL- All MRSA classified as community-onset (CO) MRSA, genetically diverse 26 (2.0 %) ST59-IV (10 %), ST121-V All PVL-negative (10 %), ST509, ST81-IV, 55 (40 %) 5 (3.7 %) ST2180-IV China Hong Kong [ 175 ] Shenyang [ 176 ] Wenzhou (Southeast) [ 177 ] Before 2004 Students and their families (29 %) 9 (1.4 %) None Medical students 2, (11 %) 22 (1.0 %) MRSA: ST88 (45 %), ST59 (18 %), ST30 (14 %), ST5 (9 %); ST90, ST239 and ST1 (one each) Before 2011 Volunteers on medical campus (15 %) 28 (3.0 %) MRSA: Diverse with 16 ST s for 28 isolates, ST59 (14 %), ST25 (11 %), also ST188, ST438 Ten MRSA PVL+ 82 % of MRSA and 66 % of MSSA isolates were resistant to multiple antibiotics, one MDR ST398-MRSA-V

62 CA-MRSA Case Studies 51 Hong Kong [ 178 ] Taiwan North [ 179 ] North [ 180 ] North [ 181 ] North, South and Central [ 182 ] Rural North [ 183 ] Taiwan [ 184 ] Kindergarten and daycare children (2 5 years) 2, (28 %) 28 (1.3 %) MRSA: ST59 -IV/V (32 %), ST45 -IV/V (25 %), ST10-V (14 %); also CC1-IV, ST30-IV, CC5-IV, ST630-V, ST88-V MSSA highly diverse (51 spa types in 101 isolates) All 18 geographical districts sampled Seven children had both MSSA and MRSA Healthy children ( 14 years) Before 2007 Day care children (<7 years) 2008 Medical and surgical ICU patients Healthy children at outpatient check-up 3, Before 2012 Medical students (26 %) 371 (12 %) MRSA: ST59 (86 %); 4.3 % of MRSA MDR ST338 (ST59 variant) Decrease in MSSA ( %) paralleled by increase in MRSA ( %) from 2004 to High ery/clinda resistance 17 (25 %) 9 (13 %) All MRSA ST59 - IV - PVL - No healthcare exposures High ery/clinda resistance 74 (42 %) 57 (32 %) MRSA: ST5 -II-PVL (34 %), ST239 -III-PVL (26 %), ST59 -SCCmec IV or V T (16 %) 6,057 1,404 (23 %) 473 (7.8 %) MRSA (279 typed): ST59 / ST338-IV/PVL (59 %), ST59/ST338-VT/PVL + (23 %) Other: ST5, ST239, ST89 62 (19 %) 7 (2.2 %) All MRSA: ST59 (6/7) SCC mec IV/PVL-, 1 of 7 SCCmev V T / PVL+ Tertiary hospital population Highest MRSA incidence in North (27.4 %), lowest in central Taiwan (20.3 %); High incidence of MDR (88 % of ST59) No difference between preclinical and clinical students High ery/clinda resistance Healthy children 3, (15 %) 0 (0 %) Only PVL + MSSA typed (5/495) Age group <18 years. All ST59 PVL + SCC mec VT (continued)

63 52 Madeleine G. Sowash and Anne-Catrin Uhlemann Table 2 (continued) Region Year Population N S. aureus carriage MRSA carriage a Molecular Typing Comments North [ 185 ] South Korea [ 186 ] Seoul South Korea[ 187 ] 2009 Adults emergency department 502 Before 2008 Pediatric outpatients (17 %) 19 (3.8 %) MRSA: ST59 (58 %), ST239 (32 %); majority of ST59 CA-MRSA MRSA carriage 5.9 % in patients with HA risk factors, 2.1 % in patients without CA-MRSA 95 (32 %) 18 (6.1 %) ST30 and variants (36 %) Age range 1 11 years ST72 among MRSA Daycare children (38 %) 40 (9.3 %) ST72 (73 %), ST1765 (15 %), 5 %: ST1, ST1735, ST1736, ST1737; All PVL- Age range years India Mangalore, [ 92 ] Ujjain [ 188 ] Andhra Pradesh [ 189 ] India [ 190 ] Nagpur, [ 191 ] Lahore, Pakistan [ 192 ] Pokhara, Nepal [ 193 ] Before 2007 Medical students (88 %) 12 (24 %) None High MRSA carriage 2007 Pediatric outpatients 1, (6.3 %) 16 (1 %) None Children years Four MSSA and three MRSA isolates MDR Before 2009 School children (16 %) 12 (3.1 %) None Age group 5 1 (age 5 15) years Before 2009 School children (52 %) 19 (3.9 %) None Rural, urban, and semi-urban slums, 5 15 years Before 2009 School children 1, (7.4 %) 4 (0.3 %) None Urban children (6 10 years) General population 1, (15 %) 48 (2.9 %) None Rural and urban community population Before 2008 School children (31 %) 32 (17 %) None Age group <15 years

64 CA-MRSA Case Studies 53 Thailand [ 194 ] Siem Reap, Cambodia [ 195 ] Before 2011 Healthy young adults (15 %) 2 (1 %) Both MRSA isolates were SCC mec type II 2008 Outpatient 2,485 Not 87 (3.5 %) MRSA: ST834 (91 %), also reported ST121, ST188, ST45, ST9 Inpatients (4.1 %) Carriage associated with healthcare risk factors 28 (32 %) of 87 outpatient carriers were considered CA-MRSA Java, Indonesia [ 196, 197 ] Java, Indonesia [ 198 ] Healthy individuals and patients Outpatients and adult companions 3, (8.2 %) 1 (0.03 %) Genetically diverse MSSA: ST45, ST188, ST % PVL + (ST188 and ST121) 62 (14 %) 0 (0 %) CC1 (21 %), CC45 (18 %), CC8 (8 %), CC15 (6 %); less Only MRSA case was isolated from patient after 45 days of hospitalization Low antibiotic resistance 10 MSSA (16 %) PVL+ Malaysia [ 199 ] Before 2008 University students 100 N.R. = not reported a MRSA carriage of individuals (number MRSA ± number swabbed) 26 (26 %) 8 (8 %) CA-MRSA ( n = 3): ST1004-V PVL-, ST80-IVa PVL+ No MDR

65 54 Madeleine G. Sowash and Anne-Catrin Uhlemann Asia : Information on S. aureus infections are lacking from many parts of the Asian continent. Overall, there appears to be a relatively low burden of MRSA in general and CA-MRSA in particular (Table 1 ). However, ST59 (Taiwan clone) is the most frequent strain encountered in Taiwan, China and across other parts of the Asia (Tables 1 and 2 ) [ 85 ]. In parallel, ST239 is widespread as a cause of nosocomial MRSA infections in South Korea, Malaysia, China, Taiwan, India, and Pakistan (Table 1 ). In Taiwan, the high frequency of MRSA infections with ST59 is also paralleled by a remarkably high nasal carriage rate of MRSA and ST59 in some but not all studies of daycare or school-aged children (~8 13 %), (Table 2 ). ST59 also contributes to MRSA infections and in particular MRSA carriage in China. There are greatly varying reports on the prevalence of CA-MRSA in China, ranging from only ~1 % in several studies to up to 68 %. The two studies reporting a high burden of CA-MRSA infections, which were defined by epidemiology, were also remarkable in that they suggested circulation of HA-MRSA clones in the community and a relatively high proportion of multidrug resistance in CA-MRSA isolates [ 86, 87 ]. However, there appears to be very infrequent nasal colonization with MRSA (1 3 %) across different Chinese populations (Tables 1 and 2 ). Of note, genotyping of MSSA isolates, the major contributor to community-associated S. aureus infections in China, revealed a number of pandemic clones such as ST121, ST88, and ST188 as well as a consistent prevalence of PVL positive ST398 (Table 1 ). This strain was first mainly recognized in Europe as livestock associated PVL-negative MRSA [ 88 ]. The relationship of the frequent occurrence of ST398 colonization and infection with ST398 MSSA in China and ST398 infections in Europe remains unclear. Colonization studies from children in South Korea showed a relatively high MRSA prevalence ( %) and were mainly accounted for by ST30 and ST72 (Table 2 ). ST72 in particular contributes to MRSA infections [ 89 ], and these strains have also become established in the hospital environment [ 90 ]. Several reports of small outbreaks have described CA-MRSA in Japan but only relatively recently an increase in SCC mec -IV isolates, interpreted as an increase in CA-MRSA genotypes, was noted (Table 1 ). Further genotyping indicated that these CA-MRSA are notably polyclonal [ 91 ] and include to varying degrees ST59, a diversity of CC8 strains (including USA300) as well as small numbers of ST89, ST88, and ST93 (Table 1 ). MRSA carriage in nonhospitalized Japanese patients was also generally low and has been attributed to a high diversity of strains, including ST5, ST8, ST59, and ST88 (Table 2 ). Little evidence for CA-MRSA has been published from Malaysia, Indonesia and Cambodia. Among the few cases of CA-MRSA in Malaysia, ST188, ST1, ST30, and ST80 predominated (Table 1 ), whereas in Cambodia the first report of CA-MRSA

66 CA-MRSA Case Studies 55 was due to a ST834 strain. In Indonesia, MRSA carriage was negligible and published data on infections are lacking. A number of studies from India, mainly conducted at hospital centers, suggest a relatively high prevalence of MRSA, but the contribution of CA-MRSA to S. aureus infections is less clear. To date, strains ST22 and ST772 have been identified as major CA-MRSA clones among infectious isolates (Table 1 ). The MRSA colonization prevalence also appears to be low with the exception of one investigation of medical students of whom 24 % were colonized [ 92 ]. In Pakistan, both, CA- and HA-MRSA strains were found to overlap with ST239-II/III and ST8-IV predominating (Table 1 ). Africa : MRSA was only first described in Africa in 1988 [ 93 ] and to date only limited information on the epidemiology of S. aureus infections is available from most of the continent. Studies on the prevalence of MRSA in Africa span from less than 10 % to up to nearly 50 % (Table 1 ). In a large survey of 1440 S. aureus isolates collected across Nigeria, Kenya, Morocco, Cameroon, Tunisia, Algeria, Senegal, Cote D Ivoire, and Malta from the late 1990s, ~15 % were MRSA [ 94 ]. The highest frequency was noted in Nigeria, Kenya, and Cameroon (at %) and lowest in the North African countries Malta, Tunisia, and Algeria (below 10 %). However, there were no data available regarding the epidemiological profile of these isolates and in light of their reported high frequency of multidrug resistance these infections may have been most consistent with HA-MRSA. Overall, there is relatively little published evidence for a substantial CA-MRSA epidemic in North Africa. Despite the relatively low overall MRSA frequency, severe cases of invasive CA-MRSA requiring admission to the pediatric ICU have been documented over a 10 year period in Tunisia with an increase in incidence over the last year of the study [ 95 ]. Despite these relatively low numbers, major international lineages have been reported from the region, such as the predominant European CA-MRSA lineage ST80 in Algeria, Egypt, and Tunisia [ 96, 97 ] (Table 1 ). In Algeria, this relatively high prevalence of ST80-MRSA was already prevalent about a decade ago. While 86 % of CA-MRSA isolates were PVL+, an unusually high percentage of HA isolates also harbored PVL (68 %). Several of these isolates were multidrug resistant, consistent with HA-MRSA. The authors suggested that poor hygiene might have contributed to the spread of PVL positive strains into the hospital setting. In a large study from five African towns in Cameroon, Morocco, Niger, Senegal, and Madagascar, ST239/241 (Morocco and Niger), ST88 (Cameroon and Madagascar), and ST5 (Senegal) accounted for the majority of MRSA infections [ 98 ]. ST88 had been sporadically encountered in Belgium [ 99 ], Portugal [ 100 ], and Sweden [ 101 ]. The pandemic spread of many of the common S. aureus clones and the evolution of a divergent PVL + ST152 clone was

67 56 Madeleine G. Sowash and Anne-Catrin Uhlemann also documented in a nasal carriage population of 448 patients in Mali [ 102 ]. Overall, ~20 % of individuals were S. aureus carriers and only one patient harbored MRSA. The most common MSSA sequence types were ST15 and ST152 accounting for about half of the isolates. Additional ST include ST5, ST8, ST291, ST30, ST88, and ST1. All of the ST152 isolates carried PVL. This clone has been associated with sporadic disease in Central Europe [ 84 ]. In Eastern Nigeria, one of the most populated African countries, the reported MRSA prevalence ranges from 1 to 41 % of S. aureus infections (Table 1 ) with a low or undefined burden of CA-MRSA infections [ 103, 104 ]. In a study from the South Western part of the country in 2007, a sizable number of ophthalmological and auricular CA-MRSA infections were reported, mainly caused by ST88-IV-PVL+. All of these isolates were also resistant to trimethoprim-sulfamethoxazole. In addition, cases of ST8 infections, including ST8-t064/t451 suggestive of USA500 have been sporadically described. The bulk of HA-MRSA is mainly attributable to ST241 and ST250. MSSA infections in Nigeria have been due to a diversity of clones, with a substantial representation of ST15, ST5, ST88, and PVL-positive ST152 [ 84 ] (for additional STs see Table 1 ). ST15 (t084) also predominated amongst carriage and infectious isolates from Gabon and a variety of ST15 associated spatypes accounted for almost half of all carriage isolates [ 105 ]. Carriage was relatively low at ~29 % using three body sites (nares, axilla, and groin), and the carriage MRSA prevalence was 3.6 %. The contribution of MRSA to the infection isolates was low at 11 % and was mainly due to ST88 (67 %). ST1 (all MSSA) and ST88 (all MRSA isolates) were more frequently present among infectious isolates, whereas ST508 was associated with carriage. Only one of the 12 MRSA isolates was PVL positive, arguing against a direct linkage of PVL + MSSA as the precursor for MRSA. The nasal S. aureus carriage in the remote indigenous Gabonese Babongo Pygmies was about 30 % and no MRSA was detected [ 81 ]. ST30 was most common (24 %) among the ten diverse sequence types, which also included ST15, ST72, ST80, and ST88 (Table 2 ) and more than half of all isolates carried PVL. The genetic background of these isolates matches pandemic CA-MRSA strains. This observation again raises the possibility that African PVL + MSSA served as a reservoir for pandemic MRSA clones. Alternatively, PVL + MSSA isolates, such as ST30, could have been introduced to Africa by European travelers or rather represent archaic S. aureus clones that globally predominated before the emergence of MRSA. In South Africa, several studies have also identified the presence of pandemic clones as a cause of the vast majority of MRSA infections, whereas the burden of CA-MRSA infections is less

68 CA-MRSA Case Studies 57 clearly defined (Table 1 ). However, in a study of 161 patients with community-onset bacteremias (incidence of 26/100,000), 39 % were due to MRSA [ 106 ]. The MRSA incidence was increased in HIV infected patients and children. Multidrug-resistance was generally high among MRSA isolates and in particular among HIVinfected children. A greater prevalence of community- acquired S. aureus pneumonia was also noted in HIV-positive children compared to their HIV-negative peers [ 107 ]. While no clonal typing was reported in these two studies it is notable that ST612-IV (also genotyped as spacc64 and USA500 by PFGE) was noted as one of the most predominant strains [ 108, 109 ]. ST612-IV accounted for the majority of, albeit infrequent, CA-MRSA from hospitals in Cape Town [ 108 ]. ST612 itself was previously only sporadically described in Germany as well as in Australian horses [ 110, 111 ]. Notably, these ST612 isolates contain spa t064 and have a PFGE pattern consistent with USA500. Interestingly, USA500 the presumed precursor of USA300, has been closely associated with infections and colonization of HIV/AIDS patients in the USA, although USA300 still accounts for the majority of cases of S. aureus in HIV [ 112 ]. It has been estimated that the HIV prevalence is ~17.3 % in the general population in South Africa. The South African molecular studies on S. aureus have not commented on the HIV prevalence in their study populations, but based on these data it is intriguing to speculate that the relatively high HIV prevalence contributes significantly to the clonal type of MRSA infections in this country. Furthermore, this association points to an important interaction between the immune status of the host and the clonal background of the infecting S. aureus strain. Middle East : The reported MRSA prevalence in Middle Eastern countries ranges from less than 5 % in the United Arab Emirates [ 113 ] to up to 75 % in a random collection of S. aureus isolates from Lebanon (Table 1 ). These numbers are likely skewed by the proportion of inpatient and outpatient surveyed in these studies. However, across the region, the international HA-MRSA clone ST239, mainly associated with SCC mec III, has been reported from many different countries, including Lebanon, Kuwait, Iran, and Saudi Arabia (Table 1 ). Although CA-MRSA isolates were only represented at a relatively low frequency among MRSA infections, in particular in Iran and Bahrain (2 13 %), pandemic ST80-IVc and ST30-IV are widespread and causing infections in Lebanon, Kuwait and Saudi Arabia (Table 1 ). In Kuwait, CA-MRSA ST30-IV, ST80-IV and isolated cases of ST8-IV, ST5-IV, and ST728-IV were detected as early as 2001 during a national survey of S. aureus isolates, although MRSA only accounted for ~5 % of all S. aureus infections [ 114 ]. Most other major clonal complexes such as ST5-IV, ST6-IV, ST8-IV, ST22-IV, and ST97 have been reported at lower frequencies. These clonal complexes are also well represented

69 58 Madeleine G. Sowash and Anne-Catrin Uhlemann among MSSA isolates and are a significant cause of S. aureus infections, including in the nosocomial setting such as ST8- MSSA in an Iranian hospital [ 115 ]. Colonization with MRSA was also generally low in community studies from Lebanon, Iran, Israel, the West Bank, and Palestine ( % of individuals) with the exception of a child parent cohort study that reported MRSA colonization in ~12 % of participants (Table 2 ). In this Palestinian-Israeli collaboration, children younger than 5.5 years and one of their parents in 12 Gaza neighborhoods and villages were surveyed [ 116 ]. The overall prevalence of S. aureus carriage was ~30 %. The only predictor for MRSA carriage in children was having a MRSA positive parent. Molecular analysis of the MRSA isolates revealed a low genetic diversity as 64 % were accounted for by the ST22-IVa-t223-PVL Gaza strain (CC22 in 75 % of MRSA), which had low non-β-lactam resistance. This strain was found to be closely related to local MSSA spa t223 strain and less related to EMRSA-15. In addition, MRSA isolates belonging to CC88 (7.4 %) and CC80 (5.3 %) were also identified. PVL was only infrequently present among MRSA isolates (9 %) and MSSA isolates. Latin America : Relatively little is known about the possible burden of CA-MRSA in Latin America. However, the presence of the three pandemic clones ST5, ST8, and ST30 has been described from multiple regions and which appear to account for the majority of CA-MRSA infections. The spread of a USA300-like clone into Latin America has been documented in Cuba and further south in the neighboring countries of Columbia, Ecuador, Peru, and Venezuela (Table 1 ). In contrast to the majority of North- American USA300, these ST8 isolates harbor the SCC mec -IVc and are usually ACME negative. Some of these ST8 infections have also occurred in the hospital setting. In Argentina, ST5 accounted for the vast majority of CA-MRSA infections [ 117 ]. In contrast to the hospital-associated MRSA infections from elsewhere, these isolates mainly harbored SCC mec - IVa and were also PVL positive. Previously, ST5 PVL + MSSA had circulated in the area as the possible precursor of this MRSA. Most of the reported CA-MRSA in the neighboring country of Uruguay has been attributed to ST30-IVc-PVL isolates (Table 1 ). Only a limited number of S. aureus colonization studies have been reported from these Latin American countries and have generally reported a low MRSA prevalence (0.5 1 %) in diverse populations in Bolivia, Peru and Brazil (Table 2 ). Although only 1 % of daycare children were colonized with MRSA in a Brazilian study, the pandemic MRSA ST239 accounted for 57 %. None of these children previously had been hospitalized or received antibiotic treatment. No MRSA was detected among the Wayampi Amerindians in the Amazonian rainforest [ 118 ]. In this study, the overall nasal S. aureus carriage was high and increased from 42 % in

70 CA-MRSA Case Studies to 58 % in Of these, 26 % of individuals were considered persistent carriers. Penicillin resistance was at 99 % in a community with high antibiotic usage. There was an overall low diversity index of the strains, which in part likely reflects the close family ties and living conditions. Two phylogenetic groups were observed with phylogenetic group 2 (ST1, ST5, ST14, ST15, ST72, ST97, ST188, ST432, ST1292, and ST1293) accounting for 79 % in 2006 and 58 % in Rare isolates belonging to ST30, ST398, and ST718 were also observed. A rare and phylogenetically distant ST1223 accounted for 19 % of colonization isolates in 2006 and 35 % in The predominant prevalence of a single clone suggests a preferential adaptation to a given population. This clone had only previously been described in Cambodia [ 119 ]. Interestingly, a closely related sequence type is ST75, the original CA-SA clone from indigenous populations in Australia. The authors suggested that an association between populations living under isolated conditions might reflect ancient human migration and coevolution of bacteria and their hosts [ 118 ]. A study from the Caribbean islands of Martinique and the Dominican Republic also documented the presence of rare international clones such as ST72 (seen in South Korea) and ST152 (present in parts of Europe and Africa). The study speculated that tourists might have imported these strains, as both countries are frequent traveler s destinations. Alternatively, these clones may be more prevalent in populations that previously were less frequently sampled. 4 Conclusions The past 20 years have seen a dramatic change in the epidemiology of S. aureus infections with the emergence of CA-MRSA clones manifesting as an epidemic of SSTIs infections in many parts of the world. However, MSSA infections continue to contribute to the burden of S. aureus disease. In a reversal of epidemiology, there is mounting evidence that CA-MRSA continuing to replace HA-MRSA in clinical setting. The evolution of drug resistance, in particular VISA and VRSA, poses a clinical dilemma, as few viable treatments are available. In addition, information on S. aureus strains is still lacking from many parts of the world, while it appears that novel S. aureus strains are continuously evolving or only now being detected. This evolution also spans an exchange of S. aureus clones with zoonotic reservoirs, such as ST398 from pigs, other livestock, and humans. Animals have also been identified as a reservoir and source for the emergence of novel resistance elements such as the novel bovine mec A gene homologue, mec A (LGA251), now designated mec C [ 120, 121 ]. While it appears that the distribution of S. aureus remains geographically diverse, the spread of successful clones, most notably

71 60 Madeleine G. Sowash and Anne-Catrin Uhlemann USA300 but also ST30, ST80, ST1, ST59, and ST93, between countries and across continents is increasingly observed. Although traditional molecular typing methods have provided important clues as to how pandemic clones are spreading, they have provided limited information on the directionality of transmission and evolution of particular S. aureus lineages. However, the advent of novel technologies such as whole-genome sequencing allows for more sensitive ways to understand how particular S. aureus strains have evolved independently or rather migrated around the world [ 42, 122, 123 ]. Acknowledgment This work was funded in part by grant K08 AI from the National Institute of Health and the Paul A. Marks scholarship. References 1. Noble WC, Valkenburg HA, Wolters CH (1967) Carriage of Staphylococcus aureus in random samples of a normal population. J Hyg (Lond) 65: Lowy FD (1998) Staphylococcus aureus infections. N Engl J Med 339: Jevons MP, Parker MT (1964) The evolution of new hospital strains of Staphylococcus aureus. J Clin Pathol 17: Saravolatz LD, Markowitz N, Arking L et al (1982) Methicillin-resistant Staphylococcus aureus. Epidemiologic observations during a community-acquired outbreak. Ann Intern Med 96: Levine DP, Crane LR, Zervos MJ (1986) Bacteremia in narcotic addicts at the Detroit Medical Center. II. Infectious endocarditis: a prospective comparative study. Rev Infect Dis 8: Udo EE, Pearman JW, Grubb WB (1993) Genetic analysis of community isolates of methicillin-resistant Staphylococcus aureus in Western Australia. J Hosp Infect 25: Gardam MA (2000) Is methicillin-resistant Staphylococcus aureus an emerging community pathogen? A review of the literature. Can J Infect Dis 11: Tenover FC, Tickler IA, Goering RV et al (2012) Characterization of nasal and blood culture isolates of methicillin-resistant Staphylococcus aureus from patients in United States Hospitals. Antimicrob Agents Chemother 56: Seybold U, Kourbatova EV, Johnson JG et al (2006) Emergence of community-associated methicillin-resistant Staphylococcus aureus USA300 genotype as a major cause of health care-associated blood stream infections. Clin Infect Dis 42: Stefani S, Chung DR, Lindsay JA et al (2012) Meticillin-resistant Staphylococcus aureus (MRSA): global epidemiology and harmonisation of typing methods. Int J Antimicrob Agents 39: International Working Group on the Classification of Staphylococcal Cassette Chromosome E (2009) Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements. Antimicrob Agents Chemother 53: Malachowa N, Kobayashi SD, Deleo FR (2012) Community-associated methicillinresistant Staphylococcus aureus and athletes. Phys Sportsmed 40: Begier EM, Frenette K, Barrett NL et al (2004) A high-morbidity outbreak of methicillin- resistant Staphylococcus aureus among players on a college football team, facilitated by cosmetic body shaving and turf burns. Clin Infect Dis 39: Kirkland EB, Adams BB (2008) Methicillinresistant Staphylococcus aureus and athletes. J Am Acad Dermatol 59: Nguyen DM, Mascola L, Brancoft E (2005) Recurring methicillin-resistant Staphylococcus aureus infections in a football team. Emerg Infect Dis 11: Aiello AE, Lowy FD, Wright LN et al (2006) Meticillin-resistant Staphylococcus aureus

72 CA-MRSA Case Studies 61 among US prisoners and military personnel: review and recommendations for future studies. Lancet Infect Dis 6: Adcock PM, Pastor P, Medley F et al (1998) Methicillin-resistant Staphylococcus aureus in two child care centers. J Infect Dis 178: Baggett HC, Hennessy TW, Rudolph K et al (2004) Community-onset methicillin- resistant Staphylococcus aureus associated with antibiotic use and the cytotoxin Panton- Valentine leukocidin during a furunculosis outbreak in rural Alaska. J Infect Dis 189: Anonymous (2004) Community-associated methicillin-resistant Staphylococcus aureus infections in Pacific Islanders Hawaii, MMWR Morb Mortal Wkly Rep 53: Mediavilla JR, Chen L, Mathema B et al (2012) Global epidemiology of communityassociated methicillin resistant Staphylococcus aureus (CA-MRSA). Curr Opin Microbiol 15: Deleo FR, Otto M, Kreiswirth BN et al (2010) Community-associated meticillin- resistant Staphylococcus aureus. Lancet 375: Okuma K, Iwakawa K, Turnidge JD et al (2002) Dissemination of new methicillinresistant Staphylococcus aureus clones in the community. J Clin Microbiol 40: Liu C, Graber CJ, Karr M et al (2008) A population- based study of the incidence and molecular epidemiology of methicillinresistant Staphylococcus aureus disease in San Francisco, Clin Infect Dis 46: David MZ, Daum RS (2010) Communityassociated methicillin-resistant Staphylococcus aureus : epidemiology and clinical consequences of an emerging epidemic. Clin Microbiol Rev 23: Moran GJ, Krishnadasan A, Gorwitz RJ et al (2006) Methicillin-resistant S. aureus infections among patients in the emergency department. N Engl J Med 355: Talan DA, Krishnadasan A, Gorwitz RJ et al (2011) Comparison of Staphylococcus aureus from skin and soft-tissue infections in US emergency department patients, 2004 and Clin Infect Dis 53: Lee BY, Singh A, David MZ et al (2012) The economic burden of community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA). Clin Microbiol Infect 19:528. doi: /j x 28. Miller LG, Diep BA (2008) Clinical practice: colonization, fomites, and virulence: rethinking the pathogenesis of community- associated methicillin-resistant Staphylococcus aureus infection. Clin Infect Dis 46: Jones TF, Creech CB, Erwin P et al (2006) Family outbreaks of invasive communityassociated methicillin-resistant Staphylococcus aureus infection. Clin Infect Dis 42:e76 e Knox J, Uhlemann AC, Miller M et al (2012) Environmental contamination as a risk factor for intra-household Staphylococcus aureus transmission. PLoS One 7:e Nerby JM, Gorwitz R, Lesher L et al (2011) Risk factors for household transmission of community-associated methicillin-resistant Staphylococcus aureus. Pediatr Infect Dis J 30: Miko BA, Uhlemann AC, Gelman A et al (2012) High prevalence of colonization with Staphylococcus aureus clone USA300 at multiple body sites among sexually transmitted disease clinic patients: an unrecognized reservoir. Microbes Infect 14: Uhlemann AC, Knox J, Miller M et al (2011) The Environment as an Unrecognized Reservoir for Community-Associated Methicillin Resistant Staphylococcus aureus USA300: a case-control study. PLoS One 6:e Diep BA, Gill SR, Chang RF et al (2006) Complete genome sequence of USA300, an epidemic clone of community-acquired meticillin- resistant Staphylococcus aureus. Lancet 367: Joshi GS, Spontak JS, Klapper DG et al (2011) Arginine catabolic mobile element encoded speg abrogates the unique hypersensitivity of Staphylococcus aureus to exogenous polyamines. Mol Microbiol 82: Vandenesch F, Naimi T, Enright MC et al (2003) Community-acquired methicillinresistant Staphylococcus aureus carrying Panton- Valentine leukocidin genes: worldwide emergence. Emerg Infect Dis 9: Li M, Cheung GY, Hu J et al (2010) Comparative analysis of virulence and toxin expression of global community-associated methicillin-resistant Staphylococcus aureus strains. J Infect Dis 202: Diep BA, Chan L, Tattevin P et al (2010) Polymorphonuclear leukocytes mediate Staphylococcus aureus Panton-Valentine leukocidin- induced lung inflammation and injury. Proc Natl Acad Sci U S A 107: Lina G, Piemont Y, Godail-Gamot F et al (1999) Involvement of Panton-Valentine leukocidin- producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infect Dis 29:

73 62 Madeleine G. Sowash and Anne-Catrin Uhlemann 40. Cremieux AC, Dumitrescu O, Lina G et al (2009) Panton-valentine leukocidin enhances the severity of community-associated methicillin- resistant Staphylococcus aureus rabbit osteomyelitis. PLoS One 4:e Lipinska U, Hermans K, Meulemans L et al (2011) Panton-Valentine leukocidin does play a role in the early stage of Staphylococcus aureus skin infections: a rabbit model. PLoS One 6:e Deleo FR, Kennedy AD, Chen L et al (2011) Molecular differentiation of historic phagetype 80/81 and contemporary epidemic Staphylococcus aureus. Proc Natl Acad Sci U S A 108: Bubeck WJ, Bae T, Otto M et al (2007) Poring over pores: alpha-hemolysin and Panton-Valentine leukocidin in Staphylococcus aureus pneumonia. Nat Med 13: Wang R, Braughton KR, Kretschmer D et al (2007) Identification of novel cytolytic peptides as key virulence determinants for community- associated MRSA. Nat Med 13: Wilson GJ, Seo KS, Cartwright RA et al (2011) A novel core genome-encoded superantigen contributes to lethality of community- associated MRSA necrotizing pneumonia. PLoS Pathog 7:e Queck SY, Jameson-Lee M, Villaruz AE et al (2008) RNAIII-independent target gene control by the agr quorum-sensing system: insight into the evolution of virulence regulation in Staphylococcus aureus. Mol Cell 32: Novick RP, Muir TW (1999) Virulence gene regulation by peptides in staphylococci and other Gram-positive bacteria. Curr Opin Microbiol 2: Risson DC, O connor ED, Guard RW et al (2007) A fatal case of necrotising pneumonia due to community-associated methicillinresistant Staphylococcus aureus. Med J Aust 186: O brien FG, Lim TT, Chong FN et al (2004) Diversity among community isolates of methicillin- resistant Staphylococcus aureus in Australia. J Clin Microbiol 42: Coombs GW, Goering RV, Chua KY et al (2012) The molecular epidemiology of the highly virulent ST93 Australian community Staphylococcus aureus strain. PLoS One 7:e Sap10 A (2010) org/files/sap%202010%20mrsa.pdf 52. Coombs GW, Nimmo GR, Pearson JC et al (2009) Prevalence of MRSA strains among Staphylococcus aureus isolated from outpatients, Commun Dis Intell 33: Coombs GW, Monecke S, Ehricht R et al (2010) Differentiation of clonal complex 59 community-associated methicillin-resistant Staphylococcus aureus in Western Australia. Antimicrob Agents Chemother 54: Monecke S, Ehricht R, Slickers P et al (2009) The molecular epidemiology and evolution of the Panton-Valentine leukocidin-positive, methicillin-resistant Staphylococcus aureus strain USA300 in Western Australia. Clin Microbiol Infect 15: Ellington MJ, Ganner M, Warner M et al (2010) First international spread and dissemination of the virulent Queensland communityassociated methicillin-resistant Staphylococcus aureus strain. Clin Microbiol Infect 16: O brien FG, Coombs GW, Pearman JW et al (2009) Population dynamics of methicillinsusceptible and -resistant Staphylococcus aureus in remote communities. J Antimicrob Chemother 64: Ng JW, Holt DC, Lilliebridge RA et al (2009) Phylogenetically distinct Staphylococcus aureus lineage prevalent among indigenous communities in northern Australia. J Clin Microbiol 47: Tong SY, Bishop EJ, Lilliebridge RA et al (2009) Community-associated strains of methicillin-resistant Staphylococcus aureus and methicillin-susceptible S. aureus in indigenous Northern Australia: epidemiology and outcomes. J Infect Dis 199: Chua KY, Seemann T, Harrison PF et al (2011) The dominant Australian communityacquired methicillin-resistant Staphylococcus aureus clone ST93-IV [2B] is highly virulent and genetically distinct. PLoS One 6:e Hageman JC, Patel J, Franklin P et al (2008) Occurrence of a USA300 vancomycinintermediate Staphylococcus aureus. Diagn Microbiol Infect Dis 62: O brien FG, Pearman JW, Gracey M et al (1999) Community strain of methicillinresistant Staphylococcus aureus involved in a hospital outbreak. J Clin Microbiol 37: Saiman L, O keefe M, Graham PL 3rd et al (2003) Hospital transmission of communityacquired methicillin-resistant Staphylococcus aureus among postpartum women. Clin Infect Dis 37: Bratu S, Eramo A, Kopec R et al (2005) Community-associated methicillin-resistant Staphylococcus aureus in hospital nursery and

74 CA-MRSA Case Studies 63 maternity units. Emerg Infect Dis 11: David MD, Kearns AM, Gossain S et al (2006) Community-associated meticillinresistant Staphylococcus aureus : nosocomial transmission in a neonatal unit. J Hosp Infect 64: Orendi JM, Coetzee N, Ellington MJ et al (2010) Community and nosocomial transmission of Panton-Valentine leucocidinpositive community-associated meticillin-resistant Staphylococcus aureus : implications for healthcare. J Hosp Infect 75: Linde H, Wagenlehner F, Strommenger B et al (2005) Healthcare-associated outbreaks and community-acquired infections due to MRSA carrying the Panton-Valentine leucocidin gene in southeastern Germany. Eur J Clin Microbiol Infect Dis 24: Regev-Yochay G, Rubinstein E, Barzilai A et al (2005) Methicillin-resistant Staphylococcus aureus in neonatal intensive care unit. Emerg Infect Dis 11: Munckhof WJ, Nimmo GR, Carney J et al (2008) Methicillin-susceptible, nonmultiresistant methicillin-resistant and multiresistant methicillin-resistant Staphylococcus aureus infections: a clinical, epidemiological and microbiological comparative study. Eur J Clin Microbiol Infect Dis 27: Sanchini A, Mg S, Monaco M et al (2013) Outbreak of skin and soft tissue infections in a hospital newborn nursery in Italy due to community-acquired meticillin-resistant Staphylococcus aureus USA300 clone. J Hosp Infect 83: Nagao M, Iinuma Y, Suzuki M et al (2010) First outbreak of methicillin-resistant Staphylococcus aureus USA300 harboring the Panton-Valentine leukocidin genes among Japanese health care workers and hospitalized patients. Am J Infect Control 38:e37 e Mine Y, Higuchi W, Taira K et al (2011) Nosocomial outbreak of multidrug-resistant USA300 methicillin-resistant Staphylococcus aureus causing severe furuncles and carbuncles in Japan. J Dermatol 38: Hermos CR, Sandora TJ, Williams LE et al (2012) Changing epidemiology of methicillinresistant Staphylococcus aureus colonization in paediatric intensive-care units. Epidemiol Infect 29: Hetem DJ, Westh H, Boye K et al (2012) Nosocomial transmission of communityassociated methicillin-resistant Staphylococcus aureus in Danish Hospitals. J Antimicrob Chemother 67: Barrios-Lopez M, Rojo-Conejo P, Gomez- Gonzalez C et al (2012) Community-onset Staphylococcus aureus infection in neonates. Enferm Infecc Microbiol Clin, DOI: /j.eimc , pii: S X(12) Hafer C, Lin Y, Kornblum J et al (2012) Contribution of selected gene mutations to resistance in clinical isolates of vancomycinintermediate Staphylococcus aureus. Antimicrob Agents Chemother 56: Bochet M, Francois P, Longtin Y et al (2008) Community-acquired methicillin-resistant Staphylococcus aureus infections in two scuba divers returning from the Philippines. J Travel Med 15: Stenhem M, Ortqvist A, Ringberg H et al (2010) Imported methicillin-resistant Staphylococcus aureus, Sweden. Emerg Infect Dis 16: Helgason KO, Jones ME, Edwards G (2008) Panton-valentine leukocidin-positive Staphylococcus aureus and foreign travel. J Clin Microbiol 46: Uhlemann AC, Dumortier C, Hafer C et al (2012) Molecular characterization of Staphylococcus aureus from outpatients in the Caribbean reveals the presence of pandemic clones. Eur J Clin Microbiol Infect Dis 31: Rasigade J, Laurent F, Lina G et al (2010) Global distribution and evolution of Panton- Valentine leukocidin-positive methicillinsusceptible Staphylococcus aureus, J Infect Dis 201: Schaumburg F, Kock R, Friedrich AW et al (2011) Population structure of Staphylococcus aureus from remote African Babongo Pygmies. PLoS Negl Trop Dis 5:e Li M, Diep BA, Villaruz AE et al (2009) Evolution of virulence in epidemic community- associated methicillin-resistant Staphylococcus aureus. Proc Natl Acad Sci U S A 106: Ja O, Gl F (2010) Molecular epidemiology of community-associated meticillin-resistant Staphylococcus aureus in Europe. Lancet Infect Dis 10: Okon KO, Basset P, Uba A et al (2009) Cooccurrence of predominant Panton- Valentine leukocidin-positive sequence type (ST) 152 and multidrug-resistant ST 241 Staphylococcus aureus clones in Nigerian hospitals. J Clin Microbiol 47: Huang YC, Chen CJ (2011) Communityassociated meticillin-resistant Staphylococcus aureus in children in Taiwan, 2000s. Int J Antimicrob Agents 38:2 8

75 64 Madeleine G. Sowash and Anne-Catrin Uhlemann 86. Yao D, Yu F, Qin Z et al (2010) Molecular characterization of Staphylococcus aureus isolates causing skin and soft tissue infections (SSTIs). BMC Infect Dis 10: Wang L, Liu Y, Yang Y et al (2012) Multidrugresistant clones of community-associated meticillin-resistant Staphylococcus aureus isolated from Chinese children and the resistance genes to clindamycin and mupirocin. J Med Microbiol 61: Armand-Lefevre L, Ruimy R, Andremont A (2005) Clonal comparison of Staphylococcus aureus isolates from healthy pig farmers, human controls, and pigs. Emerg Infect Dis 11: Kim ES, Lee HJ, Chung GT et al (2011) Molecular characterization of methicillinresistant Staphylococcus aureus isolates in Korea. J Clin Microbiol 49: Park SH, Park C, Yoo JH et al (2009) Emergence of community-associated methicillin- resistant Staphylococcus aureus strains as a cause of healthcare-associated bloodstream infections in Korea. Infect Control Hosp Epidemiol 30: Maeda T, Saga T, Miyazaki T et al (2012) Genotyping of skin and soft tissue infection (SSTI)-associated methicillin-resistant Staphylococcus aureus (MRSA) strains among outpatients in a teaching hospital in Japan: application of a phage-open reading frame typing (POT) kit. J Infect Chemother 18: Baliga S, Bansil R, Suchitra U et al (2008) Nasal carriage of meticillin-resistant Staphylococcus aureus in medical students. J Hosp Infect 68: Peddie EF, Donald PR, Burger PJ et al (1988) Methicillin-resistant Staphylococcus aureus at Tygerberg Hospital. S Afr Med J 74: Kesah C, Ben RS, Odugbemi T et al (2003) Prevalence of methicillin-resistant Staphylococcus aureus in eight African hospitals and Malta. Clin Microbiol Infect 9: Menif K, Bouziri A, Khaldi A et al (2011) Community-acquired methicillin-resistant Staphylococcus aureus infections requiring admission to a Tunisian pediatric intensive care unit. Tunis Med 89: Ramdani-Bouguessa N, Bes M, Meugnier H et al (2006) Detection of methicillin-resistant Staphylococcus aureus strains resistant to multiple antibiotics and carrying the Panton- Valentine leukocidin genes in an Algiers hospital. Antimicrob Agents Chemother 50: Enany S, Yaoita E, Yoshida Y et al (2010) Molecular characterization of Panton- Valentine leukocidin-positive communityacquired methicillin-resistant Staphylococcus aureus isolates in Egypt. Microbiol Res 165: Breurec S, Fall C, Pouillot R et al (2011) Epidemiology of methicillin-susceptible Staphylococcus aureus lineages in five major African towns: high prevalence of Panton- Valentine leukocidin genes. Clin Microbiol Infect 17: Denis O, Deplano A, De Beenhouwer H et al (2005) Polyclonal emergence and importation of community-acquired methicillinresistant Staphylococcus aureus strains harbouring Panton-Valentine leucocidin genes in Belgium. J Antimicrob Chemother 56: Aires-De-Sousa M, Correia B, De Lencastre H (2008) Changing patterns in frequency of recovery of five methicillin-resistant Staphylococcus aureus clones in Portuguese hospitals: surveillance over a 16-year period. J Clin Microbiol 46: Fang H, Hedin G, Li G et al (2008) Genetic diversity of community-associated methicillinresistant Staphylococcus aureus in southern Stockholm, Clin Microbiol Infect 14: Ruimy R, Maiga A, Armand-Lefevre L et al (2008) The carriage population of Staphylococcus aureus from Mali is composed of a combination of pandemic clones and the divergent Panton-Valentine leukocidinpositive genotype ST152. J Bacteriol 190: Adesida S, Boelens H, Babajide B et al (2005) Major epidemic clones of Staphylococcus aureus in Nigeria. Microb Drug Resist 11: Ghebremedhin B, Olugbosi MO, Raji AM et al (2009) Emergence of a communityassociated methicillin-resistant Staphylococcus aureus strain with a unique resistance profile in Southwest Nigeria. J Clin Microbiol 47: Schaumburg F, Ua N, Kosters K et al (2011) Virulence factors and genotypes of Staphylococcus aureus from infection and carriage in Gabon. Clin Microbiol Infect 17: Groome MJ, Albrich WC, Wadula J et al (2012) Community-onset Staphylococcus aureus bacteraemia in hospitalised African children: high incidence in HIV-infected children and high prevalence of multidrug resistance. Paediatr Int Child Health 32:

76 CA-MRSA Case Studies Punpanich W, Groome M, Muhe L et al (2011) Systematic review on the etiology and antibiotic treatment of pneumonia in human immunodeficiency virus-infected children. Pediatr Infect Dis J 30:e192 e Jansen Van Rensburg MJ, Eliya MV, Whitelaw A et al (2011) The dominant methicillinresistant Staphylococcus aureus clone from hospitals in Cape Town has an unusual genotype: ST612. Clin Microbiol Infect 17: Moodley A, Oosthuysen WF, Duse AG et al (2010) Molecular characterization of clinical methicillin-resistant Staphylococcus aureus isolates in South Africa. J Clin Microbiol 48: Axon JE, Carrick JB, Barton MD et al (2011) Methicillin-resistant Staphylococcus aureus in a population of horses in Australia. Aust Vet J 89: Goering RV, Shawar RM, Scangarella NE et al (2008) Molecular epidemiology of methicillin-resistant and methicillinsusceptible Staphylococcus aureus isolates from global clinical trials. J Clin Microbiol 46: Gordon RJ, Quagliarello B, Cespedes C et al (2005) A molecular epidemiological analysis of 2 Staphylococcus aureus clonal types colonizing and infecting patients with AIDS. Clin Infect Dis 40: Jumaa PA, Neringer R (2005) A survey of antimicrobial resistance in a tertiary referral hospital in the United Arab Emirates. J Chemother 17: Udo EE, O brien FG, Al-Sweih N et al (2008) Genetic lineages of communityassociated methicillin-resistant Staphylococcus aureus in Kuwait hospitals. J Clin Microbiol 46: Havaei SA, Vidovic S, Tahmineh N et al (2011) Epidemic methicillin-susceptible Staphylococcus aureus lineages are the main cause of infections at an Iranian university hospital. J Clin Microbiol 49: Biber A, Abuelaish I, Rahav G et al (2012) A typical hospital-acquired methicillin-resistant Staphylococcus aureus clone is widespread in the community in the Gaza strip. PLoS One 7:e Sola C, Saka H, Vindel A et al (2008) Emergence and dissemination of a community- associated methicillin-resistant Panton-Valentine leucocidin-positive Staphylococcus aureus clone sharing the sequence type 5 lineage with the most prevalent nosocomial clone in the same region of Argentina. J Clin Microbiol 46: Ruimy R, Angebault C, Djossou F et al (2010) Are host genetics the predominant determinant of persistent nasal Staphylococcus aureus carriage in humans? J Infect Dis 202: Ruimy R, Armand-Lefevre L, Barbier F et al (2009) Comparisons between geographically diverse samples of carried Staphylococcus aureus. J Bacteriol 191: Petersen A, Stegger M, Heltberg O et al (2013) Epidemiology of methicillin-resistant Staphylococcus aureus carrying the novel mecc gene in Denmark corroborates a zoonotic reservoir with transmission to humans. Clin Microbiol Infect 19:E16 E Garcia-Alvarez L, Holden M, Lindsay H et al (2011) Meticillin-resistant Staphylococcus aureus with a novel meca homologue in human and bovine populations in the UK and Denmark: a descriptive study. Lancet Infect Dis 11: Harris SR, Feil EJ, Holden MT et al (2010) Evolution of MRSA during hospital transmission and intercontinental spread. Science 327: Harris SR, Cartwright E, Torok ME et al (2012) Whole-genome sequencing for analysis of an outbreak of meticillin-resistant Staphylococcus aureus : a descriptive study. Lancet Infect Dis 3: Ben Nejma M, Mastouri M, Bel Hadj Jrad B, et al (2008) Characterization of ST80 Panton- Valentine leukocidin-positive communityacquired methicillin-resistant Staphylococcus aureus clone in Tunisia. Diagn Microbiol Infect Dis. doi: /j.diagmicrobio Ben NM, Mastouri M, Frih S et al (2006) Molecular characterization of methicillinresistant Staphylococcus aureus isolated in Tunisia. Diagn Microbiol Infect Dis 55: Terry Alli OA, Ogbolu DO, Mustapha JO et al (2012) The non-association of Panton- Valentine leukocidin and meca genes in the genome of Staphylococcus aureus from hospitals in South Western Nigeria. Indian J Med Microbiol 30: Shittu A, Okon K, Adesida S et al (2011) Antibiotic resistance and molecular epidemiology of Staphylococcus aureus in Nigeria. BMC Microbiol 11: Kombate K, Dagnra A, Saka BL et al (2011) Prevalence of methicillin-resistant Staphylococcus aureus in community-acquired skin infections in Lome, Togo. Med Trop (Mars) 71:68 70

77 66 Madeleine G. Sowash and Anne-Catrin Uhlemann 129. Adler A, Chmelnitsky I, Shitrit P et al (2012) Molecular epidemiology of methicillinresistant Staphylococcus aureus in Israel: dissemination of global clones and unique features. J Clin Microbiol 50: Tokajian S, Khalil P, Jabbour D et al (2010) Molecular characterization of Staphylococcus aureus in Lebanon. Epidemiol Infect 138: Udo E, Al-Sweih N, Noronha B (2006) Characterisation of non-multiresistant methicillin- resistant Staphylococcus aureus (including EMRSA-15) in Kuwait Hospitals. Clin Microbiol Infect 12: Udo E, Al-Sweih N, Dhar R et al (2008) Surveillance of antibacterial resistance in Staphylococcus aureus isolated in Kuwaiti hospitals. Med Princ Pract 17: Fatholahzadeh B, Emaneini M, Gilbert G et al (2008) Staphylococcal cassette chromosome mec (SCCmec) analysis and antimicrobial susceptibility patterns of methicillin-resistant Staphylococcus aureus (MRSA) isolates in Tehran, Iran. Microb Drug Resist 14: Shahsavan S, Jabalameli L, Maleknejad P et al (2011) Molecular analysis and antimicrobial susceptibility of methicillin resistant Staphylococcus aureus in one of the hospitals of Tehran University of Medical Sciences: high prevalence of sequence type 239 (ST239) clone. Acta Microbiol Immunol Hung 58: Monecke S, Skakni L, Hasan R et al (2012) Characterisation of MRSA strains isolated from patients in a hospital in Riyadh, Kingdom of Saudi Arabia. BMC Microbiol 12: Udo EE, Panigrahi D, Jamsheer AE (2008) Molecular typing of methicillin-resistant Staphylococcus aureus isolated in a Bahrain hospital. Med Princ Pract 17: Hopman J, Peraza GT, Espinosa F et al (2012) USA300 Methicillin-resistant Staphylococcus aureus in Cuba. Antimicrob Resist Infect Control 1: Reyes J, Rincon S, Diaz L et al (2009) Dissemination of methicillin-resistant Staphylococcus aureus USA300 sequence type 8 lineage in Latin America. Clin Infect Dis 49: Ma XX, Galiana A, Pedreira W et al (2005) Community-acquired methicillin-resistant Staphylococcus aureus, Uruguay. Emerg Infect Dis 11: Pardo L, Machado V, Mollerach M et al (2009) Characteristics of communityassociated methicillin-resistant Staphylococcus aureus (CA-MRSA) strains isolated from skin and soft-tissue infections in Uruguay. Int J Microbiol 2009: Escobar JA, Marquez-Ortiz RA, Alvarez- Olmos MI et al (2012) Detection of a new Community-genotype Methicillin-Resistant Staphylococcus aureus clone that is unrelated with USA300 clone causing pediatric infections in Colombia. J Clin Microbiol 51: Jimenez JN, Ocampo AM, Vanegas JM et al (2012) CC8 MRSA strains harboring SCCmec type IVc are predominant in Colombian hospitals. PLoS One 7:e Neela V, Ghasemzadeh MH, Van Belkum A et al (2010) First report on methicillinresistant Staphylococcus aureus of Spa type T037, Sequence Type 239, SCCmec type III/IIIA in Malaysia. Eur J Clin Microbiol Infect Dis 29: Ghaznavi-Rad E, Nor SM, Sekawi Z et al (2010) Predominance and emergence of clones of hospital-acquired methicillinresistant Staphylococcus aureus in Malaysia. J Clin Microbiol 48: Ghaznavi-Rad E, Neela V, Nor SM et al (2012) Diversity in the antimicrobial susceptibility patterns of methicillin-resistant Staphylococcus aureus clones. Eur J Clin Microbiol Infect Dis 31: Sam IC, Kahar-Bador M, Chan YF et al (2008) Multisensitive community-acquired methicillin-resistant Staphylococcus aureus infections in Malaysia. Diagn Microbiol Infect Dis 62: Ahmad N, Ruzan IN, Abd Ghani MK et al (2009) Characteristics of community- and hospital-acquired meticillin-resistant Staphylococcus aureus strains carrying SCCmec type IV isolated in Malaysia. J Med Microbiol 58: Liu Y, Kong F, Zhang X et al (2009) Antimicrobial susceptibility of Staphylococcus aureus isolated from children with impetigo in China from 2003 to 2007 shows communityassociated methicillin-resistant Staphylococcus aureus to be uncommon and heterogeneous. Br J Dermatol 161: Zhao C, Liu Y, Zhao M et al (2012) Characterization of community acquired Staphylococcus aureus associated with skin and soft tissue infection in Beijing: high prevalence of PVL + ST398. PLoS One 7:e Fan J, Shu M, Zhang G et al (2009) Biogeography and virulence of Staphylococcus aureus. PLoS One 4:e Ho PL, Chuang SK, Choi YF et al (2008) Community-associated methicillin-resistant and methicillin-sensitive Staphylococcus aureus :

78 CA-MRSA Case Studies 67 skin and soft tissue infections in Hong Kong. Diagn Microbiol Infect Dis 61: Takano T, Higuchi W, Zaraket H et al (2008) Novel characteristics of community-acquired methicillin-resistant Staphylococcus aureus strains belonging to multilocus sequence type 59 in Taiwan. Antimicrob Agents Chemother 52: Yanagihara K, Araki N, Watanabe S et al (2012) Antimicrobial susceptibility and molecular characteristics of 857 methicillinresistant Staphylococcus aureus isolates from 16 medical centers in Japan ( ): nationwide survey of community-acquired and nosocomial MRSA. Diagn Microbiol Infect Dis 72: Kawaguchiya M, Urushibara N, Kuwahara O et al (2011) Molecular characteristics of community- acquired methicillin-resistant Staphylococcus aureus in Hokkaido, northern main island of Japan: identification of sequence types 6 and 59 Panton-Valentine leucocidin-positive community-acquired methicillin-resistant Staphylococcus aureus. Microb Drug Resist 17: Alvarez-Uria G, Reddy R (2012) Prevalence and antibiotic susceptibility of communityassociated methicillin-resistant Staphylococcus aureus in a rural area of India: is MRSA replacing methicillin-susceptible Staphylococcus aureus in the community? ISRN Dermatol 2012: D souza N, Rodrigues C, Mehta A (2010) Molecular characterization of methicillinresistant Staphylococcus aureus with emergence of epidemic clones of sequence type (ST) 22 and ST 772 in Mumbai, India. J Clin Microbiol 48: Phakade RS, Nataraj G, Kuyare SS et al (2012) Is methicillin-resistant Staphylococcus aureus involved in community acquired skin and soft tissue infections? Experience from a tertiary care centre in Mumbai. J Postgrad Med 58: Shambat S, Nadig S, Prabhakara S et al (2012) Clonal complexes and virulence factors of Staphylococcus aureus from several cities in India. BMC Microbiol 12: Zafar A, Stone M, Ibrahim S et al (2011) Prevalent genotypes of meticillin-resistant Staphylococcus aureus : report from Pakistan. J Med Microbiol 60: Shabir S, Hardy KJ, Abbasi WS et al (2010) Epidemiological typing of meticillin-resistant Staphylococcus aureus isolates from Pakistan and India. J Med Microbiol 59: Chheng K, Tarquinio S, Wuthiekanun V et al (2009) Emergence of community-associated methicillin-resistant Staphylococcus aureus associated with pediatric infection in Cambodia. PLoS One 4:e Adesida SA, Abioye OA, Bamiro BS et al (2007) Associated risk factors and pulsed field gel electrophoresis of nasal isolates of Staphylococcus aureus from medical students in a tertiary hospital in Lagos, Nigeria. Braz J Infect Dis 11: Onanuga A, Temedie TC (2011) Nasal carriage of multi-drug resistant Staphylococcus aureus in healthy inhabitants of Amassoma in Niger delta region of Nigeria. Afr Health Sci 11: Regev-Yochay G, Carmeli Y, Raz M et al (2006) Prevalence and genetic relatedness of community-acquired methicillin-resistant Staphylococcus aureus in Israel. Eur J Clin Microbiol Infect Dis 25: Kaibni MH, Farraj MA, Adwan K et al (2009) Community-acquired meticillin-resistant Staphylococcus aureus in Palestine. J Med Microbiol 58: Adwan K, Jarrar N, Abu-Hijleh A et al (2012) Molecular analysis and susceptibility patterns of methicillin-resistant Staphylococcus aureus strains causing community- and health careassociated infections in the northern region of Palestine. Am J Infect Control 41(3): Sedighi I, Moez HJ, Alikhani MY (2011) Nasal carriage of methicillin resistant Staphylococcus aureus and their antibiotic susceptibility patterns in children attending daycare centers. Acta Microbiol Immunol Hung 58: Ma H, Sm H, Ma F et al (2010) Staphylococcus aureus nasal carriage rate and associated risk factors in individuals in the community. Epidemiol Infect 138: Lamaro-Cardoso J, De Lencastre H, Kipnis A et al (2009) Molecular epidemiology and risk factors for nasal carriage of staphylococcus aureus and methicillin-resistant S. aureus in infants attending day care centers in Brazil. J Clin Microbiol 47: Bartoloni A, Pallecchi L, Fernandez C et al (2012) Low prevalence of methicillinresistant Staphylococcus aureus nasal carriage in urban and rural community settings in Bolivia and Peru. Int J Infect Dis 17(5): e339 e342. doi: /j.ijid , pii: S (12) Masuda K, Masuda R, Nishi J et al (2002) Incidences of nasopharyngeal colonization of respiratory bacterial pathogens in Japanese children attending day-care centers. Pediatr Int 44: Taguchi H, Matsumoto T, Ishikawa H et al (2012) Prevalence of methicillin-resistant

79 68 Madeleine G. Sowash and Anne-Catrin Uhlemann Staphylococcus aureus based on culture and PCR in inpatients at a tertiary care center in Tokyo, Japan. J Infect Chemother 18: Ozaki K, Takano M, Higuchi W et al (2009) Genotypes, intrafamilial transmission, and virulence potential of nasal methicillinresistant Staphylococcus aureus from children in the community. J Infect Chemother 15: Otsuka T, Zaraket H, Fujii K et al (2012) Molecular epidemiology of methicillinresistant Staphylococcus aureus isolated from children in a community with low antimicrobial pressure in Japan. Jpn J Infect Dis 65: O donoghue M, Boost M (2004) The prevalence and source of methicillin-resistant Staphylococcus aureus (MRSA) in the community in Hong Kong. Epidemiol Infect 132: Ma X, Sun D, Wang S et al (2011) Nasal carriage of methicillin-resistant Staphylococcus aureus among preclinical medical students: epidemiologic and molecular characteristics of methicillin-resistant S. aureus clones. Diagn Microbiol Infect Dis 70: Du J, Chen C, Ding B et al (2011) Molecular characterization and antimicrobial susceptibility of nasal Staphylococcus aureus isolates from a Chinese medical college campus. PLoS One 6:e Ho PL, Chiu SS, Chan MY et al (2012) Molecular epidemiology and nasal carriage of Staphylococcus aureus and methicillin-resistant S. aureus among young children attending day care centers and kindergartens in Hong Kong. J Infect 64: Lo WT, Wang SR, Tseng MH et al (2010) Comparative molecular analysis of meticillinresistant Staphylococcus aureus isolates from children with atopic dermatitis and healthy subjects in Taiwan. Br J Dermatol 162: Lo WT, Lin WJ, Tseng MH et al (2007) Nasal carriage of a single clone of communityacquired methicillin-resistant Staphylococcus aureus among kindergarten attendees in northern Taiwan. BMC Infect Dis 7: Chen CB, Chang HC, Huang YC (2010) Nasal meticillin-resistant Staphylococcus aureus carriage among intensive care unit hospitalised adult patients in a Taiwanese medical centre: one time-point prevalence, molecular characteristics and risk factors for carriage. J Hosp Infect 74: Chen CJ, Hsu KH, Lin TY et al (2011) Factors associated with nasal colonization of methicillin-resistant Staphylococcus aureus among healthy children in Taiwan. J Clin Microbiol 49: Chen C, Chen C, Huang YC (2012) Nasal carriage rate and molecular epidemiology of methicillin-resistant Staphylococcus aureus among medical students at a Taiwanese university. Int J Infect Dis 16:e799 e Chiu Y, Lo W, Wang C (2012) Risk factors and molecular analysis of Panton-Valentine leukocidin-positive methicillin-susceptible Staphylococcus aureus colonization and infection in children. J Microbiol Immunol Infect 45: Lu S, Chang F, Cheng C et al (2011) Methicillin-resistant Staphylococcus aureus nasal colonization among adult patients visiting emergency department in a medical center in Taiwan. PLoS One 6:e Ko K, Lee J, Baek J et al (2008) Characterization of Staphylococcus aureus nasal carriage from children attending an outpatient clinic in Seoul, Korea. Microb Drug Resist 14: Lee J, Jy S, Ym K et al (2011) Molecular characterization of methicillin-resistant Staphylococcus aureus obtained from the anterior nares of healthy Korean children attending daycare centers. Int J Infect Dis 15:e558 e Pathak A, Marothi Y, Iyer R et al (2010) Nasal carriage and antimicrobial susceptibility of Staphylococcus aureus in healthy preschool children in Ujjain, India. BMC Pediatr 10: Ramana K, Mohanty S, Wilson C (2009) Staphylococcus aureus colonization of anterior nares of school going children. Indian J Pediatr 76: Chatterjee S, Ray P, Aggarwal A et al (2009) A community-based study on nasal carriage of Staphylococcus aureus. Indian J Med Res 130: Chande C, Shrikhande S, Jain D et al (2009) Prevalence of methicillin-resistant Staphylococcus aureus nasopharyngeal carriage in children from urban community at Nagpur. Indian J Public Health 53: Anwar M, Jaffery G, Rehman BK et al (2004) Staphylococcus aureus and MRSA nasal carriage in general population. J Coll Physicians Surg Pak 14: Rijal K, Pahari N, Shrestha B et al (2008) Prevalence of methicillin resistant Staphylococcus aureus in school children of Pokhara. Nepal Med Coll J 10: Kitti T, Boonyonying K, Sitthisak S (2011) Prevalence of methicillin-resistant Staphylococcus

80 CA-MRSA Case Studies 69 aureus among university students in Thailand. Southeast Asian J Trop Med Public Health 42: Nickerson E, Wuthiekanun V, Kumar V et al (2011) Emergence of community-associated methicillin-resistant Staphylococcus aureus carriage in children in Cambodia. Am J Trop Med Hyg 84: Severin J, Lestari E, Kuntaman K et al (2008) Unusually high prevalence of pantonvalentine leukocidin genes among methicillinsensitive Staphylococcus aureus strains carried in the Indonesian population. J Clin Microbiol 46: Lestari ES, Duerink DO, Hadi U et al (2010) Determinants of carriage of resistant Staphylococcus aureus among S. aureus carriers in the Indonesian population inside and outside hospitals. Trop Med Int Health 15: Deurenberg RH, Beisser PS, Visschers MJ et al (2010) Molecular typing of methicillinsusceptible Staphylococcus aureus isolates collected in the Yogyakarta area in Indonesia, Clin Microbiol Infect 16: Nor SM, Sekawi Z, Van Belkum A et al (2008) First community-acquired meticillinresistant Staphylococcus aureus in Malaysia. J Med Microbiol 57:

81 Chapter 3 Rapid Methods for Detection of MRSA in Clinical Specimens Elizabeth L. Palavecino Abstract Antimicrobial susceptibility test methods such as disk diffusion, broth microdilution, and oxacillin screen plate require 24 h of incubation after having the organism growing in pure culture. Rapid and accurate identification of MRSA isolates is essential not only for patient care, but also for effective infection control programs to limit the spread of MRSA. In the last few years, several commercial rapid tests for detection of MRSA directly from nasal swabs and blood cultures have been developed for use in clinical laboratories. Real-time PCR and other molecular tests are gaining popularity as MRSA screening tests to identify patients who are candidates for contact precaution at the time of admission decreasing the risk for nosocomial transmission. These new methodologies have the advantage of a lower turnaround time than that of traditional culture and susceptibility testing and they are capable of detecting MRSA directly from nasal or wound swabs allowing rapid identification of colonized or infected patients. In addition, molecular methods able to detect and differentiate S. aureus and MRSA (SA/MRSA) directly from blood cultures are becoming a useful tool for rapid detection of bacteremia caused by MSSA and MRSA. This review focuses on the procedures for performing testing using rapid methods currently available for detection of MRSA directly from clinical specimens. Key words Staphylococcus aureus, MRSA, mec A gene, Rapid methods, Molecular methods, Real-time PCR, Chromogenic agar 1 Introduction Rapid non-molecular and molecular methods are currently available to detect the presence of MRSA directly from clinical specimens. Numerous studies have demonstrated the clinical effectiveness of these rapid methods for detection of MRSA [ 1 8 ]. Depending on the test used, MRSA can be detected h earlier than with traditional methodologies (Fig. 1 ). The reduction of the turnaround time for detection of MRSA can be accomplished by rapid confirmation of methicillin resistance in positive cultures Yinduo Ji (ed.), Methicillin-Resistant Staphylococcus aureus (MRSA) Protocols, Methods in Molecular Biology, vol. 1085, DOI / _3, Springer Science+Business Media, LLC

82 72 Elizabeth L. Palavecino Day 1 Day 2 Day 3 Nasal Swab Collected Culture specimen on agar plate and incubate (16-24h) S. aureus growing on plate Perform susceptibility testing(16-24h) Detection of MRSA PBP2a latex agglutination meca gene PCR Nasal Swab Collected Culture specimen on chromogenic agar and incubate (18-28h) Detection of MRSA based on color of colony Nasal Swab Collected Perform PCR (1-3h) Traditional culture and susceptibility testing (48-72 hours) Use of Chromogenic agar for MRSA (24 hours) Real time PCR 1-3 hours after collection of swab Fig. 1 Diagram illustrating the turnaround time, from nasal swab collection to detection of MRSA, for each method. Rapid methods can reduce turnaround times by h compared to traditional methods growing S. aureus or by detection of MRSA directly from the clinical specimens. For confirmation of methicillin resistance the presence of the mec A gene or its product, the PBP2a can be detected from the S. aureus colonies. Even though the confirmation of resistance by rapid methods can shorten the turnaround time for detection of MRSA, incubation for h is still required to grow the S. aureus in culture after the sample has been received in the microbiology laboratory. For detection of MRSA directly from patients samples, cultured-based and molecular methods can be used. Cultured-based methods use selective agar media to grow and differentiate MRSA in h. Molecular methods used for detection of MRSA directly on clinical samples can provide results in 1 5 h as they obviate the requirement for cultured organisms. Below is a brief description of the rapid assays and system platforms commercially available for detection of MRSA or both S. aureus and MRSA strains from clinical specimens. 2 Rapid Methods for Confirmation of Methicillin Resistance Tests for mec A or for the protein expressed by mec A, PBP 2a, are the most accurate methods for prediction of resistance to oxacillin and can be used for confirmation of susceptibility results in S. aureus isolates growing in culture.

83 Molecular Methods for Detection of MRSA PBP2a 2.2 meca Gene As discussed above, the PBP2a or PBP2 is encoded by the mec A gene and is responsible for the expression of methicillin resistance. A PBP2 latex agglutination test is commercially available (Oxoid, Thermo Fisher Scientific, Inc. Lenexa, KS). This test uses latex particles sensitized with a monoclonal antibody against PBP2a which specifically reacts with MRSA to cause agglutination visible to the unaided eye. The test can be performed in isolated colonies of S. aureus growing on culture plates. The procedure requires a PBP2a extraction step done by adding extraction reagents, followed by boiling and centrifugation. The supernatant is then tested with the latex reagent. True positive results usually have strong agglutination reaction. The reported sensitivity and specificity of this test for detection of PBP2a in S. aureus is 100 % and 97.1 % respectively and this test may be useful for confirmation of oxacillin resistance in S. aureus in a shorter time than using traditional susceptibility testing [ 9 ]. Laboratory developed tests as well as analyte specific reagents can be used to detect the mec A gene in S. aureus growing in culture [ 10 ]. Presence of the mec A gene correlates with oxacillin resistance and therefore precludes the need for confirmation by antimicrobial susceptibility testing which takes an additional 24 h. The recent finding of a new meca homologue with only 70 % nucleotide homology to the conventional meca gene has raised concern about the performance of mec A assays as a confirmatory test for MRSA [ 11 ]. 3 Cultured-Based Rapid Methods In recent years, the use of chromogenic medium has become a valuable tool for the rapid identification of MRSA in clinical samples. In contrast to conventional culture media, chromogenic media allow direct colony identification of the resistant organism from the primary culture. In general, chromogenic agars are designed to give an identification by color reaction of the colonies and select for the resistant phenotype by including the antibiotic to which the organism is resistant in the medium. The selective mixture inhibits most bacteria not belonging to the genus Staphylococcus. This reduces the need for subculture and for further identification testing and hence the time until a result is obtained. Several chromogenic cefoxitin-based selective agar media are now available for MRSA detection and have performed well in clinical evaluations [ ] but the sensitivity may need to be enhanced by the use of an enrichment broth which may delay the results [ 7, 18 ]. Most chromogenic media can detect MRSA in h and if no colonies of the appropriate color are observed, the culture result can be reported and the plates discarded.

84 74 Elizabeth L. Palavecino Table 1 Examples of commercial chromogenic media for detection of MRSA strains in clinical samples Medium Company Approved specimen Color of MRSA colony Incubation required (h) ChromoID MRSA agar BioMerieux, Inc Nasal swabs Green 24 Spectra MRSA Remel Nasal swabs and positive blood cultures Denim blue 24 BBL CHROMagar MRSA II Becton Dickinson Nasal swabs Mauve HardyCHROM MRSA Hardy Diagnostics Nasal swabs Pink to magenta MRSA Select Bio-Rad Nasal swabs Pink Interpretation of culture results should be made taking into account the colony morphology, size and color due to the occasional growth of bacteria other than MRSA on the medium. Examples of chromogenic media commercially available for detection of MRSA strains are shown in Table 1. 4 Molecular Assays Most of the currently available molecular tests are real-time PCR tests. Molecular detection of the mec A gene in combination with detection of genes specific for S. aureus in a multiplex PCR have been used for detection of MRSA directly from patients samples. Some of the challenges that these molecular tests needed to overcome include the capability to detect MRSA in specimens that may contain a mixture of MRSA and methicillin susceptible S. aureus (MSSA) or methicillin-resistant coagulase negative staphylococci (MR-CoNS). A positive mec A gene could indicate the presence of MRSA or MR-CoNS while detection of a specific gene for S. aureus could indicate the presence of MRSA or MSSA. To avoid detection of false positives due to the presence of MR-CoNS or MSSA and to accurately detect only MRSA in the sample, molecular methods assays were developed to specifically target the junction between a conserved open reading frame orfx in S. aureus and the SCC mec containing the mec A gene (Fig. 2 ). Tests targeting this junction for probe detection ensure that an amplification product is detected only if MRSA is present in the sample. Rapid, PCR-based assays have a high sensitivity and specificity compared to traditional culture and chromogenic agars for detection of MRSA in clinical specimens approved for testing and are becoming a valuable alternative for

85 Molecular Methods for Detection of MRSA 75 SCCmec S. aureus chromosome meca SCCmec right extremity orfx SCCmec / orfx junction Fig. 2 Diagram of SCCmec carrying mec A gene and its insertion site, the orfx gene of S. aureus. Reproduced and adapted from [ 41 ], with permission from Steve Shumoski MRSA screening [ 3 7 ]. However, recent studies have demonstrated false positive results with assays that detect the SCC cassette but not the mec A gene [ ]. Strains carrying an SCC that does not contain the mec A gene, and therefore susceptible to oxacillin, have been detected as MRSA by some molecular assays [ ]. The true prevalence of the strains with an empty SCC cassette is not known, but laboratories are advised to monitor results and to culture samples positive by MRSA PCR assays to confirm results if these strains are suspected. Molecular tests targeting the SCC mec should also have primers to detect the different types or variants (MREJ types) within the right extremity of SCC to ensure detection of the most prevalent MRSA strains. Due to the wide variety of molecular assays and instruments needed to run these assays, laboratories may need to carefully evaluate the implementation of these tests and decide on a molecular assay that can be suitable for the patient population they serve and the resources and technical personnel available [ 23 ]. Below is a brief description of the molecular assays and the system platforms available for detection of MRSA and both S. aureus and MRSA in clinical specimens. Examples of molecular assays cleared by the FDA for rapid identification of S. aureus or MRSA are shown in Table 2. Data was obtained from the FDA medical devices database [ ]. 4.1 Molecular Assays for Detection of MRSA from Swabs (Nares or Wounds) Xpert MRSA, Xpert SA Nasal Complete, and Xpert MRSA/SA SSTI (Cepheid Inc, CA) These assays are available on the GeneXpert Dx System for the detection of MRSA from nasal swabs and for the detection of both S. aureus and MRSA from nasal and wound swabs. The GeneXpert System is a fully automated system that uses real-time PCR and requires the use of a single-use disposable cartridge eliminating the need for batching samples. These assays require minimal hands on time. The specimen swab is inserted into the tube containing elution reagent. Following a brief vortexing the eluted material and the appropriate reagents are transferred to different wells of the cartridge. The extraction, amplification and detection steps are performed in a closed system and each cartridge houses all the

86 Table 2 Examples of commercial molecular assays for detection of MRSA or S. aureus and MRSA in clinical specimens [ ] Organism detected Assay Company Analysis platform Probes DNA target sequence Specimen type Time to result (h) MRSA BD GeneOhm MRSA ACP Becton Dickinson SmartCycler System Molecular beacons SCC mec at orf X junction. Nasal swab 2.5 BD MAX MRSA Becton Dickinson BD MAX System Taqman R probes SCC mec at orf X junction. Nasal swab 2 Xpert MRSA Cepheid GeneXpert Dx System Taqman R probes Insertion site ( attbsc ) of SCC mec Nasal swab 1 MRSA Advanced Test Roche LightCycler FRET probes Insertion site SSC mec at orf X junction Nasal swab 2 NucliSENS EasyQ MRSA biomerieux EasyQ System (NASBA) Molecular beacons SSC mec at orf X junction and mec A gene for oxacillin resistance Nasal swab 3 S. aureus and MRSA Xpert MRSA/ SA SSTI Cepheid GeneXpert System Taqman R probes spa for S. aureus, SSC mec and mec A gene for methicillin resistance Wound swab <1 Xpert SA Nasal Complete Cepheid GeneXpert System Taqman R probes spa for S. aureus, SSC mec and mec A gene for methicillin resistance Nasal swab <1 Xpert MRSA/SA Blood Culture a Cepheid GeneXpert System Taqman R probes spa for S. aureus, SSC mec and mec A gene for methicillin resistance Blood Culture <1 StaphSR BD GeneOhm Smart Cycler Molecular beacons nuc gene for S aureus, Insertion site ( attbsc ) of SCC mec for methicillin resistance Blood Culture BC-GP b Nanosphere Verigene Gold nanoparticles gyrb for S. aureus and mec A gene for methicillin resistance Blood culture 2.5 a The Cepheid MRSA/SA Blood Culture had a Recall in 2010 [ 46 ] b The Verigene BC-GP simultaneously detects and identifies 12 g positive organisms and three resistance determinants including MRSA [ 47 ]

87 Molecular Methods for Detection of MRSA 77 reagents necessary for testing, including an internal control. The GeneXpert System software automatically interprets test results [ 24 ]. A multicenter evaluation of the Xpert MRSA assay for detection of MRSA in nares found a clinical sensitivity of 86.3 % and a specificity of 94.9 % compared to broth-enriched culture [ 32 ]. Other studies have confirmed these findings [ 33 ]. However, false positive MRSA results have recently been reported with the Xpert MRSA assay due to the presence of SCC mec lacking the mec A gene [ 19 ]. The risk of false positive is lower with the Xpert SA Nasal Complete and Xpert MRSA/SA SSTI assays which target both the SCC mec and the mec A gene because these tests will give a MRSA positive result only if both targets are detected [ 24 ]. Failure to detect a specific SCC mec type IV variant not targeted by the Xpert MRSA assay has been reported [ 34 ] BD GeneOhm MRSA and BD GeneOhm MRSA ACP (Becton Dickinson, Franklin Lakes, NJ). These assays are real-time PCR assays performed on the SmartCycler Instrument (Cepheid Inc,) The BD GeneOhm MRSA assay was the first RT-PCR assay cleared by the FDA for the detection of MRSA in nasal swabs in patients at risk for nasal colonization. The BD GeneOhm MRSA ACT assay is similar to the original and already proven BD GeneOhm MRSA assay but includes achromopeptidase (ACP) lysis and a more simplified procedure [ 25 ]. This updated assay, like the previous BD GeneOhm MRSA, is FDA cleared for detection of MRSA in nasal swabs. In the BD GeneOhm MRSA ACT assay, the lysis and preparation of the sample for PCR amplification is done manually. The lysis of the bacterial cells in nasal swab specimens is performed using the BD GeneOhm MRSA ACT lysis kit. An aliquot of the lysate is added to prepared PCR reagents which contain the MRSA- specific primers that will amplify in the presence of the target sequence. Controls and specimen lysates are added to disposable reaction tubes and placed in the SmartCycler II instrument. The amplification, detection, and result interpretation are performed by the SmartCycler software. The BD GeneOhm MRSA assay has been evaluated in several studies and found to have a high sensitivity, specificity and negative predictive value [ 5, 18, 35, 36 ]. The BD GeneOhm MRSA ACT assay has been found to be highly sensitive and specific for detection of MRSA from nasal swabs with a reported sensitivity of 92 %, specificity of 94.6 % when compared to culture-based recovery of MRSA [ 37 ]. The test performance seems to be comparable to the original BD GeneOhm MRSA assay. As with other molecular tests that target SCC for determination of resistance, false positives have been detected with the BD GeneOhm MRSA assay in S. aureus strains that have SCC mec but lack the mec A gene [ 22 ]. False negative results have also been reported due to sequence variants of SCC mec not detected by the current primers of the BD GeneOhm MRSA assay [ 38 ].

88 78 Elizabeth L. Palavecino BD MAX MRSA (Becton Dickinson, Franklin Lakes, NJ) LightCycler MRSA Advanced Test (Roche Diagnostics, Indianapolis, IN) NucliSENS EasyQ MRSA (Biomerieux, Inc. Durham, NC) This MRSA assay is similar to the BD GeneOhm MRSA ACT assay performed on the SmartCycler with the advantage of full automation provided by the BD MAX System. A nasal swab is placed in a BD MAX MRSA Sample Buffer Tube which is vortexed and placed onto the BD MAX System, which automates sample lysis, DNA extraction and concentration, reagent dehydration, nucleic acid amplification and detection of the target nucleic acid sequence using real-time PCR. The amplified DNA targets are detected using hydrolysis (TaqMan) probes labeled with different fluorophores to detect MRSA and the sample processing control. The BD MAX System software automatically interprets test results [ 26 ]. One study evaluated the performance of the BD MAX MRSA and found a sensitivity of 93.9 % and a specificity of 99.2 % and reported fewer unresolved results compared to the BD GeneOhm ACP MRSA assay [ 39 ]. Because this assay is similar to the BD GeneOhm MRSA, potential false positive results can be obtained with S. aureus strains with empty SCC cassettes. This test uses RT-PCR technology for amplification and detection of MRSA from nasal swabs. It requires swab specimen preparation using the MagNA Lyser instrument and the LightCycler Advanced Lysis kit for mechanical lysis and nucleic acid extraction. The processed specimen is subjected to PCR amplification and detection of MRSA by fluorogenic specific hybridization probes on the LightCycler instrument [ 27 ]. Each LightCycler MRSA advanced test reaction mixture contains an internal control to detect specimen inhibition and to monitor reagent integrity. Performance data of the LightCycler MRSA Advanced Tests show a positive agreement of 95.2 % and a negative agreement of 96.4 % when compared with direct chromogenic culture [ 40 ]. In addition, this study showed that this test appears to have a similar sensitivity and improved specificity compared to the BD GeneOhm MRSA assay for detection of MRSA in nasal surveillance swabs. Like with other assays targeting the insertion site of the SCC mec in the S. aureus orf X gene, both false positive and false negative results may potentially occur; false positives due to empty SSC mec cassettes and false negatives due to mutations within the target sequence. This test utilizes NASBA (nucleic acid sequence-based amplification) technology, an isothermal amplification of genomic elements of MRSA, coupled with molecular beacons to detect the presence of MRSA DNA in nasal swabs [ 28, 41 ]. Amplified products generated in the amplification reaction are concurrently detected by hybridization of fluorophore-labeled molecular beacon probes that produce a fluorescent signal read by the NucliSENS EasyQ Analyzer, which provides automated analysis of the resulting fluorescence curves and reporting of results. Because this assay targets both the SCC mec cassette at the orf X junction and the

89 Molecular Methods for Detection of MRSA 79 mec A gene for determination of resistance, the system will report a MRSA positive result only if both targets are detected, reducing the risk of false positive MRSA results due to empty SCC cassettes [ 41 ]. In addition, this assay is designed to detect seven different MREJ types or sequence variation within the right extremity of SCC. The manufacturer claims a clinical sensitivity of 95.8 % and a clinical specificity of 96.8 % compared to the enriched culture reference method [ 28 ]. 4.2 Detection of S. aureus and MRSA Directly from Blood Cultures BD GeneOhm StaphSR Assay (Becton Dickinson, Franklin Lakes, NJ) Xpert MRSA/SA Blood Culture Assay (Cepheid Inc, CA) The StaphSR assay is designed to detect S. sureus and MRSA directly from positive blood culture bottles growing gram positive cocci, identified by Gram stain. To perform the test, an aliquot of the culture media is transferred into a sample buffer tube and lysed. An aliquot of the specimen lysate is added to the PCR reagents mix which contains the specific primers for amplification of the genetic targets for S. aureus and MRSA. The amplified targets are detected with molecular beacon probes. The amplification, detection and signal interpretation is performed automatically by the Cepheid Smart Cycler software. Amplification occurs if S. aureus specific sequences, unattached to the SCC mec are present indicating the presence of S. aureus or if S. aureus specific sequences near the insertion site of the SCC mec are present indicating the presence of MRSA [ 29 ]. Compared to the culture reference method, the manufacturer claims an overall agreement between % for MRSA and % for S. aureus [ 29 ]. As with other assays targeting the insertion site of the SCC mec in the S. aureus orf X gene false positive results for MRSA may be obtained due to empty SSC mec cassettes. False negatives have been reported due to failure to detect strains with MREJ types not targeted by the current assay [ 42 ]. This test is a rapid automated test for simultaneous detection of MRSA and S. aureus directly from positive blood culture specimens showing Gram positive cocci by Gram stain. To perform the test, an aliquot (approximately 50 μl) of the blood culture media is transferred into the elution reagent tube and briefly vortexed. The eluted sample and the necessary reagents are transferred to the designated chamber of Xpert MRSA/SA cartridge. As described above, the GeneXpert System performs PCR amplification, detection of target DNA and interpretation of the results. The manufacturer claimed a sensitivity and specificity of 100 % for MRSA and a sensitivity of 100 % and specificity of 99.5 % for S. aureus [ 30 ]. Other investigators also found this assay to be highly sensitive and specific [ ]. However, the Xpert MRSA/SA BC assay had a recall issued in 2010 due to the potential of generating false negative MRSA results [ 46 ]. Customers were advised not to report a MRSA negative result when using the Xpert MRSA/SA blood culture assay.

90 80 Elizabeth L. Palavecino Verigene Gram-Positive Blood Culture Nucleic Acid Test (BC-GP) (Nanosphere, Northbrook, IL) This is a microarray-based qualitative multiplex assay that is performed directly on a positive blood culture medium growing gram positive organisms to detect and identify pathogenic gram positive organisms commonly associated with bloodstream infections, including S. aureus and S. epidermidis. In addition, the BC-GP assay detects the mec A gene inferring methicillin resistance. The Verigene system detects many targets in a single test and allows for random access test processing. The single-use test cartridge and consumables contains all the reagents necessary for testing. The Verigene System performs automated nucleic acid extraction, hybridization, signal amplification and qualitative analysis of the results [ 31, 47 ]. Gold nanoparticle probes are used for the detection of the nucleic acid targets. These gold nanoparticles have a high affinity for complementary DNA, allowing for an efficient hybridization. If hybridization occurs, the signal is amplified by silver enhancement of the gold nanoparticles. The analysis of results is performed automatically by the Verigene reader. If both the mec A gene and the target specific for S. aureus are detected, the organism present in the sample is identified as MRSA. In mixed cultures, BC-GP does not specifically attribute mec A-mediated methicillin resistance to either S. aureus or S. epidermidis. The claimed sensitivity and specificity of this assay are 99.1 % and 100 % respectively for detection of S. aureus and 94.2 % and 98.2 % respectively for the detection of the mec A gene [ 31 ]. A remaining challenge for the molecular assays is the dynamic structure of the SCC mec element and the potential for mutations, rearrangements, insertions, and deletions, creating new combinations and types of SCC mec or new mec A homologues that may not be detected with the current probes [ 11, 38, 47 ]. Because of the evolution of the SCC mec gene in MRSA, continued evaluation of the performance of these tests in a clinical setting is warranted and new primers should be designed to ensure detection of the most prevalent MRSA strains. 5 Conclusions The dissemination of MRSA strains in hospitals and other health care systems continues to be an important problem around the world. Results of traditional methods often take 2 3 days to become available. Non-molecular and molecular rapid methods are now commercially available and are becoming a valuable tool for the confirmation of methicillin resistance and for detection of MRSA directly from clinical specimens. Tests used for confirmation of oxacillin resistance are highly specific but still need to have the organism growing in culture. Chromogenic agar may decrease MRSA detection time by 1 2 days compared with the time associated with standard culture and can be used to detect MRSA directly

91 Molecular Methods for Detection of MRSA 81 on nasal swabs. Molecular assays are able to accurately detect MRSA and S. aureus directly on patient s samples, with results available in 1 3 h after collection of nasal swabs or positive blood culture medium. False negative results due to mutations and variants in the SCC mec junction not detected by current probes as well false positive results due to an excision of the mec A gene from the SCC cassette have raised concern about their performance. Rapid molecular assays targeting SCC mec should be continuously monitored to ensure that their claimed sensitivity and specificity for detection of MRSA strains is maintained. Acknowledgments I thank Carlos A. Fasola for helpful editorial suggestions to the manuscript. References 1. Cunningham R, Jenks P, Northwood J et al (2007) Effect on MRSA transmission of rapid PCR testing of patients admitted to critical care. J Hosp Infect 65: Jog S, Cunningham R, Cooper S et al (2008) Impact of preoperative screening for meticillinresistant Staphylococcus aureus by real-time polymerase chain reaction in patients undergoing cardiac surgery. J Hosp Infect 69: Polisena J, Chen S, Cimon K et al (2011) Clinical effectiveness of rapid tests for methicillin resistant Staphylococcus aureus (MRSA) in hospitalized patients: a systematic review. BMC Infect Dis 11: French GL (2009) Methods for screening for methicillin-resistant Staphylococcus aureus carriage. Clin Micro Infect 15(Suppl 7): Paule SM, Pasquariello AC, Hacek DM et al (2004) Direct detection of Staphylococcus aureus from adult and neonate nasal swab specimens using real-time polymerase chain reaction. J Mol Diagn 6: Warren DK, Liao RS, Merz LR et al (2004) Detection of methicillin-resistant Staphylococcus aureus directly from nasal swab specimens by a real-time PCR assay. J Clin Microbiol 42: Harbarth S, Hawkey PM, Tenover F et al (2011) Update on screening and clinical diagnosis of methicillin-resistant Staphylococcus aureus (MRSA). Int J Antimicrob Agents 37: Paule SM, Pasquariello AC, Thomson RB Jr et al (2005) Real-time PCR can rapidly detect methicilin-susceptible and methicillin-resistant Staphylococcus aureus directly from positive blood culture bottles. Am J Clin Pathol 124: Bressler AM, Williams T, Culler EE et al (2005) Correlation of penicillin Binding protein 2a detection with oxacillin resistance in Staphylococcus aureus and discovery of a novel penicillin binding protein 2a mutation. J Clin Microbiol 43: Kohner P, Uhl J, Kolbert C et al (1999) Comparison of susceptibility testing methods with meca gene analysis for determining oxacillin (methicillin) resistance in clinical isolates of Staphylococcus aureus and coagulase- negative Staphylococcus spp. J Clin Microbiol 37: Stegger M, Andersen PS, Kearns A et al (2012) Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either meca or the new meca homologue meca(lga251). Clin Microbiol Infect 18: Wendt C, Havill NL, Chapin KC et al (2010) Evaluation of a new selective medium, BD BBL CHROMagar MRSA II, for detection of methicillin-resistant Staphylococcus aureus in different specimens. J Clin Microbiol 48: Nonhoff C, Denis O, Brenner A et al (2009) Comparison of three chromogenic media and

92 82 Elizabeth L. Palavecino enrichment broth media for the detection of methicillin-resistant Staphylococcus aureus from mucocutaneous screening specimens: comparison of MRSA chromogenic media. Eur J Clin Microbiol Infect Dis 28: Denys GA, Renzi PB, Koch KM et al (2012) Three way comparison of BBL CHROMagar MRSA II, MRSA select, and spectra MRSA for the detection of methicillin-resistant Staphylococcus aureus (MRSA) in nasal surveillance cultures. J Clin Microbiol. doi: / JCM Bischof LJ, Lapsley L, Fontecchio K et al (2009) Comparison of chromogenic media to BD GeneOhm methicillin-resistant Staphylococcus aureus (MRSA) PCR for detection of MRSA in nasal swabs. J Clin Microbiol 47: Peterson JF, Riebe KM, Hall GS et al (2010) Spectra MRSA, a new chromogenic agar medium to screen for methicillin-resistant Staphylococcus aureus. J Clin Microbiol 48: Wassenberg MWM, Kluytmans JAJW, Box ATA et al (2010) Rapid screening of methicillin- resistant Staphylococcus aureus using PCR and chromogenic agar: a prospective study to evaluate costs and effects. Clin Microbiol Infect 16: Paule SM, Mehta M, Hacek DM et al (2009) Chromogenic media vs real-time PCR for nasal surveillance of methicillin-resistant Staphylococcus aureus : impact on detection of MRSA-positive persons. Am J Clin Pathol 131: Blanc DS, Basset P, Nahimana-Tessemo I et al (2011) High proportion of wrongly identified methicillin-resistant Staphylococcus aureus carriers by use of a rapid commercial PCR assay due to presence of staphylococcal cassette chromosome element lacking the meca gene. J Clin Microbiol 49: Snyder JW, Munier GK, Johnson CL (2010) Comparison of the BD GeneOhm methicillinresistant Staphylococcus aureus (MRSA) PCR assay to culture by use of BBL CHROMagar MRSA for detection of MRSA in nasal surveillance cultures from intensive care unit patients. J Clin Microbiol 48: Wong H, Louie L, Lo RY et al (2010) Characterization of Staphylococcus aureus isolates with a partial or complete absence of staphylococcal cassette chromosome elements. J Clin Microbiol 48: Stamper PD, Louie L, Wong H et al (2011) Genotypic and phenotypic characterization of methicillin-susceptible Staphylococcus aureus isolates misidentified as methicillin-resistant Staphylococcus aureus by the BD GeneOhm MRSA assay. J Clin Microbiol 49: Palavecino E. (2010). Make the move to molecular diagnostics. MLO Med Lab Obs 42, 10, 12, Food and Drug Administration. Medical devices databases. Cepheid Xpert SA Nasal Complete Assay. 510 (k) Substantial equivalence determination decision summary assay and instrument combination template. K pdf. Accessed 20 Oct Food and Drug Administration. Medical devices databases. BD GeneOhm MRSA ACP Assay. 510 (k) Summary. Accessed 22 Oct Food and Drug Administration. Medical devices databases. BD MAX MRSA Assay. 510 (k) Summary. gov/cdrh_docs/pdf12/k pdf. Accessed 22 Oct Food and Drug Administration. Medical devices databases. Light Cycler MRSA Advanced Test. 510 (k) Summary. K pdf. Accessed 20 Oct Food and Drug Administration. Medical devices databases. NucliSENS EasyQ MRSA. 510 (k) Summary. fda.gov/cdrh_docs/pdf10/k pdf. Accessed 20 Oct Food and Drug Administration. Medical devices databases. BD Diagnostics, BD GeneOhm StaphSR. 510 (k) Summary. pdf7/k pdf. Accessed 22 Oct Food and Drug Administration. Cepheid Xpert MRSA/SA Blood Culture Assay. 510 (k) Summary. gov/cdrh_docs/pdf10/k pdf. Accessed 22 Oct Food and Drug Administration. Nanosphere. Verigene gram-positive blood culture nucleic acid test (BC-GP). 510 (k) Summary. K pdf. Accessed 25 Nov Wolk DM, Picton E, Johnson D et al (2009) Multicenter evaluation of the Cepheid Xpert methicillin-resistant Staphylococcus aureus (MRSA) test as rapid screening method for detection of MRSA in nares. J Clin Microbiol 47: Rossney AS, Herra CM, Brennan GI et al (2008) Evaluation of Xpert methicillin resistant Staphylococcus aureus (MRSA) assay using the GeneXpert real-time PCR platform for

93 Molecular Methods for Detection of MRSA 83 rapid detection of MRSA from screening specimens. J Clin Microbiol 46: Laurent C, Bogaerts P, Schoevaerdts D et al (2010) Evaluation of the Xpert MRSA assay for rapid detection of methicillin-resistant Staphylococcus aureus from nares swabs of geriatric hospitalized patients and failure to detect a specific SCCmec type IV variant. Eur J Clin Microbiol Infect Dis 29: Lucke K, Hombach M, Hug M et al (2010) Rapid detection of methicillin-resistant Staphylococcus aureus (MRSA) in diverse clinical specimens by the BD GeneOhm MRSA assay and comparison with culture. J Clin Microbiol 48: Hombach M, Pfyffer GE, Roos M et al (2010) Detection of methicillin-resistant Staphylococcus aureus (MRSA) in specimens from various body sites: performance characteristics of the BD GeneOhm MRSA assay, the Xpert MRSA assay, and broth-enriched culture in an area with a low prevalence of MRSA infections. J Clin Microbiol 48: Patel PA, Ledeboer NA, Ginocchio CC et al (2011) Performance of the BD GeneOhm MRSA achromopeptidase assay for real-time PCR detection of methicillin-resistant Staphylococcus aureus in nasal specimens. J Clin Microbiol 49: Bartels MD, Boye K, Rhode SM (2009) A common variant of staphylococcal cassette chromosome mec type IVa in isolates from Copenhagen, Denmark, is not detected by the BD GeneOhm methicillin-resistant Staphylococcus aureus assay. J Clin Microbiol 47: Dalpke AH, Hofko M, Zimmermann S (2012) Comparison of the BD MAX methicillinresistant Staphylococcus aureus (MRSA) assay and the BD GeneOhm MRSA Achromopeptidase Assay with direct- and enriched-culture techniques using clinical specimens for detection of MRSA. J Clin Microbiol 50: Peterson LR, Liesenfeld O, Woods CW et al (2010) Multicenter evaluation of the LightCycler methicillin-resistant Staphylococcus aureus (MRSA) advanced test as a rapid method for detection of MRSA in nasal surveillance swabs. J Clin Microbiol 48: Shumoski S. NucliSENS EasyQ MRSA (2011). Improved design and robust performance in a rapid molecular screening assay. BioMerieux Connection Newsletter. September Pages Snyder JW, Munier GK, Heckman SA et al (2009) Failure of the BD GeneOhm StaphSR assay for direct detection of methicillinresistant and methicillin-susceptible Staphylococcus aureus isolates in positive blood cultures collected in the United States. J Clin Microbiol 47: Spencer DH, Sellenriek P, Burnharn CA (2011) Validation and Implementation of the GeneXpert MRSA/SA blood culture assay in a pediatric setting. Am J Clin Pathol 136: Kelley PG, Grabsch EA, Farrell J et al (2011) Evaluation the Xpert MRSA/SA Blood Culture assay for the detection of Staphylococcus aureus including strains with reduced vancomycin susceptibility from blood culture specimens. Diagn Microbiol Infect Dis 70: Parta M, Goebel M, Matloobi M et al (2009) Identification of methicillin-resistant or methicillin- susceptible Staphylococcus aureus in blood cultures and wound swabs by GeneXpert. J Clin Microbiol 47: Food and Drug Administration. Cepheid Xpert MRSA/SA Blood Culture Assay for Use with the GeneXpert Dx System. Class I Recall MedWatch/SafetyInformation/Safety AlertsforHumanMedicalProducts/ucm htm Accessed 20 Oct Nanosphere. Verigene Clinical Microbiology Tests. Verigene gram-positive blood culture. blood-cultures. Accessed 16 Nov 2012

94 Chapter 4 Immunofluorescence Microscopy for the Detection of Surface Antigens in Methicillin-Resistant Staphylococcus aureus (MRSA) Yekaterina Timofeyeva, Ingrid L. Scully, and Annaliesa S. Anderson Abstract Immunofluorescence microscopy is a widely used laboratory method which allows detection and visualization of specific antigens. The method employs the specificity of antibodies to deliver fluorophore to a specific target and then visualize it with a microscope. The power of the technique is that it requires relatively little manipulation and relatively few bacterial cells, enabling the detection of antigen expression where other methods cannot, such as during an actual infection in an animal. Here, we apply the method to follow antigen expression on the surface of MRSA cells over time in in vivo infection models. Key words Immunofluorescence microscopy, Methicillin-resistant Staphylococcus aureus, MRSA, Antigen expression, Bacterial infection 1 Introduction Staphylococcus aureus causes diverse diseases that range from mild skin infections to serious invasive infections, such as sepsis. The frequency of both community- and hospital-associated infections has increased sharply in recent years, which necessitates new strategies to prevent and treat S. aureus infections. There is a major worldwide concern about the rise of methicillin-resistant S. aureus (MRSA), and the epidemiology of infections is rapidly changing. The primary community-acquired MRSA strain USA300, which was first identified in the USA, has now spread to every continent [ 1 ]. A mechanistic understanding of the considerable virulence and efficient host-to-host transmission of MRSA, especially USA300, is extremely important [ 2, 3 ]. S. aureus expresses many potential virulence factors that may serve as targets for both new therapies and vaccine development [ 4 6 ]. The pathogenicity of S. aureus depends upon the coordinated expression of multiple virulence factors [ 7 9 ]. Expression of Yinduo Ji (ed.), Methicillin-Resistant Staphylococcus aureus (MRSA) Protocols, Methods in Molecular Biology, vol. 1085, DOI / _4, Springer Science+Business Media, LLC

95 86 Yekaterina Timofeyeva et al. these virulence factors is highly sensitive to in vivo environmental signals, which are often poorly mimicked by in vitro growth conditions. To survive, the bacteria rapidly respond to changes in the local microenvironment (such as ph, gas tension, osmolarity, temperature, and the availability of nutrients) by regulating extracellular and cell wall virulence determinants [ ]. Analysis of bacterial cell surface antigen expression in vivo is important, as it enables evaluation of the bacteria in a more physiologically relevant environment in the presence of host factors. Therefore in vivo analysis of bacterial antigen expression is critical to assess how S. aureus responds to the host microenvironment. This provides information on both bacterial physiology and putative targets for drug and vaccine design. Immunofluorescence microscopy is a powerful tool that is widely used to assess antigen expression. This methodology is applied here to MRSA isolates in mouse models of infection. The expression of capsular polysaccharide type 5 (CP5) and two surface protein antigens manganese transporter C (MntC) and clumping factor A (ClfA) which are under investigation as vaccine targets is followed over time in two murine models of infection, bacteremia and wound infection. As the expression of S. aureus genes is impacted by changes in the host microenvironment, antigen expression can modulate during the course of a particular disease. The method described below can be modified for assessing expression of different surface antigens under different growth conditions. The quality of the specimen is critical for the outcome of the experiment. Bacteria quickly react to a sudden change in their environment by rapidly expressing or repressing genes, which can lead to changes in antigen expression profiles on the surface of the bacteria. Therefore methods to preserve the antigenic integrity of the sample are also addressed. 2 Materials 2.1 Bacterial Growth 2.2 Sample Preparation 2.3 Immunofluorescence Staining 1. Trypticase soy broth (TSB). 2. Glycerol. 3. CD1 mice 8 12 weeks old (Charles River Laboratories). 1. Phosphate-buffered saline (PBS) (0.15 M NaCl, ph 7.2) (Gibco). 2. Lab-Tek II CC2 Slide, 8 Chamber (Nunc). 1. Phosphate-buffered saline (PBS) wash buffer (see above). 2. Normal goat serum (Sigma). 3. Primary antibody at appropriate dilution in PBS. The appropriate dilution must be empirically defined. Primary antibody concentrations typically range from 1 mcg/ml to 50 mcg/ml.

96 IFA for MRSA Surface Antigen Detection Fluorescein-conjugated secondary antibody at appropriate dilution in PBS. As with the primary antibody, appropriate dilutions must be empirically defined. Typical dilutions of secondary antibody range from 1:1,000 to 1:50,000. Use secondary antibody against the same species as the primary antibody. 5. Anti-fade aqueous mounting medium (Vector Labs). 6. Coverslip mm, # Methods 3.1 Bacterial Growth Conditions 3.2 Mouse Infection Models and Sample Preparation Bacteremia Model 1. Incubate S. aureus isolate in TSB overnight at 37 C with shaking (250 rpm). 2. The following day inoculate fresh TSB with a 1:10 dilution of the overnight culture and incubate at 37 C, 250 rpm until OD 600 reaches Other growth conditions and growth media can also be evaluated for antigen expression ( see Note 1 ). 3. Add glycerol to the culture to final concentration 10 %. Prepare aliquots and store the cells at 80 C. All animal experiments should be performed in accordance with the guidelines of the Institutional Animal Care and Use Committee (IACUC) in the USA, the European Guidelines for animal welfare (2010/63/EU) in the EU or in-country equivalent, and any other regional, national, or local institutional guidelines. 1. Intraperitoneal (IP) challenge female CD1 mice 8 12 weeks old (Charles River Laboratories) with to CFU S. aureus /animal. Exsanguinate 2 animals at the desired timepoints and pool the blood into sodium citrate (ph 7.0) (final concentration, 0.4 %) ( see Note 2 ). 2. Disrupt the eukaryotic cells by sonication. Keep the blood samples on ice, place the probe into the sample, and apply ultrasound (20 khz, 10 s, Branson Sonifier 450, Branson Ultrasonics) ( see Note 3 ). 3. Centrifuge the samples for 10 min at 4,000 g, 4 C ( see Note 4 ). 4. Remove the supernatant. 5. Resuspend the pellet in 1 ml of ice-cold PBS. 6. Apply 120 μl of the sample to each chamber of a cell culture chamber slide; keep slides on ice. Allow the bacteria to settle on a slide for 3 h ( see Note 5 ).

97 88 Yekaterina Timofeyeva et al Wound Infection Model 3.3 In Vitro Cultures 3.4 Immunofluorescence Staining 3.5 Image Acquisition and Analysis A 1-cm incision is made in the right thigh muscle of female CD1 mice (6 8 weeks old, Charles River Laboratories) and then closed with a suture. Five microliters of a S. aureus suspension containing approximately CFU is introduced into the incision. The skin is closed with surgical staples. The mice are euthanized at the desired timepoints, staples removed, wounds opened, and infected areas swabbed. Swab smears are applied to a chamber slide. Slides should be kept on ice ( see Note 6 ). 1. Add 100 μl containing approximately CFU of the frozen bacterial challenge stock to a well of the chamber slide. Keep slides on ice. 2. Add 30 μl of ice-cold normal goat serum. 3. Incubate at 4 C for 3 h; allow the bacteria to settle on a slide. 1. Aspirate either blocking buffer (from the wells with in vitro grown bacteria) or PBS (from the wells with the bacteremia samples). Keep slides on ice ( see Note 7 ). 2. Gently wash cells 1 with ice-cold PBS for 5 min. Keep slides on ice. 3. Prepare primary antibody appropriately diluted in ice-cold PBS. Add 150 μl to a well; incubate cells with primary antibody for 3 h at 4 C ( see Note 8 ). 4. Wash cells 3 with ice-cold PBS for 3 min per wash. 5. Prepare dilution of fluorescein-conjugated secondary antibody; add 150 μl to a well. Incubate cells for 1 h at room temperature in the dark ( see Note 9 ). 6. Wash 3 with PBS for 3 min per wash ( see Note 10 ). 7. Wash 2 with deionized H 2 O. 8. Gently detach the chamber wells from the glass slide using forceps. This must not be done with force or the glass slide will shatter ( see Note 11 ). 9. Blot the edges of the slide on a paper towel to remove excess liquid. 10. Add one drop of aqueous mounting agent to each well ( see Note 12 ). 11. Let stand at room temperature for about 5 min. Affix coverslips to slides avoiding air bubbles. Allow coverslips to dry in the dark before viewing ( see Note 13 ). 12. Store the slides in the dark at 2 8 C. 1. Examine immunostained specimens under a fluorescence microscope. Capture images of a representative field using an appropriate set of filters ( see Note 14 ).

98 IFA for MRSA Surface Antigen Detection It is important to broadly scan all samples before choosing the representative field. Start with positive and negative controls and compare them with the experimental samples. For image acquisition, establish settings using a positive control. The same acquisition settings should be used for all samples as well as the negative control. Never use the autoexpose function, as this will change settings from image to image ( see Note 15 ). 3. In the protocol described above, the importance of preserving the antigenic integrity of the specimen is constantly taken into account. No fixatives are used because inappropriate fixation can cause antigen redistribution and/or a reduction in antigen exposure. Instead, we use chemically coated glass surfaces that provide binding sites optimal for bacterial cells. Bacterial permeabilization is not necessary when using polyclonal antibodies for the detection of polysaccharide capsule or surface proteins. Due to the fact that S. aureus surface antigen expression can be impacted by environmental factors and physical handling (e.g., detergent treatment), any unnecessary manipulation should be avoided. 4. Some examples of immunofluorescence images obtained using the protocols above are shown in Figs. 1 and 2. The MRSA USA300 clinical isolate CDC3 was used for these studies. In Fig. 1, the expression of the capsule polysaccharide CP5, the manganese transporter protein MntC, and the adhesion factor clumping factor A (ClfA) is monitored over time in a bloodstream infection. Bright-field images are provided for comparison to demonstrate the location of bacterial cells in the selected field of view. As can be seen in Fig. 1, the expression of CP5 and MntC antigens is not detected on CDC3 bacteria following propagation in vitro prior to infection (T0). In contrast, the expression of ClfA is detected in the T0 challenge inoculum. After an hour of exposure to the bloodstream microenvironment (T1), the expression of MntC is detected on the bacterial cell surface, while ClfA expression is undetectable. Using these methods, CP5 expression remains undetectable at the T1 timepoint. At 6 h after introduction into the bloodstream, CDC3 bacteria express both CP5 and ClfA on their cell surface, but no longer express MntC. 5. A similar result is shown in Fig. 2, where surface antigen expression was monitored over time in a wound infection. As in Fig. 1, bright-field images are provided for comparison to demonstrate the location of bacterial cells in the field of view represented. The same challenge stock was used for the experiments displayed in Fig. 2, so it is unsurprising that the challenge inoculum (T0) does not express detectable levels of capsule or MntC, but ClfA expression is detectable. After exposure to the wound microenvironment for an hour, the

99 Fig. 1 Surface antigen expression by Staphylococcus aureus USA300 strain CDC3 during bacteremia. Two groups of two mice each were infected by intraperitoneal injection of colony-forming units of the S. aureus clinical isolate CDC3. At 1 h (T1) and 6 h (T6) after infection, one group was euthanized, blood from the animals was pooled, and the bacteria were isolated. Bacteria at the time of challenge (T0) and bacteria isolated from the bloodstream (T1, T6) were stained with affi nity-purifi ed rabbit anti-cp5, anti-clfa, anti-mntc, or control immunoglobulin G and visualized with a confocal microscope. ( a ) Bright-fi eld (BF) images of anti- CP5 smears. ( b ) Fluorescence microscopy images of CP5 expression. ( c ) BF images of anti-clfa smears. ( d ) Fluorescence microscopy images of ClfA expression. ( e ) BF images of anti-mntc smears. ( f ) Fluorescence microscopy images of MntC expression

100 Fig. 2 Surface antigen expression by Staphylococcus aureus USA300 strain CDC3 during wound infection. A surgical wound was created as described in the protocol colony-forming units of the S. aureus USA300 clinical isolate CDC3 were introduced into the wound, which was then closed by surgical clips. At 1 h (T1) and 72 h (T72) after infection, the wound was opened and a sterile swab used to collect bacteria, which was swabbed onto chamber slides one. Bacteria at the time of challenge (T0) and bacteria isolated from the wound (T1, T72) were stained with affi nity-purifi ed rabbit anti-cp5, anti-clfa, anti-mntc, or control immunoglobulin G and visualized with a confocal microscope. ( a ) Bright-fi eld (BF) images of anti-cp5 smears. ( b ) Fluorescence microscopy images of CP5 expression. ( c ) BF images of anti-clfa smears. ( d ) Fluorescence microscopy images of ClfA expression. ( e ) BF images of anti-mntc smears. ( f ) Fluorescence microscopy images of MntC expression

101 92 Yekaterina Timofeyeva et al. bacteria express detectable levels of MntC, but not capsule or ClfA. Both capsule and ClfA are robustly detected on the cell surface after 72 h in the wound microenvironment, but MntC is not detected at this timepoint. The results shown in Figs. 1 and 2 highlight the need to monitor S. aureus surface antigen expression in vivo and over a range of timepoints, due to the ability of S. aureus to rapidly adapt to its surroundings in the host. 3.6 Discussions and Conclusions 1. The pathology of S. aureus infections in humans is heterogeneous. S. aureus can colonize skin and mucosal surfaces without causing overt clinical signs. To cause a productive infection, S. aureus must invade the host, bind to host surfaces, and elude or inactivate the components of the host immune system. S. aureus protect themselves from host immune cell phagocytosis by capsule and biofilm formation. In addition, they compete with the host cells for nutrients such as iron and manganese. Complex and precise regulatory pathways control the surface expression of virulence factors, such as metal ion-scavenging proteins, capsule, and adhesins. 2. In contrast to many other methods, immunofluorescence microscopy enables the analysis of the surface antigen expression of live bacteria exposed to in vivo microenvironments, i.e., in physiologically relevant conditions. It allows for the visualization of antigen expression when other methods fail due to the insufficient amount of cells. In addition, the method doesn t require complete removal of host cell debris, which minimizes manipulation of the bacteria. We were able to show that USA300 strains express capsule in vivo, whereas previous studies stated that these strains don t produce detectable capsule when grown in vitro. We also showed that the timing of protein antigen expression in vivo can be determined using this technique. The information obtained by immunofluorescent microscopy sheds light on the mechanisms of MRSA virulence during active infection in vivo. 3. One of the major S.aureus virulence factors, capsular polysaccharide (CP), protects the bacteria from opsonophagocytosis by the host. In addition, CP may promote bacterial colonization and modulates abscess formation [ 13, 14 ]. In contrast, it has also been reported that loss of capsule expression may lead to S. aureus persistence in a chronically infected host [ 15 ]. It has been reported that USA300 isolates do not express capsule, but this observation has been made on in vitro grown cells [ 16, 17 ]. Our data show that USA300 isolates can express capsule in vivo [ 18 ], but it is unclear if the expression of capsule is related to the hypervirulence of the USA300 clone.

102 IFA for MRSA Surface Antigen Detection Bacterial surface proteins allow pathogens to protect themselves from host attack, attach to surfaces, and gather vital nutrients. The manganese transport protein C (MntC) is expressed very early during the infectious cycle [ 19 ] and enables the bacteria to obtain manganese, vital for metabolic processes and also involved in neutralizing reactive oxygen species generated during host defense. Clumping factor A (ClfA) is one of the microbial surface components recognizing adhesive matrix molecules (MSCRAMMs), which are involved in staphylococci attachment to human extracellular matrix proteins as well as surgical implants. ClfA expression varies depending on strain and type of infection [ 18 ]. The variability of antigen expression by S. aureus, including MRSA isolates, demonstrates the importance of multiantigen vaccine approaches for the prevention of S. aureus disease. 4 Notes 1. Expression of surface-associated proteins varies due to growth phase, cell density, and nutrient availability. The biological function and the regulation of a particular antigen of interest should be considered when selecting culture media and growth conditions. 2. Use ice-cold sodium citrate. Keep blood samples on ice. 3. Red and white blood cells can be disrupted in a few seconds. Make sure the sample is clear after sonication; if not, repeat sonication step until blood cells are disrupted. Wear hearing protection. If possible, locate the sonicator in a soundproof cabinet. Do NOT sonicate in a room containing people not wearing hearing protection. 4. Allow the rotor chamber to reach preset temperature. It s very important to perform centrifugation at 4 C. 5. You can leave the slides at this step at 4 C over night. 6. Slides should be placed on ice after the sample is applied. 7. It s important to aspirate very carefully and not touch the wells with the pipette tips. 8. Initial experiments should be conducted to determine the amount of primary antibody to use. This requires conducting a dilution series with the primary antibody. A concentration of 5 μg/ml is a common amount of primary antibody to use. 9. The ideal amount of secondary antibody to use should be empirically determined by conducting a dilution series. A typical final dilution of secondary antibody is 1:1,000.

103 94 Yekaterina Timofeyeva et al. 10. It s better to use PBS without calcium and magnesium. Both Ca 2+ and Mg 2+ trigger a broad range of cellular actions, including adhesion, and can affect the cell surface antigen expression profile. 11. Make sure slides are at room temperature before removing plastic chamber. Slides are more likely to shatter during chamber removal if cold. 12. Any permanent aqueous mounting medium optimized for preservation of fluorescently stained tissue sections can be used. The choice of the mounting medium depends on the type of microscopic technique to be used. Phase-contrast imaging requires the refractive index of the mounting medium to be different from the refractive index of the specimen. Bright-field imaging requires the refractive indexes to be similar. Large differences in refractive index can lead to dark fringes around the specimen. 13. Be careful to avoid applying an excessive amount of medium. If excessive application occurs, excess medium can be removed by touching the edges of the slide against a paper towel. You can seal the edges of the coverslip with nail polish if you intend to store slides for a long period of time. 14. Review the mounting medium data sheet for specific details on how long you have to wait before you can visualize your specimen. Refractive index of media that harden can change dramatically in time. 15. When imaging bacteria, the resolution is critical and the choice of the objective lens should be done carefully. Take into consideration not only the magnification but also the numerical aperture of the lens. Oil immersion objectives are preferable. Disclosure and Acknowledgements All authors are employees of Pfizer and as such may also own stock in the company. This work was funded by Pfizer. We would like to thank Drs Paul Liberator and Bruce Green, both of Pfizer, for their helpful reviews of this chapter. References 1. Mediavilla JR, Chen L, Mathema B et al (2012) Global epidemiology of communityassociated methicillin resistant Staphylococcus aureus (CA-MRSA). Curr Opin Microbiol 15: Johnson AP (2011) Methicillin-resistant Staphylococcus aureus: the European landscape. J Antimicrob Chemother 66(Suppl 4): iv43 iv48 3. David MZ, Daum RS (2010) Communityassociated methicillin-resistant Staphylococcus aureus : epidemiology and clinical consequences of an emerging epidemic. Clin Microbiol Rev 23:

104 IFA for MRSA Surface Antigen Detection Gould IM, David MZ, Esposito S et al (2012) New insights into methicillin-resistant Staphylococcus aureus (MRSA) pathogenesis, treatment and resistance. Int J Antimicrob Agents 39: Naber CK (2009) Staphylococcus aureus bacteremia: epidemiology, pathophysiology, and management strategies. Clin Infect Dis 48(Suppl 4):S231 S Wilson DN (2009) The A-Z of bacterial translation inhibitors. Crit Rev Biochem Mol Biol 44: Morrison JM, Dunman PM (2011) The modulation of Staphylococcus aureus mrna turnover. Future Microbiol 6: Arsic B, Zhu Y, Heinrichs DE et al (2012) Induction of the Staphylococcal Proteolytic Cascade by Antimicrobial Fatty Acids in Community Acquired Methicillin Resistant Staphylococcus aureus. PLoS One 7(9):e Thurlow LR, Joshi GS, Richardson AR (2012) Virulence strategies of the dominant USA300 lineage of community-associated methicillinresistant Staphylococcus aureus (CA-MRSA). FEMS Immunol Med Microbiol 65: Kohler C, Wolff S, Albrecht D et al (2005) Proteome analyses of Staphylococcus aureus in growing and non-growing cells: a physiological approach. Int J Med Microbiol 295: Reniere ML, Skaar EP (2008) Staphylococcus aureus haem oxygenases are differentially regulated by iron and haem. Mol Microbiol 69: Montgomery CP, Boyle-Vavra S, Roux A et al (2012) CodY deletion enhances in vivo virulence of community-associated methicillinresistant Staphylococcus aureus clone USA300. Infect Immun 80: O Riordan K, Lee JC (2004) Staphylococcus aureus Capsular Polysaccharides. Clin Microbiol Rev 17: Lattar SM, Tuchscherr LP, Caccuri RL et al (2009) Capsule expression and genotypic differences among Staphylococcus aureus isolates from patients with chronic or acute osteomyelitis. Infect Immun 77: Tuchscherr LP, Buzzola FR, Alvarez LP et al (2005) Capsule-negative Staphylococcus aureus induces chronic experimental mastitis in mice. Infect Immun 73: Montgomery CP, Boyle-Vavra S, Adem PV et al (2008) Comparison of virulence in community- associated methicillin-resistant Staphylococcus aureus pulsotypes USA300 and USA400 in a rat model of pneumonia. J Infect Dis 198: Sutter DE, Summers AM, Keys CE et al (2011) Capsular serotype of Staphylococcus aureus in the era of community-acquired MRSA. FEMS Immunol Med Microbiol 63: Nanra JS, Timofeyeva Y, Buitrago SM et al (2009) Heterogeneous in vivo expression of clumping factor A and capsular polysaccharide by Staphylococcus aureus : implications for vaccine design. Vaccine 27: Anderson AS, Scully IL, Timofeyeva Y et al (2012) Staphylococcus aureus manganese transport protein C is a highly conserved cell surface protein that elicits protective immunity against S. aureus and Staphylococcus epidermidis. J Infect Dis 205:

105 Chapter 5 Internal Transcribed Spacer (ITS)-PCR Identification of MRSA Shin-ichi Fujita Abstract Polymerase chain reaction (PCR) analysis of the 16S 23S rrna gene internal transcribed spacer (ITS) followed by microchip gel electrophoresis was useful for identification of staphylococci and for strain delineation of Staphylococcus aureus. In the study presented in this chapter, 74 ITS patterns were demonstrated among 1,188 isolated colonies of S. aureus: 55 patterns for methicillin-susceptible S. aureus (MSSA), 4 patterns for methicillin-resistant S. aureus (MRSA), and 15 patterns for both MSSA and MRSA, highlighting the inability of ITS pattern analysis to differentiate the MSSA and MRSA strains. To overcome this problem, simultaneous PCR amplification of the ITS region and meca gene was applied to isolated colonies of staphylococcus species and positive-testing blood culture bottles. Key words Methicillin-resistant Staphylococcus aureus, 16S 23S rrna gene, Internal transcribed spacer, Microchip gel electrophoresis, Polymerase chain reaction, meca gene 1 Introduction Infections produced by Staphylococcus aureus are often acute and pyogenic and, if left untreated, can spread to surrounding tissue or organs. Therefore, rapid identification of S. aureus, especially methicillin-resistant S. aureus (MRSA), from blood culture bottles is important for the establishment of effective antibiotic therapy. Although several molecular techniques have been reported for the identification of MRSA, it takes 4 8 h to obtain the results [ 1 3 ]. The internal transcribed spacer (ITS) separating the 16S rrna and 23S rrna genes is characterized by a high degree of sequence and length variation at both the genus and species levels [ 4 8 ]. Regarding S. aureus, however, the ITS-polymerase chain reaction (PCR) patterns do not allow discrimination of the methicillinsusceptible S. aureus (MSSA) and MRSA strains [ 7, 9 ]. Fujita et al. have been shown that PCR detection of the meca gene, a methicillinresistant gene, and an rrna gene spacer length polymorphism Yinduo Ji (ed.), Methicillin-Resistant Staphylococcus aureus (MRSA) Protocols, Methods in Molecular Biology, vol. 1085, DOI / _5, Springer Science+Business Media, LLC

106 98 Shin-ichi Fujita from positive-testing blood culture bottles followed by microchip gel electrophoresis (MGE) is useful for rapid identification and delineation of MRSA [ 7 ]. The time course of the PCR- MGE assay for identification of MRSA was about 1 h ( see Note 1 ). 2 Materials 2.1 Preparation of DNA 2.2 Special Equipment McFarland standard (Eiken Chemical, Tokyo, Japan). 2. Achromopeptidase (Sigma, St. Louis, MO): Dissolve at 10 mg/ml in 10 mm NaCl, and store in 50 μl aliquots at 20 C ( see Note 2 ). 3. TE buffer: 10 mm Tris HCl (ph 8.0), 1 mm EDTA (ph 8.0). Autoclave before storage at room temperature. 4. Sodium dodecyl sulfate (SDS) solution: 0.1 % (w/v) SDS. Store at room temperature mg/ml proteinase K solution. Store in 50 μl aliquots at 20 C ( see Note 3 ). 6. Takara Z-Taq DNA polymerase (5 U/μL) Z-Taq PCR buffer containing 30 mm Mg 2+ (supplied with Z-Taq DNA polymerase kit). 8. dntp mixture (2.5 mm of each dntp) (supplied with Z-Taq DNA polymerase kit). 9. DNA size markers: 100 bp (100 ng/μl) and 1,000 bp (100 ng/μl). Dilute each DNA size marker with TE buffer at 1:5, and mix the diluted markers at an equal volume (each 10 ng/μl concentration). Store at 20 C. 10. Primer design for ITS-PCR [ 10 ]: primer IX (100 μm; GGTGAAGTCGTAACAAG) and primer II (100 μm; TGCCAAGGCATCCACC). Store at 20 C. The primer target areas are shown in Fig Primer design for amplification of the meca gene [ 7 ]: forward primer (100 μm; AGAAATGACTGAACGTCCG) and reverse primer (100 μm; GCGATCAATGTTACCG TAG). Store at 20 C. 12. PCR master mix per reaction: 5 μl of 10 Z-Taq PCR buffer, 4 μl of dntp mix, 0.5 μl of Z-Taq polymerase. 1. Thermal cycler. This thermal cycler has a fast ramp speed. 2. Microchip Electrophoresis Analysis System (model SV1210; Hitachi Electronics Engineering, Tokyo, Japan). 3. Dry bath incubator (FastGene ; Nippon Genetics, Tokyo, Japan).

107 ITS-PCR Identification of MRSA 99 Internal transcribed spacer 16S rrna gene 23S rrna gene Primer IX Primer II Fig. 1 Schematic representation of bacterial ribosomal genes containing primer target areas 3 Methods 3.1 Cell Lysis 3.2 DNA Extraction from Positive- Testing Blood Culture Bottle 1. Suspend a colony grown on blood agar plates in 0.2 ml of TE buffer at a density of 0.5 McFarland standard (about 1 to CFU/mL). 2. Add a 5 μl of achromopeptidase solution to the resuspended colony and incubate at 60 C for 5 min. 3. Lyse the cells by adding 3 μl of proteinase K solution and incubating at 60 C for 5 min. 4. Incubate the solution for 7 min in a boiling water bath. 5. Pellet cell debris by centrifuging for 2 min at 10,000 g. 6. Use the supernatant as template DNA for PCR. It can be stored at 20 C. The expected DNA yield is ng/μl. 1. Pour ml of blood culture fluids into a centrifuge tube (10 ml). 2. Add 7 8 ml of 0.1 % SDS solution to the tube. 3. Mix well by inverting the tube several times. 4. Centrifuge the mixture at 4,000 g for 5 min and discard the supernatant. 5. Suspend the pellets in 7 8 ml of TE buffer. 6. Centrifuge the mixture at 4,000 g for 5 min and discard the supernatant. 7. Suspend the pellets in 100 μl of TE buffer, and transfer the solution into a 1.5 ml microtube. 8. Add 5 μl of achromopeptidase solution to the resuspended cells, and incubate at 55 C for 5 min. 9. Lyse the cells by adding 3 μl of proteinase K solution and incubating at 55 C for 5 min. 10. Incubate the solution for 7 min in a boiling water bath. 11. Pellet cell debris by centrifuging for 2 min at 10,000 g. 12. Use the supernatant as template DNA for PCR. It can be stored at 20 C. The expected DNA yield is ng/μl.

108 100 Shin-ichi Fujita Detection point Lane 3 Lane 2 Gel well 2 Gel well 3 1 Sample well 2 Gel well 1 Lane 1 Fig. 2 Microchip (i-chip 3DNA R ) viewed from the top. One i-chip has three lanes. Electrophoresis can be performed three times by switching the lanes. Arrow 1 indicates sample injection channel and arrow 2 separation phoresis channel 3.3 Multiplex PCR 3.4 Microchip Gel Electrophoresis 1. Thaw the master mix and primer solutions on ice. 2. Add 1 μl each of four primers and 2 μl of template DNA to the PCR master mix, and make up to a 50-μL final reaction volume with deionized H 2 O. 3. Program the thermal cycler to denature initially for 10 s at 95 C then for 25 cycles of 8 s at 95 C for denaturation, 10 s at 50 C for annealing, and 15 s at 72 C for primer extension. Set the final extension period for 5 min at 72 C. 1. Mix 100 μl of electrophoresis gel and 1 μl of fluorescent dye solution. 2. Take 10 μl of electrophoresis gel containing fluorescent dye and add to gel well 1 of the i-chip. A scheme of the i-chip viewed from the top is shown in Fig. 2 ( see Note 4 ). 3. Cover gel well 1 with air from the attached syringe. 4. Push the syringe slowly until the electrophoresis gel reaches each well from the separation phoresis channel. 5. Take 10 μl of electrophoresis gel and add to gel wells 2 and Mix 10 μl of distilled water, 0.4 μl of PCR sample, and 0.4 μl of size markers in a sample well Run the electrophoresis at 300 V for 1 min (injection time), then at 565 V for 4 min (separation time). The i-chip temperature is 30 C. The analyzing software starts at the completion of electrophoresis, and the measured waveform is automatically analyzed. The results displayed are base size, emission intensity, concentration, and tone ( see Notes 5 7 ). Examples of results are shown in Figs. 3 and 4.

109 ITS-PCR Identification of MRSA 101 Fig. 3 Representative ITS-PCR patterns (ITSP) of MRSA strains. Asterisks indicate DNA size markers 100 bp ( left ) and 1,000 bp ( right ). Int intensity Fig. 4 Microchip gel electrophoresis of amplifi ed DNA fragments obtained by multiplex PCR for the meca gene and the internal transcribed spacer region. Asterisks indicate DNA size markers 100 bp ( left ) and 1,000 bp ( right ). Int intensity

110 102 Shin-ichi Fujita 4 Notes 1. It takes min to extract DNA from isolated colonies or positive-testing blood culture bottles. The PCR procedure requires about 30 min, and microchip gel electrophoresis (MGE) takes 5 min. Therefore, the overall turnaround time of the PCR-MGE assay is ~1.5 h. 2. Achromopeptidase solution can be kept for several months at 20 C. 3. Proteinase K solution can be kept for several months at 20 C. 4. Take out the electrophoresis gel from the refrigerator and leave it at room temperature for more than 10 min. The mixture of electrophoresis gel and fluorescent dye should be used within 7 days. 5. It is important to ensure that the PCR product (151 bp) of the meca gene is well separated from both amplified products of ITS and the DNA size markers. 6. Electrophoretic analysis of the amplified products consistently shows one to seven intense, sharp fragments for each sample, ranging from 233 to 845 bp. 7. The fragments with intensities of <10 % of the peak intensity should not be taken into account for analysis. References 1. Levi K, Towner KJ (2003) Detection of methicillin- resistant Staphylococcus aureus (MRSA) in blood with the EVIGENE MRSA kit. J Clin Microbiol 41: Maes N, Magdalena J, Rotiers S et al (2002) Evaluation of a triplex PCR assay to discriminate Staphylococcus aureus from coagulasenegative staphylococci and determine methicillin resistance from blood cultures. J Clin Microbiol 40: Mason WJ, Blevins JS, Beenken K et al (2001) Multiplex PCR protocol for the diagnosis of staphylococcal infection. J Clin Microbiol 39: Jensen MA, Webster A, Straus N (1993) Rapid identification of bacteria on the basis of polymerase chain reaction-amplified ribosomal DNA spacer polymorphisms. Appl Environ Microbiol 59: Gürtler V, Barrie HD (1995) Typing of Staphylococcus aureus by PCR-amplification of variable-length 16S-23S rdna spacer regions: characterization of spacer sequences. Microbiology 141: Mendoza M, Meugnier H, Bes M et al (1998) Identification of Staphylococcus species by 16S- 23S rdna intergenic spacer PCR analysis. Int J Syst Bacterio 48: Fujita S, Senda Y, Iwagami T et al (2005) Rapid identification of staphylococcal strains from positive-testing blood culture bottles by internal transcribed pacer PCR followed by microchip gel electrophoresis. J Clin Microbiol 43: Fujita S, Yoshizaki K, Ogushi T et al (2011) Rapid identification of Gram-negative bacteria with and without CTX-M extended-spectrum β-lactamase from positive blood culture bottles by PCR followed by microchip gel electrophoresis. J Clin Microbiol 49: Dolzani L, Tonin E, Lagatolla C et al (1994) Typing of Staphylococcus aureus by amplification of the 16S-23S rrna intergenic spacer sequences. FEMS Microbiol Lett 119: Saruta K, Matsunaga T, Kono M et al (1997) Rapid identification and typing of Staphylococcus aureus by nested PCR amplified ribosomal DNA spacer region. FEMS Microbiol Lett 146:

111 Chapter 6 Pulsed-Field Gel Electrophoresis Typing of Staphylococcus aureus Isolates Yiping He, Yanping Xie, and Sue Reed Abstract Pulsed-field gel electrophoresis (PFGE) is the most applied and effective genetic typing method for epidemiological studies and investigation of foodborne outbreaks caused by different pathogens, including Staphylococcus aureus. The technique relies on analysis of large DNA fragments generated by the cleavage of intact bacterial chromosomes with a rare cutting restriction enzyme, subsequently resolved by pulsedfield electrophoresis with periodic changes of the orientation of the electrical field across the gel. The high discriminatory power, improved reproducibility due to standardization of experimental protocols and data interpretation guidelines, and establishment of a national PFGE database of S. aureus profiles have made it a valuable means for global tracking of S. aureus infection sources and determination of genetic relatedness of outbreak isolates. Key words Pulsed-field gel electrophoresis, Typing, Staphylococcus aureus 1 Introduction Staphylococcus aureus is one of the most important pathogens associated with hospital- and community-acquired infections. Methicillin-resistant S. aureus (MRSA) strains are resistant to beta- lactam antibiotics, which can cause serious human illness, including life-threatening infection. In past years, the prevalence of MRSA has increased and become a serious public health problem worldwide perhaps due to the overuse of antibiotics [ 1, 2 ]. The ability to rapidly differentiate and type MRSA isolates from clinical or environmental samples can prevent substantial illness and economic costs arising from MRSA transmission and subsequent infections. Moreover, having an accurate typing method for MRSA infection is also crucial for understanding the epidemiological evolution of MRSA strains as well as for the investigation of MRSA outbreaks. A number of molecular techniques have been developed and used with varying success in the genotyping of S. aureus strains and Yinduo Ji (ed.), Methicillin-Resistant Staphylococcus aureus (MRSA) Protocols, Methods in Molecular Biology, vol. 1085, DOI / _6, Springer Science+Business Media, LLC

112 104 Yiping He et al. prediction of the relatedness of MRSA isolates. These include plasmid profile analysis, restriction fragment length polymorphism (RFLP), RFLP-Southern blot, random amplified polymorphic DNA (RAPD), pulsed-field gel electrophoresis (PFGE), surface protein A (spa) typing, multilocus sequence typing (MLST), and whole-genome DNA sequence typing (WGST) [ 3 6 ]. Among these DNA-based methods, PFGE has been considered the gold standard for genotyping S. aureus and other pathogenic bacteria because of its performance (discriminatory power and reproducibility) and practice (ease of execution and data interpretation, cost, and availability) [ 7 ]. Over the past few years, experimental protocols and pattern interpretation of PFGE have been standardized. Because of this, the Centers for Disease Control and Prevention (CDC) has established a molecular subtyping network (PulseNet) for foodborne disease surveillance and assembled a national database of S. aureus PFGE profiles for investigation of MRSA outbreaks and global tracking of MRSA strain types [ 8 10 ]. The PFGE technique, developed by Schwarz et al. [ 11 ], is based on the digestion of bacterial genomic DNA using a restriction endonuclease that recognizes few digestion sites in the chromosome, generating large DNA fragments that can be effectively separated using pulsed-field gel electrophoresis by periodically shifting the orientation of the electrical field (Fig. 1 ). Streak for single colonies of S. aureus isolates Preparation of cell suspension Preparation of agarose plugs containing cell suspension Restriction digestion of DNA trapped in agarose plugs Washing of agarose plugs Lysis of cells in agarose plug Pulsed-field gel electrophoresis of digested DNA PFGE gel image capture PFGE data analysis Fig. 1 Main procedural steps for PFGE subtyping of S. aureus isolates

113 Pulsed-Field Gel Electrophoresis Typing of Staphylococcus aureus Isolates 105 Briefly, PFGE requires isolating intact chromosomal DNA by lysing bacterial cells embedded in low-melting agarose plugs to avoid mechanical shearing of DNA molecules during the extraction process [ 12 ]. Remaining in the soft agarose, the isolated chromosomal DNA is digested by a rare cutting restriction endonuclease selected to produce 12 high-molecular-weight DNA fragments. The digested DNA ( kb) in the agarose plugs is then subjected to separation by pulsed-field gel electrophoresis. Effective separation of these large restriction fragments requires the use of pulsed fields of electrical current from 24 electrodes spaced in a hexagonal contour that alternate direction at a 120º fixed angle over a relatively long electrophoresis time. During electrophoresis, DNA molecules migrate to the anode in a sizedependent manner. Constant change of the direction of the electrical current makes DNA fragments correspondingly reorient toward the new electrical direction. The time required for reorientation is also inversely proportional to the size of DNA fragment. In this way, good resolution of large DNA fragments is achieved [ 11, 13 ]. For data analysis, Tenover et al. [ 14 ] developed criteria to interpret PFGE patterns, which have been widely used for molecular subtyping and outbreak investigation of various pathogenic bacteria. BioNumerics software allows PFGE images to be normalized and patterns to be compared within and between laboratories with high reproducibility [ 15 ]. 2 Materials 2.1 Growth and Preparation of Cultures 2.2 Preparation of Agarose Plugs 1. S. aureus NCTC 8325 as a control strain ( see Note 1 ). 2. Trypticase soy agar plates containing 5 % sheep blood (Becton Dickinson, Sparks, MD) C shaking incubator. 4. Brain-heart infusion (BHI) broth. 5. Turbidity meter or spectrophotometer for preparation of cell suspensions. 6. Microcentrifuge to pellet cell suspensions C stationary water bath or heating block to temper agarose. 2. SeaKem Gold agarose (Cambrex BioScience Rockland, Inc. Rockland, ME). 3. TE buffer: 10 mm Tris HCl, 1 mm EDTA (ph 8.0). Autoclave in glass screw cap bottles and store at room temperature for up to 6 months. 4. PFGE plug mold (Bio-Rad, Hercules, CA).

114 106 Yiping He et al. 5. Lysostaphin enzyme (Sigma, St. Louis, MO). Prepare a 1 mg/ ml suspension in 20 mm sodium acetate (ph 4.5), aliquot, and freeze at 20 C for up to 6 months. 6. Stainless steel spatulas. 2.3 Plug Lysis 2.4 Plug Washing 2.5 Restriction Enzyme Digestion 2.6 Preparing and Running the Gel 2.7 Staining and Documentation 2.8 Data Analysis C and 55 C stationary water bath. 2. EC lysis buffer: 6 mm Tris HCl, 1.0 M NaCl, 0.1 M EDTA, 0.5 % Brij-58, 0.2 % sodium deoxycholate, 0.5 % sodium lauroylsarcosine (ph 7.5). Autoclave in glass screw cap bottles and store at room temperature for up to 6 months. 3. Tubes to hold plug and buffer. 1. TE buffer. 2. Spatula or equivalent to hold plug in tube. 3. Rocker, rotator, or equivalent. 1. Restriction endonuclease Sma I (Promega, Madison, WI) with packaged 10 restriction buffer and 100 bovine serum albumin (BSA). 2. Ice or 20 C insulated box. 3. Sterile tubes for preparing water-buffer and water-bufferenzyme mixtures. 4. Microcentrifuge tubes. 5. Cutting dish (sterile disposable Petri dish or equivalent). 6. Scalpel or razor blade for cutting agarose plugs TBE buffer. 2. Sterile distilled water, pre-warmed to 55 C. 3. SeaKem Gold agarose (Cambrex BioScience Rockland, Inc.). 4. Gel-casting platform and accessories. 5. Gel leveling bubble or equivalent % SeaKem Gold agarose (for sealing wells). 7. CHEF system (Bio-Rad) for running pulsed-field gels. 8. Spatula. 1. Ethidium bromide solution, 10 mg/ml (Sigma or equivalent). 2. Covered glass dish for staining gels. 3. Distilled water. 4. Gel Doc 2000 (Bio-Rad) or equivalent gel documentation apparatus. BioNumerics software version 4.0 (Applied Maths, Belgium).

115 Pulsed-Field Gel Electrophoresis Typing of Staphylococcus aureus Isolates Methods 3.1 Growth and Preparation of Cultures 3.2 Prepare Agarose Plugs 3.3 Plug Lysis 3.4 Plug Washing 1. Streak S. aureus isolates onto trypticase soy agar plates containing 5 % sheep blood to produce isolated bacterial colonies. 2. Inoculate one colony from each test and control culture into tubes containing 5 ml BHI. 3. Vortex and then incubate tubes with shaking at C for h. 4. Prepare cell suspensions by measuring either turbidity or absorbance at 610 nm. Use sterile BHI to adjust cell turbidity to or absorbance to at 610 nm reading ( see Note 2 ). 5. Transfer 200 μl of the cell suspensions to microcentrifuge tubes and pellet by centrifugation at 8,600 g for 3 4 min. 6. Aspirate all supernatant, resuspend cell pellets in 300 μl TE buffer, and equilibrate at 37 C. 1. Prepare plugs by weighing 1.8 g SeaKem Gold agarose into a 250 ml screw cap flask containing 100 ml 1 TE buffer. Mix gently, remove the screw cap, and dissolve agarose in a microwave until the solution becomes clear. Swirl the agarose solution gently in the middle and at the end of heating. Replace any fluid lost with pre-warmed reagent-grade water and mix thoroughly. Recap flask and place in 55 C water bath to equilibrate for 30 min. 2. Label wells of plug mold. To the tempered cell suspensions add 3 or 4 μl lysostaphin stock solution (1 mg/ml in 20 mm sodium acetate, ph 4.5) and mix gently but quickly to avoid shearing DNA and generating bubbles (use 3 μl recombinant or 4 μl conventional lysostaphin per tube) ( see Note 3 ). 3. Add 300 μl agarose (equilibrated to 55 C) to the cell suspension, gently mix, and dispense mixture into well(s) of plug mold. At least two plugs per test culture are recommended. 4. Allow plugs to solidify at room temperature for min or in the refrigerator (4 C) for 5 min. 1. Carefully remove plugs from mold using a spatula and place in labeled tubes. 2. Add at least 3 ml EC lysis buffer, making sure the plug is fully immersed. 3. Incubate in a 37 C water bath for at least 4 h to lyse cells. 1. Carefully pour off or aspirate the EC lysis buffer. 2. Add at least 4 ml TE buffer to the tubes and place on a rocker or rotator at 60 rpm for 30 min.

116 108 Yiping He et al. 3. Repeat steps 1 and 2 at least three more times to remove excess reagents and cell debris from the lysed plugs ( see Note 4 ). 4. After final wash, add 4 ml of TE buffer to the tubes and store refrigerated until all reagents are prepared for the enzyme digestion. 3.5 SmaI Restriction Enzyme Digestion 3.6 Preparing and Running the Gel 1. Make 1:10 dilution of 10 restriction buffer in sterile reagentgrade water. Add 200 μl of 1 buffer to each of the labeled microcentrifuge tubes. 2. Remove the lysed plug from storage tube and place in cutting dish. 3. Using a scalpel or razor blade to cut the plug into the desired size (2 5 mm for tooth comb or 2 10 mm for tooth comb) ( see Note 5 ). 4. Transfer the slice to a labeled microcentrifuge tube containing 1 restriction buffer and equilibrate at room temperature for min. 5. After the plug slices have equilibrated, aspirate the buffer. 6. Add 200 μl freshly prepared enzyme-buffer mixture to each tube. The final concentration of Sma I is 30 U/tube. The enzyme-buffer mixture is prepared by adding 3 μl of Sma I (10 U/μl) to 197 μl of 1 buffer. For a total number of N samples (test cultures plus 3 5 standards from control strain) to be digested and run on the gel, 200 N μl of the enzymebuffer mixture needs to be prepared. 7. Incubate at 25 C for at least 3 h to allow complete endonuclease digestion. During this time, prepare reagents and equipment for running the gel. 1. Prepare 0.5 TBE running buffer from 10 TBE stock. 2. Prepare a 1 % agarose gel by mixing 1.5 g of SeaKem Gold agarose with 150 ml of 0.5 TBE buffer. Microwave to dissolve the agarose. Swirl the flask gently to make sure that the agarose is completely dissolved. Cap and place the flask in a 55 C water bath for15 20 min to equilibrate. 3. Pour ca. 2,200 ml running buffer (0.5 TBE) into a gel box. Set cooling module at a temperature of 14 C. Turn pump on and set at a flow rate of 1 l/min ( see Note 6 ). 4. Assemble the gel-casting platform on a level surface. Use a gel leveling bubble to confirm. On the comb holder, adjust the height of comb 2 mm above the surface of platform. 5. Place the comb holder and attach comb on a flat work surface with the comb side closest to the work area. 6. Place the plug slices on the end of each comb tooth using a spatula. Carefully load the comb and holder into the gel form.

117 Pulsed-Field Gel Electrophoresis Typing of Staphylococcus aureus Isolates Carefully pour equilibrated agarose into the gel-casting platform. Allow gel to solidify for min. Remove comb by gently lifting straight up. If desired, remelt and equilibrate 1.8 % SeaKem agarose leftover from plug preparation to seal the plugs into the gel. 8. Remove gel from casting platform, wiping excess agarose from the bottom and sides with a tissue. Place gel in electrophoresis chamber and close cover. Make sure that the 0.5 TBE buffer covers to a height of ~2 mm above the gel. 9. Set the instrument parameters (for CHEF DRII, DRIII, and CHEF Mapper) as follows: volts = 200 (6 v/cm), temp = 14 C, initial switch = 5 s, final switch = 40 s, and time = 21 h for SeaKem Gold agarose. Start the run. 3.7 Gel Staining and Image Capture 3.8 Data Analysis 1. After the electrophoresis is complete, turn off the power on the equipment, remove gel from chamber into a glass dish, add ethidium bromide solution (use 50 μl of 10 mg/ml stock in 500 ml distilled water), cover, and stain for min with gentle shaking ( see Note 7 ). 2. Destain the gel in fresh distilled water for min with shaking. 3. Place the destained gel on a UV box and capture image using a Gel Doc 2000 (Bio-Rad) or equivalent. Save the image as an xxx.tif file for PFGE pattern and cluster analysis. 1. Open BioNumerics Software (Applied Maths) and import the xxx.tif image file by clicking on Add new experiment file. 2. Process a TIFF image using the software through the following four steps: convert a TIFF to gel strips, define curves, normalize the gel, and find gel bands. 3. For cluster analysis, select the isolates to be compared and then click the Calculate Cluster Analysis. In the fingerprinting comparison settings, select Dice as similarity coefficient and the unweighted pair group method using arithmetic averages (UPGMA) as a dendrogram type. Band position tolerance and optimization are set at 1.25 and 0.5 %, respectively. Figure 2 is an example of PFGE image and cluster analysis of S. aureus clinical isolates from China [ 16 ]. 4 Notes 1. In each run, S. aureus NCTC 8325 should be included as a reference standard for data normalization. The standard should be loaded in every fifth or seventh lane of the gel depending on the number of wells per gel.

118 110 Yiping He et al. Fig. 2 PFGE gel image of Sma I-digested chromosomal DNA of S. aureus clinical isolates from China. A dendrogram based on percentage of genetic relatedness of the S. aureus isolates is shown. A similarity coeffi cient of 80 % was selected to defi ne the pulsed-fi eld-type (PFT) clusters 2. It is necessary to adjust cell turbidity or absorbance to a uniform concentration in the preparation of cell suspension. The volume of cell suspension used for preparing a plug depends on the concentration of cells.

119 Pulsed-Field Gel Electrophoresis Typing of Staphylococcus aureus Isolates It is important to isolate intact chromosomal DNA and minimize mechanical shearing of the DNA. 4. After lysis of bacterial cells, the plugs should be washed thoroughly to avoid uncompleted restriction enzyme digestion. 5. To analyze consistent amount of DNA, the plugs subjected to Sma I digestion and loaded on the gel should be cut into the same size. 6. It is recommended to prechill the 0.5 TBE buffer. During the electrophoresis, the running buffer should completely cover the gel. 7. Ethidium bromide, a potent mutagen, should be handled carefully during gel staining and image capturing and disposed appropriately afterwards. References 1. Jarvis WR, Jarvis AA, Chinn RY (2012) National prevalence of methicillin-resistant Staphylococcus aureus in inpatients at United States health care facilities. Am J Infect Control 40: Stemper ME, Shukla SK, Reed KD (2004) Emergence and spread of communityassociated methicillin-resistant Staphylococcus aureus in rural Wisconsin, J Clin Microbiol 42: Trindade PA, McCulloch JA, Oliveira GA et al (2003) Molecular techniques for MRSA typing: current issues and perspectives. Braz J Infect Dis 7: Enright MC, Day N, Davies CE et al (2000) Multilocus sequence typing for characterization of methicillin-resistant and methicillinsusceptible clones of Staphylococcus aureus. J Clin Microbiol 38: Koreen L, Ramaswamy SV, Graviss EA et al (2004) spa typing method for discriminating among Staphylococcus aureus isolates: implications for use of a single marker to detect genetic micro- and macrovariation. J Clin Microbiol 42: Mwangi MM, Wu SW, Zhou YJ et al (2007) Tracking the in vivo evolution of multidrug resistance in Staphylococcus aureus by wholegenome sequencing. Proc Natl Acad Sci 104: Bannerman TL, Hancock GA, Tenover FC et al (1995) Pulsed-field gel electrophoresis as a replacement for bacteriophage typing of Staphylococcus aureus. J Clin Microbiol 33: McDougal LK, Steward CD, Killgore GE et al (2003) Pulsed-field gel electrophoresis typing of oxacillin resistant Staphylococcus aureus isolates from the United States: establishing a national database. J Clin Microbiol 41: Goering RV, Winters MA (1992) Rapid method for the epidemiological evaluation of gram-positive cocci by field inversion gel electrophoresis. J Clin Microbiol 30: Swaminathan B, Barrett TJ, Hunter SB et al (2001) PulseNet: the molecular subtyping network for foodborne bacterial disease surveillance, United States. Emerg Infect Dis 7: Schwartz DC, Cantor CR (1984) Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresis. Cell 37: Matushek MG, Bonten MJ, Hayden MK (1996) Rapid preparation of bacterial DNA for pulsed-field gel electrophoresis. J Clin Microbiol 10: Reed KD, Stemper ME, Shukla SK (2007) Pulsed-Field Gel Electrophoresis of MRSA, Methicillin-Resistant Staphylococcus aureus (MRSA). Protocols 391: Tenover FC, Arbeit RD, Goering RV et al (1995) Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 33: Applied Maths (2000) BioNumerics software v 2.5 Manual: the integral study of biological relationships. Applied Maths, Belgium. www. applied-maths.com 16. Xie Y, He Y, Gehring AG et al (2011) Genotypes and enterotoxin gene profiles of Staphylococcus aureus clinical isolates from China. PLoS One 6:e28276

120 Chapter 7 Multilocus Sequence Typing (MLST) of Staphylococcus aureus Nicholas A. Saunders and Anne Holmes Abstract MLST is a widely accepted method of sequence-based typing that relies on analysis of relatively conserved genes that encode essential proteins. For Staphylococcus aureus the level of discrimination provided by MLST is sufficient to provide a relatively detailed picture of the global dissemination of the pathogen. The method is not restrictive in the precise methodology used to acquire the sequences, but the method of assigning types requires that the data be of high quality. Excellent web-based tools have been developed and are curated by the groups that launched MLST. These tools have allowed the scheme to be maintained as a coherent global asset and assist users in the analysis of their data. Key words Staphylococcus aureus, Multilocus sequence typing, MLST, PCR, Sequencing, Epidemiology, eburst 1 Introduction Multilocus sequence typing (MLST) is a nucleotide sequencebased method for characterizing, subtyping, and classifying members of bacterial populations [ 1, 2 ]. It is a modification of multilocus enzyme electrophoresis (MLEE) where instead of comparing the electrophoretic mobilities of housekeeping enzymes, allelic variation is determined by sequencing internal fragments of the encoding genes. Housekeeping genes are used as they are essential to cell function so are present in every organism, and sequence variations evolve slowly and are likely to be selectively neutral. An MLST scheme was developed and validated for Staphylococcus aureus in 2000 [ 1 ]. It involves PCR amplification and sequencing of internal fragments (~450 bp) of seven housekeeping genes ( arcc, carbamate kinase; aroe, shikimate dehydrogenase; glp, glycerol kinase; gmk, guanylate kinase; pta, phosphate acetyltransferase; tpi, triosephosphate isomerase; and yqil, acetyl coenzyme A acetyltransferase), which were selected as they provided the greatest number of alleles out of the 14 genes investigated and enabled Yinduo Ji (ed.), Methicillin-Resistant Staphylococcus aureus (MRSA) Protocols, Methods in Molecular Biology, vol. 1085, DOI / _7, Springer Science+Business Media, LLC

121 114 Nicholas A. Saunders and Anne Holmes adequate resolution to characterize the genetic diversity of the S. aureus population. For each of the loci, different sequences are assigned arbitrary allele numbers and the seven assigned numbers form the allelic profile, or the sequence type (ST). Sequences with a single nucleotide difference are considered distinct, and no weighting is applied to reflect the number of nucleotide differences between alleles. The Staphylococcus aureus MLST database currently has over 2,500 multilocus DNA sequence types (STs) enriched with metadata over traits such as antibiotic resistance and country of origin of the isolates. A major strength of MLST is that the unambiguous, portable data generated can easily be compared between laboratories. With the help of a web-based database [ 3 ], the technique has been extremely useful for global epidemiology and, in conjunction with SCC mec typing [ 4, 5 ], has provided a common international nomenclature for S. aureus strains. Furthermore, the method has been invaluable for providing insights into the origin and evolution of S. aureus [ 6 14 ]. 1.1 Analysis of MLST Data When MLST has been completed, the result is a sequence type (i.e., ST36) that is underlain by the allelic profile for the seven loci (i.e., 2, 2, 2, 2, 3, 3, 2 for ST36). Although this is clearly useful for typing, relationships between different sequence types are not immediately apparent from these notations. Useful information about the relationships between sequence types is nevertheless clearly available within the MLST data. Consequently, methods have been developed to process the raw data so that underlying relationships between strains are conveniently displayed. Various methods have been exploited for the purpose of showing relationships between STs and all have legitimate arguments in their favor. One approach is to use all of the sequence data, and the simplest implementation of this method is to give equal weight to each nucleotide difference. The allele sequences for all seven loci of each strain are first compiled in series. The option to retrieve the concatenated sequences for given types is available on the MLST website [ 3 ]. The resulting concatemers are compared pairwise using a suitable sequence analysis tool to count the number of nucleotide differences between the pairs. These, pairwise genetic distances, which may be corrected to take account of factors such as the expected rate of double mutations, are then used to construct phylogenetic trees that show the relationships between strains [ 15 ]. Alternative methods of using sequence data to estimate the phylogenetic relationships between strains exist, for example, those based on maximum parsimony [ 15 ]. The main advantage of the sequence comparison approach is that it would still show a close relationship between two strains that differed by just three nucleotides even when each change occurred at a different locus (i.e., triple-locus variants or TLVs). The main disadvantage of the sequence concatenation approach

122 MLST 115 for analysis of MLST data is that it does not take account of recombination events. The homologous recombination events known to shuffle MLST loci between strains in S. aureus might be expected to cause the relationships estimated using concatenated sequences to be inaccurate [ 16 ]. For example, a single recombination that replaced an allele with another that had multiple nucleotide differences would change the topology of the phylogenetic tree and prevent detection of the close relationship between the two strains. In order to avoid this, artifact analysis methods that only take account of the number of alleles shared have been developed [ 16 ]. One approach available through the MLST website [ 3 ] is to select STs that have a minimum degree of similarity in their allelic profiles to a query strain. A dendrogram (tree) based on the pairwise differences between profiles is then drawn. However, it can be argued that trees are a poor representation of the way in which bacterial lineages emerge and diversify. In the BURST method [ 16 ] relationships are presented in a way which is arguably more appropriate. The method assumes that selection of strains proceeds to the emergence of a genotype that is present within the population at relative high frequency. This strain is termed a founding type and might achieve relative dominance due to, for example, the acquisition of improved colonization potential or antibiotic resistance. Once established the founding type will diversify over time due to the accumulation of mutations and by the occurrence of recombination events. BURST diagrams attempt to represent founding types and their progeny as shown in Fig. 1. A simple alternative to these methods is available on the PubMLST website ( which constructs minimum spanning trees using the allele numbers as shown in Fig. 3. However, although this method also avoids the problems presented by recombination events, the networks generated are relatively unhelpful and may be misleading [ 17 ]. The large size of the MLST database increases the computational power needed for rapid analyses of large databases and sets of query sequences. Cheng and colleagues [ 18 ] have developed a computationally efficient Bayesian model-based method for semi- supervised classification of MLST data that allows users to automatically analyze the relation of sets of new bacterial isolates to existing curated sequences. The database is used as a training set and new sequences are each either assigned to an existing lineage or allowed to form a previously undiscovered, genetically distinct, group. An estimation of the uncertainty associated with the formation of each group is given. The authors plan to integrate a search facility for placing sequence types into BAPS groups based on the current S. aureus MLST database at the website [ 3 ]. 1.2 The Need for Accuracy and Quality Control The need for very high standards of accuracy in sequencing for MLST has been illustrated by a study from Day and colleagues [ 19 ]. This group studied the link between virulence and ecological

123 116 Nicholas A. Saunders and Anne Holmes Fig. 1 A BURST diagram for 39 STs. In this representation the primary founder ST30 ( black ) has 28 SLVs, 5 DLVs, and 4 TLVs. ST39, ST36, and ST34 are subgroup founders ( grey ). This group was found in an analysis of all STs. Six identical loci were the minimum number required to defi ne a group abundance of S. aureus by genotyping (MLST) strains from nasal carriage and episodes of severe disease within a defined population. The data appeared to show that the most frequently carried genotypes were disproportionately common as causes of disease. In addition recombination appeared to be a more frequent cause of the diversification of clonal complexes than mutation. However, in a later retraction that was possible due to careful work by the same authors [ 20 ], it was reported that the apparent virulent subgroup of the earlier report was the result of sequencing errors involving approximately 0.1 % of nucleotides. Unfortunately, errors had occurred disproportionately within the nasal carriage strains leading to the unsupported conclusion. The reanalysis also showed that mutation was a more common cause of the observed variation within clonal complexes. Clearly, a relatively low rate of sequencing error can be amplified by the process of allele and sequence-type assignment. For this reason only sequencing chromatograms of good quality are acceptable for MLST. 1.3 Worldwide Coordination of the S. Aureus MLST Scheme The value of the S. aureus MLST scheme is greatly enhanced by the creation and maintenance of a website ( net/) that provides a central point for the rapid designation of new alleles and sequence types [ 3 ]. The website also collects MLST and

124 MLST 117 additional relevant data (including clinical and drug-resistance data) on strains isolated worldwide. The site is hosted at Imperial College and development is funded by the Wellcome Trust. The S. aureus site is one of a growing number of species-specific sites accessed through the [ 3 ]. The species- specific sites use a common set of tools and procedures to facilitate access to and control of the databases. In order to ensure the quality of the data, the databases are curated manually. The curator assigns new allele numbers and maintains the allele database. When a potential new allele is identified, the user is prompted to check the sequencing plot at nucleotide sites that differ from the most similar alleles in the database. This is facilitated by use of the Jalview [ 3 ] alignment editor and tools provided on the website. After checking by the user, the sequence traces are submitted to the curator for a final quality check, before the new allele is numbered and included in the allele database. Sequence-type designation of a strain proceeds when all seven alleles have been identified. The allelic profile can be checked against the database using a query tool to determine whether it is identical or similar to that of any strains already in the database. New ST numbers are assigned by the curator. 1.4 MLST Direct from Specimens 1.5 Resequencing Arrays for MLST A logical development of MLST is to modify the MLST PCRs by making them nested or hemi-nested. As expected this increases the sensitivity of the PCRs so that sufficient sequencing template can be obtained by direct amplification of bacterial DNA within either clinical or environmental specimens. Thus, it becomes unnecessary to culture the bacterium and extract DNA. Modifications of the Streptococcus pneumoniae [ 21 ] and Neisseria meningitidis [ 22 ] schemes have been described that are applicable to direct typing of these organisms in cerebrospinal fluid. It is likely that equivalent modifications to the S. aureus MLST protocol would allow typing direct from swabs or clinical samples. However, the circumstances in which this would be required appear to be rather limited. MLST has many advantages but one of the main barriers to acceptance has been that it is necessary to obtain good quality sequence data on all seven alleles so that each ST equates to 14 sequence reads. In many laboratories this is an expensive and time- consuming process. Against this it can now be reasonably argued that sequencing is a largely automated process and that the material costs have been greatly reduced by the introduction of a new generation of parsimonious capillary sequencers. However, arrays for resequencing the seven alleles have nevertheless been developed [ 23 ]. The array developed by van Leeuwen and colleagues [ 23 ] uses the Affymetrix platform. Each nucleotide position is interrogated using four oligonucleotide probes that are identical except for the central nucleotide. One probe in each set of four matches a sequence

125 118 Nicholas A. Saunders and Anne Holmes in at least one MLST allele with the other three mismatching at the central base. For S. aureus MLST [ 23 ] only four probes are used for each position rather than the five (includes a base deletion probe) usual for resequencing. This is reasonable because singlebase deletions have not been reported in these essential genes. When the fluorescently labelled target sequence is bound to the four probes, the perfectly matched probe is expected to give the strongest hybridization signal. The van Leeuwen and colleagues study [ 23 ] reported encouraging levels of base call accuracy ranging from 98.7 to 99.6 % for different centers and strain groups using the best available target-labelling protocol. Further improvement in accuracy will be required to meet the exacting standards needed for MLST. A clear advantage of using the array is that the seven genes may be amplified in a single multiplex PCR rather than the seven reactions advised for the standard sequencing method. Obtaining MLST data by using resequencing array devices is considerably more expensive than using alternative methods. The arrays were developed on the basis that they may become cost effective as the price of array fabrication fell. However, other developments in array technology have more likely rendered resequencing arrays redundant as arrays have become the central technology in the emergence of Next-Generation sequencing. The Next- Generation sequencing technologies should eventually provide a cost-effective solution to the problem of how to obtain large numbers of MLST types accurately. 1.6 MLST Using Next-Generation Sequencing Next-generation sequencing-based methods are under development as alternative, more cost-effective strategies for the simultaneous analysis of large numbers of strains. Several protocols have been described [ 24, 25 ], which involve the parallel sequencing of pooled PCR products from multiple isolates in a single NGS run. The protocol described by Boers and colleagues [ 25 ], highthroughput MLST (HiMLST), uses a two-step PCR with fusion primers to generate barcode-labelled PCR products, enabling the pooling of amplicons from multiple strains for NGS. The first PCR step employs primers with universal 5 tails to generate target genespecific amplicons. Following PCR cleanup, a second round PCR utilizes primers that recognize the universal 5 tails and contain isolate-specific barcodes (multiplex identifiers, MID) and 454 sequencing-specific nucleotides, essential for sequencing on the Roche 454 platform. All amplicons from multiple isolates are then pooled, purified, and diluted for clonal amplification by emulsion PCR and NGS. The NGS is analyzed using a pipeline that enables the seven-allele profile from each individual isolate to be identified by their unique barcodes. Boers and colleagues [ 25 ] successfully used this method to genotype 96 bacterial isolates from four different species in a single NGS run. They found amplicon length and optimal PCR conditions were critical to the success of HiMLST. It

126 MLST 119 was essential amplicons were similar in size so as they amplified with comparable efficiencies during emulsion PCR and subsequently produced equal numbers of sequence reads for each allele of each species. In some cases, the amplicon sizes used in the standard MLST schemes were altered to enable the successful sequencing of all target alleles. The protocol was time consuming taking 38.5 h to complete; however, further automation of the workflow would speed up the procedure. A disadvantage of this method is it is not suited to testing small number of samples; for example, the routine weekly typing of isolates sent to a reference laboratory. Also, the need for long reads ( p) means HiMLST is currently only suited to NGS on the 454 or Ion Torrent platforms. However, there are potential advantages of increasing the resolution of the MLST by incorporating more genes and increasing the capacity for large-scale studies. 1.7 Multi-Virulence- Locus Sequence Typing (MVLST) Although MLST has proven to be an invaluable tool for creating a widely accepted evolutionary framework within which to classify S. aureus strains, it is somewhat limited as a standalone typing method due to its low discriminatory ability. Furthermore, the essential housekeeping genes analyzed are not expected to have any direct association with strain virulence. To address these issues, many investigators sequence additional genes to be analyzed in parallel to the seven used for MLST. For example, Lamers and colleagues [ 14 ] used the repeat-containing loci of clfa, clfb, fnba, and fnbb. In a logical progression of this trend, Verghese and colleagues [ 26 ] have developed a combined multi-virulence-locus sequence typing and staphylococcal cassette chromosome mec typing scheme and were able to demonstrate that it possessed enhanced discriminatory power for typing MRSA strains. 2 Materials 2.1 Culture and Sample Preparation 2.2 PCR 1. Nutrient agar plates. 2. Enzymatic lysis buffer: 20 mm Tris HCl (ph 8.0), 2 mm EDTA, 1.2 % Triton X-100; 30 μg/ml lysostaphin (Sigma); 300 μg/ml lysozyme (Sigma) ( see Note 1 ). 3. DNeasy Tissue Kit (Qiagen). 4. Ethanol %: prepare 95 % (v/v) and 70 % (v/v) ethanol/water ( see Note 2 ). 1. Primers ( see Table 1 ); prepare 10 μm of each primer pair. 2. Taq DNA polymerase (5 U/μl) supplied with 10 PCR buffer and 50 mm MgCl mm dntp set; prepare 10 mm dntp mastermix.

127 120 Nicholas A. Saunders and Anne Holmes Table 1 PCR and sequencing primers Primer Sequence 5 3 Length (bp) arcc -Up TTG ATT CAC CAG CGC GTA TTG TC 456 arcc -Dn AGG TAT CTG CTT CAA TCA GCG aroe -Up ATC GGA AAT CCT ATT TCA CAT TC 456 aroe -Dn GGT GTT GTA TTA ATA ACG ATA TC glpf -Up CTA GGA ACT GCA ATC TTA ATC 465 glpf -Dn TGG TAA AAT CGC ATG TCC AAT TC gmk-u p ATC GTT TTA TCG GGA CCA TC 429 gmk -Dn TCA TTA ACT ACA ACG TAA TCG TA pta -Up GTT AAA ATC GTA TTA CCT GAA GG 474 pta -Dn GAC CCT TTT GTT GAA AAG CTT AA tpi -Up TCG TTC ATT CTG AAC GTC GTG AA 402 tpi-d n TTT GCA CCT TCT AAC AAT TGT AC yqil -Up CAG CAT ACA GGA CAC CTA TTG GC 516 yqil -Dn CGT TGA GGA ATC GAT ACT GGA AC ml thin-wall 96-well plate. 5. Heat sealing foil. 6. Thermal cycler with heated lid (e.g., Eppendorf MasterCycler). 7. Molecular biology agarose TBE buffer: dilute to 1 TBE using distilled water. 2.3 PCR Cleanup Kits and Reagents 2.4 Sequencing Reaction Primers and Materials 1. MultiScreen PCR 96 filter plates (Millipore). 2. MultiScreen Vacuum Manifold 96-well (Millipore). 3. Vacuum pump, 220 V/50 Hz. 4. Plate sealing tape. 5. Plate shaker. Materials for a typical sequencing protocol using the Beckman CEQ platform are given μm of each primer ( see Table 1 ). 2. CEQ Dye Terminator Cycle Sequencing (DTCS) Quick Start Kit (Beckman Coulter). 3. Half CEQ (Genetix, New Milton, Hampshire, UK). 4. Sterile, thin-walled thermal cycling plates (Beckman Coulter). 5. Thermal cycler with heated lid.

128 MLST Sequencing Reaction Cleanup Kits and Reagents 2.6 Sequencing 1. 3 M sodium acetate ph M Na 2 -EDTA: prepare 100 mm Na 2 -EDTA (ph 8.0). 3. Glycogen (20 mg/ml; supplied with DTCS Quick Start Kit). 4. Refrigerated microplate centrifuge, e.g., Allegra X-22R (Beckman Coulter). 5. Ethanol % (Sigma): Prepare 95 % and 70 % (v/v) ethanol/water (s ee Note 3 ). 6. Sample Loading Solution (SLS) (supplied with DTCS Quick Start Kit) ( see Note 4 ). 7. Mineral oil (supplied with DTCS Quick Start Kit). 1. CEQ 8000 Genetic Analysis System (Beckman Coulter). 2. CEQ Capillary Array (Beckam Coulter). 3. CEQ Separation Gel LPA-1 (Beckman Coulter). 4. CEQ Separation Buffer (Beckman Coulter). 5. Buffer Microtiter Plates (Beckman Coulter). 3 Methods 3.1 Culture and Isolation of Genomic DNA (DNeasy Tissue Kit) For MLST, various methods may be used to extract S. aureus DNA. If relatively small sample numbers are being processed, a single tube method such as that described below is suitable. However, a microtiter plate or automated approach (e.g., MagNA Pure, Roche) is more appropriate for large sample numbers. Regardless of which method is used, a pre-lysis step using lysostaphin is essential. 1. Subculture bacteria onto nutrient agar using a sterile disposable loop ( see Note 5 ). 2. Incubate at 37 C overnight. 3. Using a sterile loop, pick approximately 5 10 bacterial colonies and suspend in 180 μl enzymatic lysis buffer. 4. Incubate at 37 C for at least 30 min to lyse the bacterial cells. 5. Add 25 μl proteinase K and 200 μl buffer AL. Mix by vortexing. 6. Incubate at 70 C for 30 min. 7. Add 200 μl of 100 % ethanol to the sample and mix thoroughly by vortexing. 8. Pipette the mixture into a DNeasy mini-column placed in a 2 ml collection tube. Centrifuge at 6,000 g for 1 min. Discard the flow-through and the collection tube.

129 122 Nicholas A. Saunders and Anne Holmes Table 2 Preparation of PCR mastermix Reagent For 1 test (μl) For 48 tests (μl) For 96 tests (μl) Buffer (10 ) MgCl (50 mm) dntp (10 mm) Primer mix (10 μm) Taq polymerase (5 U/μl) H 2 O , , Place the DNeasy mini-column into a new 2 ml collection tube, add 500 μl buffer AW1, and centrifuge at 6,000 g for 1 min. Discard the flow-through and the collection tube. 10. Place DNeasy mini-column into a new 2 ml collection tube, add 500 μl buffer AW2, and centrifuge at full speed (i.e., 14,000 g ) for 3 min. Discard the flow-through and the collection tube. 11. Place DNeasy mini-column into a clean 1.5 ml microfuge tube and add 200 μl buffer AE directly onto the membrane to elute the DNA. Incubate at room temperature for 1 min and then centrifuge at 6,000 g for 1 min. 12. Store DNA at 20 C until ready for use. 3.2 PCR Amplification of MLST Genes 3.3 Purification of PCR Products 1. Thaw PCR reagents and prepare seven mastermixes with the primer pairs by combining the reagents in Table 2. A negative PCR control, which consists of the reaction components and no added template DNA, should be included. 2. Aliquot 48 μl of mastermix into each well of a microtiter plate. 3. Add 2 μl of 1:10 (~40 ng/μl) DNA to wells. 4. Seal plate with foil and load onto PCR machine. 5. Perform PCR amplification by running the following cycling program: 94 C 5 min; 94 C 30 s, 55 C 30 s, 72 C 30 s for 35 cycles; 72 C10 min, 4 C hold. 6. Run products on a 1.5 % agarose gel to confirm the presence of the desired product ( see Note 6 ). Since seven PCR reactions are prepared for each test sample, a highthroughput method is most appropriate, especially for large sample numbers. The method described below uses filter plates, which are available in micro96-, 96-, and 384-well formats. They are cheap, quick, and easy to use and compatible with liquid- handling systems.

130 MLST 123 Table 3 Preparation of sequencing reaction Mastermix reagents Full reaction Half reaction (μl) (see Note 9 ) Sequencing primer (3.2 μm) 3 μl 3 DTCS Quick Start Master Mix 8 μl 4 Genetix halfceq (s ee Note 9 ) 4 Sterile water (adjust total volume to 20 μl depending on DNA volume) 8 μl 8 For small sample numbers, spin columns (e.g., QIAquick PCR purification kit, Qiagen) or an enzymatic method (e.g., ExoSap-IT, Amersham BioSciences, Chalfont, UK) may be used. 1. Make PCR reactions up to 100 μl and load into wells of a MultiScreen PCR 96 filter plate ( see Note 7 ). Cover wells that are not in use with plate sealing tape. 2. Place the MultiScreen PCR 96 filter plate on top of the vacuum manifold. 3. Apply vacuum at 20 in. Hg for 7 12 min or until the wells are empty. Allow 1 min extra under vacuum after wells appear empty to be sure all liquid has filtered. Filters appear shiny when they are dry. 4. Remove plate and blot from underneath with an absorbent material. 5. Add 40 μl of water to wells, cover the wells, and place on plate shaker for 20 min at 1,100 rpm. 6. Retrieve purified PCR products from each well by pipetting and place in microtube. 7. Store purified DNA at 20 C until use. 3.4 Sequencing Reaction 1. Quantify purified PCR products on a 1.5 % agarose gel using a DNA mass ladder (e.g., Bioline Hyperladder IV, London, UK). The following protocol is for use on the Beckman capillary sequencer. Alternative sequencing platforms can be used ( see Note 8 ). 2. Prepare a mastermix using a single MLST primer as shown in Table 3, setting up both a forward primer and reverse primer reaction for each PCR reaction. 3. Aliquot 19 μl of the mastermix into each well of a 96-well plate and add 1 μl of ~ 30 ng/μl purified PCR products.

131 124 Nicholas A. Saunders and Anne Holmes 4. Cover wells with plastic strip caps and amplify on the Eppendorf thermocycler using the following conditions: 96 C, 20 s; 50 C, 20 s; 60 C, 4 min for 30 cycles; and 4 C, hold. 3.5 Electrophoresis (Beckman Platform) 3.6 Assessment of Data Quality 1. Spin plate at 4 C for 1 min at 1,000 rpm in a centrifuge with a microtiter plate rotor. 2. Prepare the stop solution (2 μl 3.0 M sodium acetate, ph 5.2, 2 μl 0.1 M EDTA, ph 8.0, 1 μl 20 mg/ml glycogen) and add 5 μl to each well containing sequencing reaction. 3. Add 60 μl of 95 % (v/v) cold ethanol and vortex. 4. Centrifuge the plate in a refrigerated centrifuge with a microplate rotor (e.g., Beckman Coulter, Allegra X-22R Centrifuge) at 3,000 rpm for 30 min at 4 C. 5. After this a pellet should be seen in each of the wells. Carefully remove supernatant and rinse pellet two times with 200 μl of 70 % (v/v) cold ethanol. For each rinse, centrifuge immediately at 3,000 rpm for 5 min and carefully remove supernatant by inverting and gently shaking three times. After the last spin, place the inverted plate onto blue paper towel do not turn plate upright and spin at 300 rpm for 15 s. 6. Leave the plate for 30 min to air dry before resuspending the pellets in 40 μl of Sample Loading Solution (SLS) (s ee Note 10 ). 7. Add one drop of mineral oil per well. 8. Make up a buffer plate in a flat bottom 96-well plate by filling the same number of wells as the sample plate with CEQ Separation Buffer. 9. Load both plates onto the CEQ. 10. The sample plate is run using preprogrammed conditions designed for sequencing PCR products. 1. The first step in the analysis is to assess the quality of the raw and analyzed data. The signal from all four dyes should be sufficient to give high signal-to-noise ratios. As a general guide it is best to reject sequences that do not achieve an average Phred score ( see Phred Quality Base Calling at phrap.com/phred/) of at least 20 for every 20 contiguous bases throughout the sequence required for MLST. This means that the minimum base call accuracy of any subsequence will be >99 % and that most of the sequence will be at least 99 % accurate. 2. The next step is to align and compare the forward and reverse sequences. This can be done easily with a convenient sequence alignment editor such as BioEdit [ 27 ]. BioEdit can also be used to trim the sequences to the bases required for the Staphylococcus aureus MLST scheme. It is useful to import a

132 MLST 125 known allele to make trimming easier. Discrepancies between the forward and reverse strand sequence should be resolved by reference to the Phred scores and careful analysis of the original electrophoretograms. 3.7 Assigning Allele Numbers and Sequence Types 3.8 Comparison of Strains Using eburst 1. Alleles and allelic profiles can be assigned using the tools provided on the MLST website. A single or batch locus query allows a single sequence or a batch of sequences for the same locus to be compared with all alleles in the database. A multiple locus query identifies the allelic profile, and a batch strain query returns the allelic profile for multiple strains. In most cases the software is expected to return an allele number for each sequence submitted. 2. If the allele sequence is novel, the sequence should be checked against the closest alleles in the database which are returned by the website. This should involve a reexamination of the Phred scores, and if necessary, the original data should be checked. If the new allele is confirmed, the forward and reverse trace files are submitted to the curator. 3. When all seven alleles for a strain or batch of strains are confirmed, the data can be entered into the allelic profile query tool. This query determines whether the strains are identical, or similar, in profile to any strains in the database. If a match is found, the ST number is returned. For strains with no exact match, data on the closest available matches can be displayed. 4. Local handling of this process can be streamlined using a BioNumerics database. This process is described in Note The eburst [ 16 ] application is integrated into the Staphylococcus aureus MLST site. On starting the application a number options are presented. To enter profile data, the input is in the form of tab-delimited text with the data for each strain on a line. The data consist of the ST type followed by the allele numbers for the seven MLST loci in the standard scheme order. An example of the correct format is shown here for Staphylococcus aureus MLST types

133 126 Nicholas A. Saunders and Anne Holmes New MLST types and alleles that are not yet in the curated database can be given temporary numbers ( see Note 12 ). Often the input file will consist of the data for the complete MLST database with new types appended. 2. When the profile data has been entered, it is possible to analyze it separately or with all or a subset of the STs in the database. When this has been defined, the eburst applet is started. A window with profile, analysis, and diagram tabs is opened together with a profile, analysis of diagram panel depending upon which tab is selected. The various options are explained in the eburstv2 manual which is available at mlst.net. 3. The analysis panel allows selection of the minimum number of identical loci to define a group, the minimum number of SLVs to define a group, and the number of bootstrap replicates to perform. Clicking on compute returns the groups. Groups can be drawn using the diagram panel. Tools are provided to manipulate eburst diagrams including reassignment of the group founder. These tools are explained in detail in the eburstv2 manual. An eburst diagram showing a group found in an analysis of the complete S. aureus MLST database is shown in Fig Comparison of Strains Using Concatenated Allele Sequences 3.10 Comparison of Strains Using Minimum Spanning Trees (Networks) 1. The MLST website provides an option to output concatenated allele sequences in FASTA format. The FASTA file can then be input into a suitable tree-drawing program such as those provided in the Phylip suite of programs [ 15 ]. 2. A typical distance tree is shown in Fig. 2. The PubMLST website ( provides an option to output minimum spanning trees from allele data as shown in Subheading 3.8. A typical minimum spanning tree is shown in Fig Notes 1. Lysostaphin (1 mg/ml) and lysozyme (10 mg/ml) working stock solutions should be prepared and stored in single-use aliquots at 20 C. Always prepare fresh lysis buffer. 2. Unless stated otherwise, all solutions should be prepared using sterile, molecular-grade water. This standard is referred to as water in the text. 3. When using ethanol precipitation for purification of sequencing reactions, always use molecular biology-grade ethanol and store-working solutions at 20 C. Ultra pure ethanol that has been treated to remove traces of contaminating water should

134 MLST Fig. 2 A phylogenetic tree based on concatemers of S. aureus MLST sequences. A distance tree based on the concatenated allele sequences of the STs analyzed in the BURST diagram in Fig. 1. The tree was calculated using the Phylip package (Felsenstein). Distances were fi rst computed using the DNADIST program (Kimura 2-parameter model) and then used to draw a tree using the FITCH program. The treefi le was drawn using TreeView v2. The scale bar shows Knuc distances not be used since some batches appear to contain quenchers that reduce the fluorescent signal. The quality of the ethanol is essential for obtaining clean sequencing reactions. Avoid the use of old bottles of ethanol which are likely to be <99 % due to the absorption of atmospheric water. Alternative methods of removing the dye terminators from sequencing reactions prior to electrophoresis are acceptable and may save time. We have found the CleanSEQ kits (Agencourt) to be particularly effective and convenient.

135 128 Nicholas A. Saunders and Anne Holmes Fig. 3 A minimum spanning tree based on the alleles of the MLST types analyzed in Figs. 1 and 2. The diagram was produced using the web tool provided on the PubMLST website 4. SLS should not be subjected to repeated freeze-thaw cycles as this may cause the formamide to breakdown to ammonia and formic acid, which destroys the fluorescent dyes. SLS should therefore be aliquoted into single-use amounts (~350 μl). 5. It is essential that the initial culture is pure. This should be ensured by picking a single well-defined colony. 6. The same primers are used for amplification and sequencing so it is important that only a single DNA fragment is amplified. If more than one fragment is observed, the PCR conditions may need to be re-optimized. 7. Replicate reactions may be added to each well to increase the yield although this should not be necessary under normal circumstances for MLST. 8. Alternative sequencing platforms may be used including the Applied Biosystems capillary sequencer(s) or the MegaBACE 4000 DNA Analysis System (GE Healthcare).

136 MLST HalfCEQ (Genetix) is a specially formulated sequencing reagent that when mixed in equal volume with DCTS Quick Start mix can reduce sequencing costs, without loss of resolution, read length, and accuracy. Similar products are available for use with other commercial sequencing kits. Additionally, it is possible to halve the size of the reaction mixture to reduce costs further. Greater reductions in reaction mixture volume (and consequent increases in economy) are possible with newer, more sensitive, capillary sequencing systems such as the Applied Biosystems Care should be taken to ensure that the wells are completely dry before adding the SLS. Ethanol may quench the fluorescent signal. 11. To streamline data analysis and reduce errors due to copying and pasting sequences, a local database may be used to assign alleles and sequence types. For example, BioNumerics (Applied-Maths) is a software platform that enables trace files to be analyzed using a sequence alignment editor (Genebuilder) and for the resulting unknown sequences to be assigned allele numbers by using a script to compare them with known sequences stored as a simple format file in BioNumerics. Similarly, the sequence type of a given strain may be determined once the seven alleles are assigned by using a script to compare the unknown profile with known profiles stored as a space-delimited file. This is possible as the alleles and sequence types are available for download from the MLST website. 12. It is suggested that the user-defined temporary numbers should be greater than 1,000 for alleles and greater than 10,000 for STs in order to avoid confusion. These numbers should not be used in publications external to the users laboratory for obvious reasons. Acknowledgement The authors acknowledge the support of the Health Protection Agency. References 1. Enright MC, Day NP, Davies CE et al (2000) Multilocus sequence typing for characterization of methicillin-resistant and methicillinsusceptible clones of Staphylococcus aureus. J Clin Microbiol 38: Enright MC, Spratt BG (1999) Multilocus sequence typing. Trends Microbiol 7: Aanensen DM, Spratt BG (2005) The multilocus sequence typing network: mlst.net. Nucleic Acids Res 33:W728 W Ito T, Katayama Y, Asada K et al (2001) Structural comparison of three types of staphylococcal cassette chromosome mec integrated in the chromosome in methicillin-resistant

137 130 Nicholas A. Saunders and Anne Holmes Staphylococcus aureus. Antimicrob Agents Chemother 45: Oliveira DC, de Lencastre H (2002) Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 46: Howe RA, Monk A, Wootton M et al (2004) Vancomycin susceptibility within methicillinresistant Staphylococcus aureus lineages. Emerg Infect Dis 10: Feil EJ, Enright MC (2004) Analyses of clonality and the evolution of bacterial pathogens. Curr Opin Microbiol 7: Enright MC, Robinson DA, Randle G et al (2002) The evolutionary history of methicillinresistant Staphylococcus aureus (MRSA). Proc Natl Acad Sci USA 99: Robinson DA, Enright MC (2004) Evolution of Staphylococcus aureus by large chromosomal replacements. J Bacteriol 186: Robinson DA, Enright MC (2004) Multilocus sequence typing and the evolution of methicillin- resistant Staphylococcus aureus. Clin Microbiol Infect 10: Nübel U, Roumagnac P, Feldkamp M et al (2008) Frequent emergence and limited geographic dispersal of methicillin-resistant Staphylococcus aureus. Proc Natl Acad Sci USA 105: Monecke S, Coombs G, Shore AC et al (2011) A field guide to pandemic, epidemic and sporadic clones of methicillin-resistant Staphylococcus aureus. PLoS One 6(4):e Rolo J, Miragaia M, Turlej-Rogacka A et al (2012) High genetic diversity among community- associated staphylococcus aureus in Europe: results from a multicenter study. PLoS One 7(4):e Lamers RP, Stinnett JW, Muthukrishnan G et al (2011) Evolutionary analyses of staphylococcus aureus identify genetic relationships between nasal carriage and clinical isolates. PLoS One 6(1):e Felsenstein J (1993) PHYLIP (Phylogeny Inference Package) version 3.5c. Distributed by the author. Department of Genetics, University of Washington, Seattle. 16. Feil EJ, Li BC, Aanensen DM et al (2004) eburst: inferring patterns of evolutionary descent among clusters of related bacterial genotypes from multilocus sequence typing data. J Bacteriol 186: Salipante SJ, Hall BG (2011) Inadequacies of minimum spanning trees in molecular epidemiology. J Clin Microbiol 49: Cheng L, Connor TR, Aanensen DM et al (2011) Bayesian semi-supervised classification of bacterial samples using MLST databases. BMC Bioinformatics 12: Day NPJ, Moore CE, Enright MC et al (2001) A link between virulence and ecological abundance in natural populations of Staphylococcus aureus. Science 292: Day NPJ, Moore CE, Enright MC et al (2002) Retraction of Day et al., Science 292 (5514) Science 295: Enright MC, Knox K, Griffiths D et al (2000) Molecular typing of bacteria directly from cerebrospinal fluid. Eur J Clin Microbiol Infect Dis 19: Birtles A, Hardy K, Gray SJ et al (2005) Multilocus sequence typing of Neisseria meningitidis directly from clinical samples and application of the method to the investigation of meningococcal disease case clusters. J Clin Microbiol 43: van Leeuwen WB, Jay C, Snijders S et al (2003) Multilocus sequence typing of Staphylococcus aureus with DNA array technology. J Clin Microbiol 41: Singh P, Foley SL, Nayak R et al (2012) Multilocus sequence typing of Salmonella strains by high-throughput sequencing of selectively amplified target genes. J Microbiol Methods 88: Boers SA, van der Reijden WA, Jansen R (2012) High-throughput multilocus sequence typing: bringing molecular typing to the next level. PLoS One 7(7):e Verghese B, Schwalm ND, Dudley EG et al (2012) A combined multi-virulence-locus sequence typing and Staphylococcal Cassette Chromosome mec typing scheme possesses enhanced discriminatory power for genotyping MRSA. Infect Genet Evol 12: Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95 98

138 Chapter 8 Staphylococcal Cassette Chromosome mec (SCC mec ) Analysis of MRSA Teruyo Ito, Kyoko Kuwahara-Arai, Yuki Katayama, Yuki Uehara, Xiao Han, Yoko Kondo, and Keiichi Hiramatsu Abstract Methicillin-susceptible S. aureus (MSSA) changes to methicillin-resistant S. aureus upon the acquisition of Staphylococcal Cassette Chromosome mec (SCC mec ), a genomic island that encodes methicillin resistance. All SCC mec elements reported to date share four common characteristics: (1) carrying the mec gene complex ( mec ); (2) carrying the ccr gene complex ( ccr ); (3) being flanked by characteristic nucleotide sequences, inverted repeats, and direct repeats, at both ends; and (4) being integrated at the integration site sequence (ISS) for SCC, which is located at the 3 -end of orfx or at the extremity of the SCC element. SCC mec elements in S. aureus are classified into different types based on the combination of mec and ccr, which share variations, five classes in mec and eight in ccr. To date, at least 11 types of SCC mec elements have been identified. Regions other than mec and ccr within the SCC mec element are designated as joining regions (J-regions), which are classified into three subgroups, J1-3. Many J-region variants have been identified among the SCC mec elements of types I V. We herein describe PCR methods to type SCC mec elements by first identifying the mec and ccr type, and then identifying genes in the J-regions. Key words meca, mec gene complex, ccr gene complex, cassette chromosome recombinase ( ccr ), staphylococcal cassette chromosome mec (SCC mec ) 1 Introduction Staphylococcal cassette chromosome mec (SCC mec ) is a unique mobile genetic element that carries the methicillin resistance gene, meca. Nucleotide sequence determination of the mec DNA of premrsa N315 revealed its characteristic structure. Besides meca, it also carries two site-specific recombinase genes, cassette chromosome recombinase A and B ( ccra and ccrb ), and characteristic nucleotide sequences at both ends [ 1 ]. SCC mec is not a bacteriophage or a transposon. It is excised from the cells and integrates at a specific site on the chromosome as a result of the functions of ccra and ccrb [ 2 ]. Yinduo Ji (ed.), Methicillin-Resistant Staphylococcus aureus (MRSA) Protocols, Methods in Molecular Biology, vol. 1085, DOI / _8, Springer Science+Business Media, LLC

139 132 Teruyo Ito et al. Following the first report of the element, many structurally distinct SCC mec elements have been identified. To date, nucleotide sequences of more than 80 SCC mec elements in staphylococcal species have been determined. The SCC mec elements identified in S. aureus are classified into types first based on the combination of two essential components, the mec gene complex and the ccr gene complex [ 3 ]. Eleven types have been reported so far [ 3 11 ]. The updated list and the classification of SCC mec are available at mec.org or The mec gene complex is the gene linkage from IS 431mec located downstream of meca to meca, and two genes that encode regulatory proteins for meca, mecr1 (signal transducer protein), and meci (repressor protein). In some cases, an insertion sequence is inserted by disrupting mecr1. The region between IS 431mec and meca is highly homologous, except for the subregion called the hypervariable region, which is composed of 40-bp direct repeat units (drus) [ ]. The gene linkage, IS 431mec-mecA-mecR1- meci, which was first reported by a group in Switzerland and for which many isolates have so far been identified, e.g., N315, is regarded as a prototype of the mec gene complex, and was designated the class A mec gene complex [ 12, 13 ]. When the mecr1 gene is truncated by the insertion of another insertion sequence, the mec gene complexes are regarded to be different, and are designated as follows: Class B, IS 431mec - meca -Δ mecr1 -IS 1272 ; Class C1, IS 431mec - meca -Δ mecr1 -IS 431 (two IS 431s are arranged in the same direction); and class C2, IS 431mec -meca - ΔmecR1 -IS 431 (two IS 431s are arranged in opposite directions). Recently, mecc, a homologue of meca, was identified [ 15 ], and homologues of mecr1 and meci were found to be located upstream of mecc. The gene linkage between the bla-mecc-mecr1 homologue and meci homologue was designated as the class E mec gene complex (Fig. 1 ). The ccr gene complex is the gene linkage composed of seven to eight ORFs and ccr gene(s) located in the midst of the gene complex. To date, three ccr genes, ccra, ccrb, and ccrc, have been identified in staphylococcal species. Figure 2 shows the phylogenetic relationships of ccr genes in the SCC mec elements identified in S. aureus. In contrast to the high similarity of the meca genes Fig. 1 (continued) IVb, 8.6/3P; type IVc, 81/108; type IVd, JCSC4469; type IV (2B&5), ZH47; type V, WIS[WBG8318]; type V(5C2&5); type VI, HDE288; type VII, JCSC6082; type VIII, C10682; type IX, JCSC6943; type X, JCSC6945; and type XI, LGA251. The locations of the sets of primers identifying the mec gene complex and ccr genes are indicated by bars ; A, meci-mecr1 ; B, IS 1272-mecA ; C1 and C2, meca-is431 with primers pairs listed in Table 1 ; D, mecc; E, ccr A and ccrb genes; F, ccrc. The locations of sets of primers identifying the J1 regions are indicated by squares (not to scale) as follows: black square (X), primer pairs from Kondo et al. [ 23 ] and Okuma et al. [ 18 ]; red square (Y), primer pairs from Oliveila et al. [ 29 ] and Milheirco et al. [ 32 ]; blue square (Z), primer pairs from Zhang et al. [ 30, 31 ]

140 Staphylococcal Cassette Chromosome mec (SCC mec ) Analysis of MRSA 133 Type VII(5C1) Type X(7C1) Type IX(1C2) arsc arsb arsr orfx meca C1 ccra1 ccrb1 ccrc F ccrb6 ccra1 F C2 C2 Z C1 meca ΔmecR1 meca cadx cadd IS431 arsc arsc arsb arsb cadx arsr arsr arsd cadd cop F ISSha1 arsa arsc arsb arsr cop Type V(5C2&5) orfx ccrc ccrc meca ΔIS431 Type V Type VI Type IV(2B&5) Type IVa Type IVb Type IVc Type IVd Type I Type IIa Type IIb SCCHg+Type III F Tn554 orfx mer orfx IS431 meca IS431 orfx ΔmecR1 orfx orfx orfx orfx Tn4001 IS431 orfx orfx J3 pub110 orfx IS431 pt181 IS431 IS431 IS431 IS431 C2 B meca ΨIS1272 ccrb2 ΔmecR1 ccra2 meca ΨIS1272 ccrb2 ΔmecR1 ccra2 meca ΨIS1272 ccrb2 ΔmecR1 ccra2 meca ΨIS1272 ccrb2ccra2 ΔmecR1 meca ΨIS1272 ΨccrB1 ΔmecR1 ccra1 mec gene complex A meca mecr1 meci A B B B B B meca mecr1 meci A E E E E E J2 ccrc ΨIS1272 ccrb4 ccra4 meca ΔmecR1 F E F B 2 Tn4001 ccrc meca ΨIS1272ccrB2 ΔmecR1 ccra2 ccr gene complex E Tn554 Tn554 ΨTn554 XZY XYZ X XY E IE25923 ZXXY ccrb2 ccra2 ccrb2 ccra2 E YZX J1 E ZX XY XZXY orfx ccrc Type VIII(4A) Type XI(8E) IS431 IS431 meca ΨmecR1 meci A Tn554 meca mecr1 meci D ccrb3 mecc ccra1 mecr1lga251 mecilga251 Fig. 1 Structures of the SCC mec elements and the locations of primers. The structures of SCC mec elements of the following strains are illustrated based on the nucleotide sequences deposited in the DDBJ/EMBL/ GenBank databases listed in Table 3 : type I, NCTC10442; type II, N315; type III, 85/2082; type IVa, CA05; type ccrb3 ccra3 E ccrb4 ccra4 cop arsc arsb arsr

141 134 Teruyo Ito et al. ccra1(nctc10442:type I SCCmec) ccra1(jcsc6945:type X SCCmec) ccra1(jcsc6943:type IX SCCmec) ccra1(lga251:type XI SCCmec) ccra3(85/2082:type III SCCmec) ccra2(n315:type II SCCmec) ccra2(ca05:type IV SCCmec) ccra4(hde288:type VI SCCmec) ccra4(c10628:type VIII SCCmec) ccra6(m. caseolyticus JCSC7096) ccrc1allele 1(WIS:type VSCCmec) ccrc1allele 2(TSGH17:type V(5C2&5)SCCmec) ccrc1allele 8(TSGH17:type V(5C2&5)SCCmec) ccrc1allele 3(JCSC6082:type VII SCCmec) ccrb8(m. caseolyticus JCSC7096) ccrb4(hde288:type VI SCCmec) ccrb4(c10628:type VIII SCCmec) ccrb1(nctc10442:type I SCCmec) ccrb1(jcsc6943:type IX SCCmec) ccrb6(jcsc6945:type X SCCmec) ccrb2(n315:type II SCCmec) ccrb2(ca05:type IV SCCmec) ccrb3(85/2082:type III SCCmec) ccrb3(lga251:type XI SCCmec) Fig. 2 Phylogenetic tree constructed using the ClustalW software program, with nucleotide sequences deposited in the EMBL/GenBank/DDBJ databases. The nucleotide sequences of the ccr genes in SCC mec elements listed in Table 3 as well as AB ( M. caseolyticus JCSC7096) were used widely disseminated among staphylococcal species, the ccr genes are extremely diverse. Three ccr gene types have been distinguished by defining ccr genes with less than approximately 50 % nucleotide identities as distinct types. Within each type, ccr genes with more than 85 % nucleotide identities are classified as a subgroup. So far, two ccr types, ccra (1,350 bp in size) and ccrb (1,629 bp), have been further classified into subgroups ccra1 7 and ccrb1 6, respectively. Although the sizes of the genes belonging to the third ccr type, ccrc, range from 1,554 bp ( ccrc in S. aureus strain 85/2082) to 1,683 bp ( ccrc in S. saprophyticus strain ATCC10350), ccrc so far contains only one subgroup, ccrc1. Outbreaks of community-associated methicillin-resistant S. aureus (MRSA) strains have become a great concern worldwide especially since the beginning of this century in 2000 [ 16, 17 ]. In contrast to the fact that the majority of hospital-associated MRSA strains carried SCC mec elements of types, I, II, and III, the majority of community-acquired MRSA strains carried characteristic SCC mec elements, type IV SCC mec or type V SCC mec [ ]. Livestockassociated MRSA (LA-MRSA) strains have also emerged in Europe, Asia, and the Americas. These strains carried unique SCC mec elements distinct from those carried by human isolates, e.g., types IX and X, and types V(5C2&5)c carrying distinct J1 regions [ 10, 20 ]. MRSA strains carrying type XI SCC mec were isolated from

142 Staphylococcal Cassette Chromosome mec (SCC mec ) Analysis of MRSA 135 LA-MRSA spread mostly in England or northern Europe. Type XI SCC mec carries the class E mec gene complex, mecc (a homologue of meca gene), and homologues of mecr1 and meci instead of the original gene linkage, meca, mecr1, and meci, and type 8 ccr gene complex carrying ccra3 and ccrb1 [ 11, 21 ]. The regions other than the mec and ccr gene complexes are called joining (J)-regions, which are classified into J1, J2, and J3 (Fig. 1 ). Even within a specific type of SCC mec, very diverse structures have been reported. SCC mec elements can be sub-typed further by the differences found in the J1 region (formerly called the L-C region). Many different J-1 regions have been identified in types, I, II, IV, and V SCC mec elements: two of type I [ 22 ], five of type II [ 22, 23 ], ten of type IV [ 5, ], and three of type V [ 6, 10 ] (Fig. 1 and Table 3 ). The genes encoding antibiotic resistance are inserted at the J1 3 regions in the form of integrated copies of plasmids or transposons. The pub110 plasmid, a small-sized plasmid that encodes the kanamycin and tobramycin resistance gene, ant (4 )-1, and bleomycin resistance gene ( ble ), is frequently identified in the type II SCC mec element, and occasionally in the type I and IV SCC mec elements. Another plasmid, pt181, a small-sized plasmid that encodes a tetracycline resistance gene ( tetk ), is identified in the majority of type III SCC mec elements and type V(5C2&5)c SCC mec. Transposon Tn 554, which encodes erythromycin and spectinomycin resistance genes ( erma and spc ), is identified in types II and VIII SCC mec s, and ΨTn 554, which encodes cadmium resistance, is identified in type III SCC mec. Heavy metal resistance genes are also found, especially integrated in the SCC mec elements of LA-MRSA strains, which are generally not associated with insertion sequences or transposons. The caddx operon, which is composed of cadd (cadmium-resistant transporter) and cadx (regulatory protein), is carried by two SCC mec elements, type IX in JCSC6943 and type X in JCSC6945. A novel gene, czrc ( c admium z inc r esistance C), which was shown to be responsible for cadmium and zinc resistance by Cavaco et al. [ 28 ], is carried by type V(5C2&5)c in strain JCSC6944. The copb gene, which may be associated with copper resistance, is identified in types IX and X SCC mec elements. The resistance genes for arsenate are carried by three SCC mec elements. As different types of SCC mec elements have been discovered, it has become evident that two MRSA clones are different if they carry different SCC mec elements, even if they belong to the same MLST type or the same pulsotype. Therefore, determination of the type of SCC mec element carried by an MRSA clone (SCC mec typing) has become an essential aspect of the epidemiology of MRSA since arriving at the consensus that MRSA clones should be defined by both the type of SCC mec element and the type of S. aureus chromosome in which the SCC mec element is integrated.

143 136 Teruyo Ito et al. We herein describe the basic PCR strategy that can be used to identify the types of mec and ccr in order to first assign the types of SCC mec elements, and we also describe the PCR strategy to identify subtypes of SCC mec elements. We have listed only the primers used in our lab, although a comparison of the primers reported by other researchers identifying mec, ccr, and genes in the J-region is also described. 2 Materials 2.1 Preparation of Chromosomal DNA Reagents for Genomic DNA Extraction 1. Medium for the cultivation of cells: Heart-infusion broth or L-broth. (Dissolve 10 g Bacto-tryptone, 5 g Bacto-yeast extract, 5 g NaCl in 1 L H 2 O. Adjust ph to with NaOH.) Sterilize by autoclaving. 2. Achromopeptidase (Wako Pure Chemical Industries, Ltd. Tokyo, Japan): 50,000 U/mL in 10 mm NaCl or lysostaphin (Sigma): 2 mg/l in 20 mm sodium acetate [ph 4.8] % SDS: Dissolve 10 g sodium dodecyl sulfate in 100 mm H 2 O. Sterilize by autoclaving. 4. Proteinase K: 10 mg/ml in DEPC-H 2 O. 5. Tris Cl-saturated phenol*: Melt phenol in a bottle in a water bath at 65 C. Add an equal volume of 0.5 M Tris Cl [ph 8.0] and 8-hydroxyquinoline to a final concentration of 0.1 %. Stir the mixture on a magnetic stirrer for 15 min, and then turn off the stirrer. When the two phases have separated, remove the aqueous (upper) phase. Add an equal volume of 0.5 M Tris Cl [ph 8.0], and mix well with stirring for 15 min. After the two phases have separated, remove the aqueous phase. Repeat the extraction with 0.1 M Tris Cl [ph 8.0] until the ph of the aqueous phase is >7.6. Remove 90 % of the aqueous phase, relative to the volume of the phenol phase. Store in a lightprotected bottle at 4 C ( see Note 1 ). 6. Chloroform:isoamyl alcohol (24:1)*. Mix 24 volumes of chloroform and 1 volume of isoamyl alcohol M NaCl*: Dissolve g NaCl in 800 ml H 2 O. Adjust volume to 1 L. Sterilize by autoclaving. 8. Ethanol % v/v Ethanol M Tris Cl (ph 8.0)*: Dissolve g Tris base in 800 ml H 2 O. Adjust the ph to 8.0 by adding concentrated HCl and adjust the volume to 1 L. Sterilize by autoclaving M EDTA (ph 8.0)*: Add g disodium ethylene diamine tetraacetate 2H 2 O to 800 ml H 2 O. Stir on a magnetic stirrer. Adjust the ph to 8.0 with NaOH (~20 g of

144 Staphylococcal Cassette Chromosome mec (SCC mec ) Analysis of MRSA 137 NaOH pellets) and adjust the volume to 1 L. Sterilize by autoclaving. 12. T10E10 (ph 8.0)*: Mix 1 M Tris Cl (ph 8.0), 0.5 M EDTA (ph 8.0), and DEPC- H 2 O to make a final concentration of 10 mm Tris Cl and 10 mm EDTA. 13. T10E1 (ph 8.0)*: Mix 1 M Tris Cl (ph 8.0), 0.5 M EDTA (ph 8.0), and DEPC- H 2 O to make a final concentration of 10 mm Tris Cl and 1 mm EDTA. 14. DEPC-H 2 O: Add diethyl pyrocarbonate (Sigma) to a final concentration of 0.02 % to deionized water in a bottle and shake vigorously. Keep at room temperature overnight and then sterilize by autoclaving. 15. Commercially available kits: Any commercially available DNA extraction kit would be fine, e.g., from QIAGEN Inc. (Valencia, CA) or ProMega Co. (Madison, WI). Here we describe a conventional extraction kit, Cica Geneous DNA extraction Reagent from Kanto Chemical (Tokyo, Japan). 2.2 PCR Amplification 1. dntps (2.5 mm): Prepare dntps as a 10 stock solution of 2.5 mm datp, 2.5 mm dctp, 2.5 mm dgtp, and 2.5 mm dttp. 2. Reaction buffer (10 ): To prepare a 10 stock solution, 5 M KCl, 1 M Tris Cl [ph 8.3], 1 M MgCl 2, 2 % (w/v) gelatin, and DEPC-H 2 O were mixed to make final concentrations of 500 mm KCl, 100 mm Tris Cl, 15 mm MgCl 2, and 0.01 % gelatin. Alternatively, a commercially available 10 stock solution was used. 3. DEPC-H 2 O. 4. Primers: Prepare primers at a concentration of 10 pmol/μl. Primers used for the assignment of SCC mec element types and their subtypes are listed in Tables 1 and 2, respectively ( see Note 2 ). 5. Taq DNA polymerase: Extaq (Takara Bio. Co. Ltd., Shiga, Japan) ( see Note 3 ). 6. Tris acetate (TAE) buffer*: Prepare TAE buffer as a 50 stock solution. Dissolve 242 g Tris base in 800 ml H 2 O. Add 57.1 ml glacial acetic acid and 100 ml 0.5 M EDTA (ph 8.0). Adjust volume to 1 L % agarose gel: 0.8 g Agarose is melted in 100 ml 1 TAE buffer by heating in a microwave oven. Cool the solutions to 50 C, and pour the agarose solution into the minigel mold. After the gel is completely set, carefully remove the comb. 8. Size markers: 1 kb ladder and λ Hin diii. 9. Loading buffer.

145 138 Teruyo Ito et al. Table 1 Primers used for SCCmec typing Detected gene(s) or gene alleles Primer name Nucleotide sequence (5 3 ) Expected sizes of products Multiplex PCR-1 for identifying meca and ccr genes meca ma1 TGCTATCCACCCTCAAACAGG 286 ma2 AACGTTGTAACCACCCCAAGA ccr gene type ccrb βc* ATTGCCTTGATAATAGCCITCT ccra1 α1 AACCTATATCATCAATCAGTACGT 695 ccra2 α2 TAAAGGCATCAATGCACAAACACT 937 ccra3 α3 AGCTCAAAAGCAAGCAATAGAAT 1,791 ccrc γr CCTTTATAGACTGGATTATTCAAAATAT 518 γf CGTCTATTACAAGATGTTAAGGATAAT ccrab 4 α4.2 GTATCAATGCACCAGAACTT 1,287 β4.2 TTGCGACTCTCTTGGCGTTT Multiplex PCR-2 for identifying mec gene complex classes, A, B, and C2 ma7 ATATACCAAACCCGACAACTACA Class A ( meca meci ) mi6 CATAACTTCCCATTCTGCAGATG 1,965 Class B (meca IS 1272 ) IS7 ATGCTTAATGATAGCATCCGAATG 2,827 Class C2 ( meca IS 431 ) IS2(iS-2) TGAGGTTATTCAGATATTTCGATGT 804 Uniplex PCRs for identifying other targets mecc mecal-f ATGAAATCGGTATTGTCCCTAACA mecal-r AATGCTAATGCAATGCGGGCA 916 Class C1 ( meca IS 431 ) ma7 ATATACCAAACCCGACAACTACA is-1 ACATTAGATATTTGGTTGCGT 617 *a primer constructed using inosine at the 19th nucleotide position so that it recognize three ccr genes, ccrb1, ccrb2, and ccrb3 10. Control DNAs: SCC mec sequenced strains are used as standard strains: type-i (NCTC10442, COL), type-ii (N315, Mu50, E-MRSA 252), type-iii (85/2082), type-iva (CA05, MW2, JCSC4744, FPR3757), type-ivb (8-6/3P, JCSC2172), type- IVc (81/108, JCSC4788), type-ivd (JCSC4469), type- V (WIS[WBG8318]), type VI (HDE288), type VII (JCSC6082), type VIII (C10682), type IX (JCSC6943), type X (JCSC6945), and type XI (LGA251) ( see Note 4 ). 3 Methods 3.1 Preparing Template DNA DNA Extraction with Phenol Chloroform (Small Scale) 1. Inoculate 4 ml of HI-broth or L-broth with a single colony of S. aureus. Incubate at 37 C overnight with shaking. 2. Pour 0.8 ml of the culture into an Eppendorf tube (1.5 ml). Centrifuge for 2 min at g. Remove as much of the medium as possible using a pipetman. 3. Resuspend the cell pellet in 400 μl T10E10.

146 Staphylococcal Cassette Chromosome mec (SCC mec ) Analysis of MRSA 139 Table 2 Primers used for subtyping SCC mec Detected gene(s) or gene alleles Primer name Nucleotide sequence (5 3 ) Expected sizes of products M-PCR # 3: Amplification of ORFs in J1 region of type I and IV SCC mec E007 in Type I.1 (Ia) SCC mec 1a3 TTTAGGAGGTAATCTCCTTGATG 154 1a4 TTTTGCGTTTGCATCTCTACC CQ002 in Type IV.1 (IVa) SCC mec 4al TTTGAATGCCCTCCATGAATAAAAT 458 4a3 AGAAAAGATAGAAGTTCGAAAGA M001 in Type IV.2 (IVb) SCC mec 4b3 AACCAACAGTGGTTACAGCTT 726 4b4 CGGATTTTAGACTCATCACCAT CR008 in Type IV.3 (IVc) SCC mec 4c4 AGGAAATCGATGTCATTATAA 259 4c5 ATCCATTTCTCAGGAGTTAG CD002 in Type IV.4 (IVd) SCC mec 4d3 AATTCACCCGTACCTGAGAA 1,242 4d4 AGAATGTGGTTATAAGATAGCTA M-PCR # 4 : Amplification of ORFs in J1 region of type II, III, and V SCC mec KdpB in Type II.1 SCC mec kdpb1 GATTACTTCAGAACCAGGTCAT 287 kdpb2 TAAACTGTGTCACACGATCCAT S01 in Type II.2 SCC mec 2b3 GCTCTAAAAGTTGGATATGCG 1,518 IIE03 in Type II.3 (IIE) SCC mec and M001 in Type IV.2 (IVb) SCC mec 2b4 TGGATTGAATCGACTAGAATCG 4b3 AACCAACAGTGGTTACAGCTT 726 4b4 CGGATTTTAGACTCATCACCAT RN06 in Type II.4 SCC mec II4-3 GTACCGCTGAATATTGATAGTGAT 2,003 II4-1 ACTCTAATCCTAATCACCGAAC Z004 in type III.1 SCC mec 3a1 ATGGCTTCAGCATCAATGAG 503 3a2 ATATCCTTCAAGCGCGTTTC V024 in type V SCC mec 5a1 ACCTACAGCCATTGCATTATG 1,159 5a2 TGTATACATTTCGCCACTAGCT MLEP (previously called MREP) cr4 GTTCAAGCCCAGAAGCGATGT type i; 1.6 kb mr5 ATGCTCTTTGTTTTGCAGCA type ii; 1.7 kb mr6 ATATTCTAGATCATCAATAGTTG type iii; 1 kb 4. Add 5 μl lysostaphin solution (2 mg/ml), and place the tube at 37 C for 60 min in a water bath or an incubator until it becomes transparent. If the suspension does not become transparent, add an additional aliquot of lysostaphin and keep the tube at 37 C until it becomes transparent ( see Note 5 ). Add 8 μl achromopeptidase solution (50,000 U/mL), and place the tube at 55 C for 30 min in a water bath until it becomes transparent. 5. Add 4 μl proteinase K (10 mg/ml) to a final concentration of 100 μg/ml and 24 μl 10 % SDS. Place the tube in the incubator or the water bath at 37 C for more than 1 h or overnight.

147 140 Teruyo Ito et al. 6. Add an equal volume of Tris Cl-saturated phenol. Mix well by inverting the tube several times. Separate the phases by centrifugation at g for 3 5 min at room temperature, and transfer the aqueous phase to a fresh tube. 7. Extract the aqueous phase twice with an equal volume of chloroform/isoamyl alcohol. 8. Transfer the aqueous phase to a fresh tube. Add 5 M NaCl to a final concentration of 0.2 M and 2 volumes of 100 % ethanol. Mix thoroughly. 9. Centrifuge at g for 1 min and discard the supernatant. The chromosomal DNA sediments to the bottom of the tube. 10. Discard the supernatant. Wash the DNA pellet with 80 % ethanol twice. Air-dry the pellet for min, and redissolve the pellet of chromosomal DNA in 50 μl T10E Estimate the concentration of DNA using an ND-1000 UV/ Vis spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) or estimate roughly by running an agarose gel DNA Extraction with a Commercially Available Kit 3.2 PCR Amplification M-PCR#1 (M-PCR with Primer Set 1) Identifying the ccr Gene Complex DNAs were extracted using the procedure recommended by the manufacturer. Below we describe the convenient method that we are using: Cica Geneus DNA Extraction Reagent 1. Add 100 μl of the DNA extraction reagent mixture (mixture of regents a and b at a ratio of 1:10) into a microtube. 2. Add 10 μl of the bacterial solution to the microtube and mix well. The following bacterial solutions can be used: liquid culture (overnight-cultured cells or late-log-phased cells); bacterial solutions prepared by suspending bacterial colonies in distilled water at the concentration of McFarland Standards Numbers Heat-treat the samples at 72 C for 6 min, and then at 94 C for 3 min. The reaction mixtures contained 10 ng chromosomal DNA, oligonucleotide primers (0.1 μm), 200 μm each dntp, Ex Taq buffer, and 2.5 U Ex Taq polymerase (Takara), and MgCl 2 at the concentration of 0.32 mm in a final volume of 50 μl. The pre-mixture should contain the following components in a volume of 49 μl per aliquot: 5 μl 10 ExTaq buffer, 4 μl dntps, oligonuleotide primers (1 2 μl), ExTaq DNA polymerase (2.5 U), and DEPC- H 2 O to adjust the final volume to 49 μl. Add 1 μl of template DNA to each tube and subject samples to PCR( see Note 2 ). In cases using 2 μl of template DNA, e.g., DNA extracted with the Cica Geneus DNA Extraction Reagent, the volume of pre-mixture should be changed to 48 μl by reducing the amount of DEPC-H 2 O. The PCR

148 Staphylococcal Cassette Chromosome mec (SCC mec ) Analysis of MRSA 141 conditions are as follows: M-PCR1, initial denaturation step (94 C, 2 min), 30 cycles of denaturation (94 C, 2 min), annealing (57 C, 1 min), extension (72 C, 2 min), and a final elongation at 72 C for 2 min. Keep samples at 4 C following PCR M-PCR#2 (M-PCR with Primer Set 2) Identifying the mec Gene Complex M-PCR#3 and #4 (M-PCR with Primer Sets 3 and 4) Identifying the J1 Region Genes 3.3 Detection of Amplified DNA Fragments 3.4 Analyzing the Products of PCR Experiments Assignment of ccr For M-PCR#2, the reaction mixtures are the same as for M-PCR#1 other than the concentration of MgCl 2 (0.25 mm) and the primer pairs. The PCR conditions are as follows: M-PCR2, denaturation (94 C, 1 min), 30 cycles of denaturation (94 C, 1 min), annealing (50 C, 1 min), and extension (72 C, 2 min). Keep samples at 4 C following PCR. The reaction mixtures and conditions used are the same as those for M-PCR#2 other than the primer pairs. 1. Mount the agarose gel in the electrophoresis tank, and add enough 1 TAE buffer to cover the gel. 2. Mix 4 μl of sample from each PCR reaction with 1 μl of loading buffer, and load samples into the wells of the gel. The gel is usually run at high voltage (100 V). Stop running at an appropriate time. We usually stop the procedure when the bromophenol blue has run 2/3 of the length of the gel. 3. DNA fragments in the agarose gel are stained by soaking in 0.01 % ethidium bromide solution for 20 min. 4. Take a photograph using transmitted UV light with the Fas II system (UV sample camera, Toyobo, Tokyo, Japan). M-PCR#1 contains pairs of primers that can identify the meca and 5 ccr genes at the same time. It contains previously established primer pairs identifying ccra, B, and C based on the differences in the ccra gene: cβ, a primer constructed using inosine at the 19th nucleotide position so that it recognizes three ccr genes, ccrb1, ccrb2, and ccrb3 ; α1, a primer specific to ccra1 ; α2, a primer specific to ccra2 ; and α3, a primer specific to ccra3. The DNA fragments corresponding to each of the ccr genes are shown in Fig 2a ; 695 bp, type 1 ccr in type I SCC mec ; 937 bp, type 2 ccr in types II and IV SCC mec s; 1,791 bp, type 3 ccr in type III SCC mec ; 1,287 bp, type 4 ccr in type VI and VIII SCC mec s; 518 bp, type 5 ccr in type V and VII SCC mecs ; as well as SCC Hg in 85/2082 were successfully amplified by M-PCR#1. The presence of DNA fragments of 286 bp indicated that these strains carried meca (Fig. 3a ). Two DNA fragments of 518 and 1,791 bp [lane III] were amplified with chromosomal DNA of 85/2082, indicating that it carried both type 3 ccr and ccrc. The sequence data indicate that the strain carries two SCC elements, type III SCC mec encoding

149 142 Teruyo Ito et al. a MWM I II III IV V VI VII VIII IX X XI MWM ccrab3 (1791bp) ccrab2 (937bp) ccrab1 (695bp) ccrc (518bp) Maker ccrab4 (1287bp) meca (286bp) b MWM I II III IV V VI VII VIII IX X XI MWM c MWM VII IX X XI MWM Class B mec (2827bp) Class A mec Class C2 mec (804bp) Class C1mec (1567bp) Class C1mec (617bp) Fig. 3 Agarose gel electrophoresis of amplifi ed DNA fragments: ( a ) With M-PCR#1; ( b ) with M-PCR#2; ( c ) uniplex PCR identifying the class C1 mec gene complex. Chromosomal DNAs extracted from the following strains were used: I, NCTC10442; II, N315; III, 85/2082; IV, CA05; V, WIS[WBG8318]; VI, HDE288; VII, JCSC6082; VIII, C10682; IX, JCSC6943; X, JCSC6945; and XI, LGA251. MWM (molecular weight marker, 1 kb ladder) type-3 ccr and SCC Hg encoding ccrc. When no DNA fragments can be amplified with the set of primers to identify ccr 1 5, these strains are judged unable to be typed. In the case of the type IX SCC mec element, the band for type 1 was not shown clearly in the case of JCSC6943 ( see Note 6 ) Assignment of mec M-PCR#2 contained primer pairs for identifying three gene linkages in the mec gene complex, meca meci (class A), meca IS 1272 (class B), and meca IS 431 (class C2). From the sizes of the amplified DNA fragments, we could judge the class of mec carried by a given strain (Fig. 3b ). The sizes of the DNA fragments amplified

150 Staphylococcal Cassette Chromosome mec (SCC mec ) Analysis of MRSA 143 with M-PCR#2 are as follows: class A, 1,965 bp or 1,797 bp in type II, III, and VIII SCC mec ; class B, 2,827 bp in types, I, IV, and VI SCC mec ; class C2, 804 bp in types V and IX SCC mec. Although the size of DNA fragment identified with chromosomal DNA of 85/2082 is shorter than that with chromosomal DNA of N315, the data clearly indicated that mecr1 of strain 85/2082 was deleted by 166 bp ( see Note 7 ). When no DNA fragment was amplified with sets of primers to identify class A to C2 mec, we suggest that the sample should be examined for the carriage of the class C1 mec gene complex and mecc with the sets of primers listed in Table 1. DNA fragments can be amplified in types VII and X SCC mec with a pair of primers identifying the class C1 mec gene complex (Fig. 3c ). Since SCC mec JCSC6945 carries a novel class C1-like mec gene complex (6,422 bp), which is distinct from the class C1 mec gene complex (7,212 bp) carried by type VII SCC mec in a Swedish community-associated MRSA strain JCSC6082, the sizes of amplified DNA fragment are not identical. The differences in size are due to the difference in the position where the IS 431 was inserted [ 10 ]. If necessary, PCR reactions to find the localization of meci and mecr1 genes with three sets of primers [ 18 ] can be carried out, since this region sometimes has mutations or deletions. Since the size of the amplified DNA fragment for class B mec is relatively long, it is important to use Taq DNA polymerase that can amplify these sizes of DNA fragments ( see Note 2 ). M-PCRs reported by Oliveila et al. [ 29 ], Milheirico et al. [ 27, 29 ], and Zhang et al. [ 30, 31 ], and uniplex PCRs reported from our laboratory [ 18 ], suggest that the class A mec should be determined by identifying meci, class B mec by identifying IS 1272, and class C2 mec by identifying gene linkage mecr1 IS 431. Although these PCRs could not show the linkage of genes directly, this would not be likely to cause any problems, since such genes are mostly carried at the SCC mec element in the S. aureus chromosome Assignment of J-Regions J-regions contain ORFs specific to each SCC mec element, as well as inserted copies of plasmids or transposons. ORFs specific to each SCC mec have been used as targets of some M-PCRs. However, some SCC mec elements carrying the same J1 region, but belonging to distinct types of SCC mec, have been identified. For example, type Ib SCC mec in PL72, type IIe SCC mec in JCSC6833, and type IVj SCC mec in JCSC6670 (type IVj) carry identical J1 regions [ 22, 25 ]. Type IIb SCC mec in JCSC3063 and IVi SCC mec elements also carried the same J1 region [ 25 ]. Therefore, we suggest that the identification of ORFs at J-regions should be used for further classifying each SCC mec type. We must emphasize that judging an SCC mec type only by the identification of the J-region should be avoided. Targets of PCRs for identifying J-regions are classified into two groups: identifying ORFs or regions specific to each element, and

151 144 Teruyo Ito et al. identifying ORFs (mostly resistant determinant) in mobile genetic elements, e.g., transposons or integrated plasmid. M-PCR#3 and #4 have been developed to further classify types I V SCC mec elements based on the differences in the J1 regions. The locations of primers are indicated by X in Fig. 1. With M-PCR#3, a subtype of type I and four subtypes of IV SCC mec elements can be determined. With M-PCR#4, four subtypes of type II SCC mec and a subtype of types III and V SCC mec elements can be determined. The location of primers for M-PCR identifying the J1 region reported by Duarte et al. [ 29 ] and Milheirico et al. [ 27, 32 ] and Zhang et al. [ 30, 31 ] are indicated by Y and Z, respectively, in Fig. 1. The number of novel subtypes of each SCC mec has been increasing, so it will soon be necessary to update the primer pairs used for identifying J1 region-based subtypes. The J3 region was also used as the target for classifying SCC mec or identifying MRSA. The mec left extremity polymorphism (MLEP) typing (formerly called mec right extremity polymorphism typing) is a PCR strategy that can be used to identify differences in the region of SCC mec flanking orfx. This multiplex PCR is composed of three primers: cr4, a primer in the chromosomal region flanking the SCC mec ; mr5, a primer for the extremities of the type I and type II SCC mec elements, which were called the downstream constant region ( dcs region) by Oliveira et al. [ 33 ]; and mr6, a primer for the extremity of the type III SCC mec element, which was discovered to be SCC Hg. The identification of MRSA with primer pairs, including one designed for the S. aureus chromosome and one for the left extremity of SCC meci, can be achieved using commercially available rapid MRSA detection kits (e.g., from BD Diagnosis or Cepheid). For identifying ORFs (mostly resistance-determinant ORFs) in mobile genetic elements, we have developed M-PCR#5 identifying the J2 region, and M-PCR#6 identifying the inserted plasmid pub110 or pt181. By using these PCRs, the inserted plasmids or transposons can be identified with their real connection to SCC mec elements. Oliveila et al. and Milheilto et al. also reported primers identifying these plasmids in their multiplex PCR system ( see Note 8 ) Some Problems Associated with Assigning SCCmec Elements Table 3 lists the SCC mec types and representative J1 region- based subtypes reported to date. As you may notice, composites of SCC mec and SCC, e.g., type IV(2B&5) or type V(5C2&5), have been identified. Two ccr genes, ccra2b2 and ccrc, could be amplified in the case of type IV(2B&5), while only the ccrc gene was identified in the case of the type V (5C2&5) SCC mec element. To determine whether it carried a type V SCC mec or a composite type V(5C2&5), further PCR experiments would be necessary. Furthermore, DNA fragments of two different types of ccr genes were occasionally

152 Staphylococcal Cassette Chromosome mec (SCC mec ) Analysis of MRSA 145 Table 3 Currently identified SCC mec types in S. aureus strains SCCmec types ccr gene type mec gene complex J1 regionbased subtypes Strains (EMBL/GenBank/DDBJ accession nos. or URL of genome projects) I 1 (A1B1) B a NCTC10442(AB033763), COL(NC_00295) b PL72(AB433542) II 2 (A2B2) A a N315 (D86934, NC_002745), Mu50 (NC_002758), MRSA252 (BX571856), JH1(NC_009632) b c d e JCSC3063(AB127982) AR13.1/3330.2(AJ810120) RN7170 (AB261975) JCSC6833 (AB433542) III 3 (A3B3) A 85/2082 (AB037671) IV 2 (A2B2) B a CA05(AB063172), MW2(NC_003923), JCSC4744(AB266531) b c d g h i j k 8/6-3P (AB063173) 81/108 (AB096217), 2314(AY271717), cm11 (EF584543) JCSC4469 (AB097677) M03-68 (DQ106887) HO (EMRSA15) ( ac.uk/resources/downloads/bacteria/ staphylococcus-aureus.html ) JCSC6668 (=CCUG41764)(AB425823) JCSC6670 (=CCUG27050) (AB425824) 45394F(GU122149) IV(2B&5) 2 (A2B2) B ZH47(AM292304) V 5 (C1) C2 a WIS(WBG8318) (AB121219) V (5C2&5) 5 (C1) C2 b TSGH17 (AB512767), PM1(AB462393), V (5C2&5) 5 (C1) C2 c S0385(AM990992), JCSC6944(AB505629) VI 4 (A4B4) B HDE288 (AF411935) VII 5 (C1) C1 JCSC6082 (=P5747/2002) (AB373032) VIII 4 (A4B4) A C10682 (FJ390057), BK20781(FJ670542) IX 1(A1B1) C2 JCSC6943 (AB505628) X 7(A1B6) C1 JCSC6945 (AB505630) XI 8(A1B3) E LGA251(FR821779)

153 146 Teruyo Ito et al. identified by M-PCR #1. In our experience, such strains mostly carry an SCC carrying ccrc or ccra4 and ccrb4 downstream of orfx (Meng Zhang, in preparation). For M-PCR#2, there are a very small number of cases where amplification of the DNA fragment would fail because of the presence of an integrated copy of a transposable element. For example, type IV(2B&5) SCC mec elements carried an inserted copy of Tn 4001 at the me c gene complex. If no DNA fragment is amplified by M-PCR2, we recommend confirming the presence of meci, mecr, and/or IS When M-PCR#1 was used for the identification of ccr genes carried by staphylococcal strains other than S. aureus, we found that two, three, or more bands were amplified. It is very difficult to judge the type of ccr in such a case, since there is a possibility that non- S. aureus strains carry a novel ccr gene. 4 Notes 1. Reagents marked by asterisks (*) were prepared based on previously described protocols [ 34 ]. All reagents whose manufacturers were not indicated were of reagent grade. 2. A primer pair used for the identification of type 3 ccr sometimes does not work well. When the band for type 3 ccr would not be generated clearly with DNA of reference strain. 3. Taq DNA polymerase that can amplify these sizes of DNA fragments should be used. ExTaq is fine for these amplifications, but the use of other Taq DNA polymerases that amplify only short regions, e.g., AmpliTaq, is therefore not recommended for the M-PCR#2. 4. Ideally, DNAs from characterized MRSA strains in which the entire SCC mec region has been sequenced should be used as controls. If no such strains are available, DNAs from MRSA strains in which the entire SCC mec region has been amplified by long-range PCR are recommended. 5. It is important to lyze the cells completely. 6. In the case of JCSC6943, it turned out that it carries ccr genes classified into type 1, although the M-PCR#1 amplification is not so clear. However, other IX SCC mec strains belonging to ST9, type 1 ccr genes were identified by M-PCR1. 7. When DNA fragment of different size was amplified, we suggest to conduct uniplex PCR using a set of primers identifying either one of the mec gene complexes. 8. In this chapter, we do not describe these PCRs in detail. Please refer the references for details [ 23, 29 ].

154 Staphylococcal Cassette Chromosome mec (SCC mec ) Analysis of MRSA 147 Acknowledgement This work was supported by a Grant-in-Aid from MEXT (Ministry of Education, Culture, Sports, Science and Technology) Supported Program for the Strategic Research Foundation at Private Universities. References 1. Ito T, Katayama Y, Hiramatsu K (1999) Cloning and nucleotide sequence determination of the entire mec DNA of pre-methicillin- resistant Staphylococcus aureus N315. Antimicrob Agents Chemother 43: Katayama Y, Ito T, Hiramatsu K (2000) A new class of genetic element, staphylococcal cassette chromosome mec, encodes methicillin resistance in Staphylococcus aureus. Antimicrob Agents Chemother 44: International Working Group on the Classification of Staphylococcal Cassette Chromosome Elements (IWG-SCC) (2009) Classification of staphylococcal cassette chromosome mec (SCC mec ): guidelines for reporting novel SCC mec elements. Antimicrob Agents Chemother 53: Ito T, Katayama Y, Asada K et al (2001) Structural comparison of three types of staphylococcal cassette chromosome mec integrated in the chromosome in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 45: Ma XX, Ito T, Tiensasitorn C et al (2002) Novel type of staphylococcal cassette chromosome mec identified in community-acquired methicillinresistant Staphylococcus aureus strains. Antimicrob Agents Chemother 46: Ito T, Ma XX, Takeuchi F et al (2004) Novel type V staphylococcal cassette chromosome mec driven by a novel cassette chromosome recombinase, ccrc. Antimicrob Agents Chemother 48: Oliveira DC, Milheirico C, de Lencastre H (2006) Redefining a structural variant of staphylococcal cassette chromosome mec, SCC mec type VI. Antimicrob Agents Chemother 50: Berglund C, Ito T, Ikeda M et al (2008) Novel type of staphylococcal cassette chromosome mec in a methicillin-resistant Staphylococcus aureus strain isolated in Sweden. Antimicrob Agents Chemother 52: Zhang K, McClure JA, Elsayed S et al (2009) Novel staphylococcal cassette chromosome mec type, tentatively designated type VIII, harboring class A mec and type 4 ccr gene complexes in a Canadian epidemic strain of methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 53: Li S, Skov RL, Han X et al (2011) Novel types of staphylococcal cassette chromosome mec elements identified in clonal complex 398 methicillin-resistant Staphylococcus aureus strains. Antimicrob Agents Chemother 55: Garcia-Alvarez L, Holden MT, Lindsay H et al (2011) Meticillin-resistant Staphylococcus aureus with a novel meca homologue in human and bovine populations in the UK and Denmark: a descriptive study. Lancet Infect Dis 11: Katayama Y, Ito T, Hiramatsu K (2001) Genetic organization of the chromosome region surrounding meca in clinical Staphylococcal strains: role of IS 431 -mediated meci deletion in expression of resistance in meca -carrying, low-level methicillin- resistant Staphylococcus haemolyticus. Antimicrob Agents Chemother 45: Ryffel C, Bucher R, Kayser FH et al (1991) The Staphylococcus aureus mec determinant comprises an unusual cluster of direct repeats and codes for gene product similar to the Escherichia coli sn-glycerophosphoryl diester phosphodiesterase. J Bacteriol 173: Goering RV, Morrison D, Al-Doori Z et al (2008) Usefulness of mec -associated direct repeat unit (dru) typing in the epidemiological analysis of highly clonal methicillin-resistant Staphylococcus aureus in Scotland. Clin Microbiol Infect 14: Ito T, Hiramatsu K, Tomasz A et al (2012) Guidelines for reporting novel meca gene homologues. Antimicrob Agents Chemother 56: Chambers HF (2001) The changing epidemiology of Staphylococcus aureus. Emerg Infect Dis 7: Eady EA, Cove JH (2003) Staphylococcal resistance revisited: community-acquired

155 148 Teruyo Ito et al. methicillin resistant Staphylococcus aureus an emerging problem for the management of skin and soft tissue infections. Curr Opin Infect Dis 16: Okuma K, Iwakawa K, Turnidge JD et al (2002) Dissemination of new methicillinresistant Staphylococcus aureus clones in the community. J Clin Microbiol 40: Chambers HF, Deleo FR (2009) Waves of resistance: Staphylococcus aureus in the antibiotic era. Nat Rev Microbiol 7: Schijffelen MJBC, van Strijp JA, Fluit AC (2010) Whole genome analysis of a livestockassociated methicillin-resistant Staphylococcus aureus ST398 isolate from a case of human endocarditis. BMC Genomics 11: Shore AC, Deasy EC, Slickers P et al (2011) Detection of Staphylococcal cassette chromosome mec type XI carrying highly divergent meca, meci, mecr1, blaz, and ccr genes in human clinical isolates of clonal complex 130 methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 55: Han X, Ito T, Takeuchi F et al (2009) Identification of a novel variant of staphylococcal cassette chromosome mec, type II.5, and its truncated form by insertion of putative conjugative transposon Tn Antimicrob Agents Chemother 53: Kondo Y, Ito T, Ma XX et al (2007) Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions. Antimicrob Agents Chemother 51: Ma XX, Ito T, Chongtrakool P, Hiramatsu K (2006) Predominance of clones carrying Panton-Valentine leukocidin genes among methicillin-resistant Staphylococcus aureus strains isolated in Japanese hospitals from 1979 to J Clin Microbiol 44: Berglund C, Ito T, Ma XX et al (2009) Genetic diversity of methicillin-resistant Staphylococcus aureus carrying type IV SCC mec in Orebro County and the western region of Sweden. J Antimicrob Chemother 63: Kwon NH, Park KT, Moon JS et al (2005) Staphylococcal cassette chromosome mec (SCC mec ) characterization and molecular analysis for methicillin-resistant Staphylococcus aureus and novel SCC mec subtype IVg isolated from bovine milk in Korea. J Antimicrob Chemother 56: Milheirico C, Oliveira DC, de Lencastre H (2007) Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus : SCCmec IV multiplex. J Antimicrob Chemother 60: Cavaco LM, Hasman H, Stegger M et al (2010) Cloning and occurrence of czrc, a gene conferring cadmium and zinc resistance in methicillin-resistant Staphylococcus aureus CC398 isolates. Antimicrob Agents Chemother 54: Oliveira DC, Lencastre H (2002) Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 46: Zhang K, McClure JA, Elsayed S et al (2005) Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J Clin Microbiol 43: Zhang K, McClure JA, Conly JM (2012) Enhanced multiplex PCR assay for typing of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. Mol Cell Probes 26: Milheirico C, Oliveira DC, de Lencastre H (2007) Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrob Agents Chemother 51: Oliveira DC, Wu SW, Lencastre H (2000) Genetic organization of the downstream region of the meca element in methicillin- resistant Staphylococcus aureus isolates carrying different polymorphisms of this region. Antimicrob Agents Chemother 44: Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning. Cold Spring Harbor Laboratory Press, USA, New York

156 Chapter 9 Genetic Interruption of Target Genes for Investigation of Virulence Factors Adhar C. Manna Abstract Recently, more emphasis has been given to understand molecular genetics and the contribution of a gene in the disease process. In fact, increased understanding of bacterial pathogenesis and intracellular communication has revealed many potential strategies for development of novel agents to treat bacterial infection. Therefore, to study the function and the involvement of a particular gene in pathogenesis, the inactivation or interruption is very important. In this section, various methods leading to inactivation of the gene in Staphylococcus aureus will be discussed. Key words Staphylococcus aureus, Gene inactivation, Allele replacement, Gene function, Pathogenesis 1 Introduction Staphylococcus aureus is an opportunistic pathogen with low G.C content. It causes broad range of human and animal infection and contributes substantial morbidity and mortality worldwide [ 1, 2 ]. Antibiotics are currently the treatment of choice for any S. aureus infections. Increasing resistance to these agents along with the decline in commercial development of new antibiotics has created an urgent need and a window of opportunity to introduce new treatment. Among the options, antivirulence therapy might offer an alternative to antibiotics, since these agents target the disease- causing factors, thereby disarming the pathogens of its weapons [ 3 ]. The pathogenesis and the survival of S. aureus are complex processes that involve multiple factors. Expression of many of these factors is primarily controlled by regulatory systems such as twocomponent regulatory systems and transcriptional regulators [ 4 6 ]. To understand the gene function relationships or the involvement of any gene in pathogenesis, survival, and/or any process, inactivation is a valuable approach. Several approaches have been used to construct stable gene knockouts in S. aureus [ 4, 5, 7 10 ]. Yinduo Ji (ed.), Methicillin-Resistant Staphylococcus aureus (MRSA) Protocols, Methods in Molecular Biology, vol. 1085, DOI / _9, Springer Science+Business Media, LLC

157 150 Adhar C. Manna Construction of stable gene inactivation requires the allelic exchange of a chromosomal copy (wild type) region with a modified mutated or inactivated gene region by homologous recombination. Unlike E. coli or Gram-negative microorganisms, allelic replacement or marker exchange by homologous recombination is not very efficient in S. aureus largely due to the complexity in the recombination pathways. Most of the successful gene knockouts in Staphylococcus used a S. aureus temperature-sensitive replication origin shuttle vectors [ ]. In addition, the established method for allele replacement requires the use of an antibiotic resistance cassette to mark the mutated allele or gene inactivation and subsequent selection. This allows the selection of the mutated version of the gene which is easier during the process of mutant construction. Although this method has advantage over non-antibiotic marker for strong selection pressure, the major disadvantage is that small numbers of multigene mutants can be constructed. This is due to the availability of small number of antibiotic resistance markers that can be used successfully as selective markers in Staphylococcus. Constructions of gene knockout without the use of antibiotic markers have been developed [ 12 ]. In this procedure, a color selection marker of β-galactosidase (blue colony) was used. Upon introduction of a temperature-sensitive replication origin shuttle vector containing β-galactosidase gene into S. aureus, the colonies will be blue while in the subsequent allelic homologous recombination for marker exchange will turn colonies to white in color on a selection medium. In theory using this method, an unlimited number of mutations can be introduced into S. aureus genome without the requirement of antibiotic markers. The advantages and disadvantages of this method will be discussed in the later section in this chapter. Several procedures for interruption of the chromosomal gene to construct stable mutant into S. aureus will be discussed. The basic thematic steps are cloning of the target gene, interruption of the gene by suitable marker or by deletion, cloning of the modified DNA fragment into an E. coli S. aureus shuttle vector, transformation of the recombinant plasmid construct into a restriction-deficient S. aureus strain, isolated modified plasmid and transform into the desired S. aureus strain, temperature shifting for integration and allelic exchange or homologous recombination, selection on selective medium, screening for the potential mutant strain, and finally the authentication of the desired mutant strain by various methods. Several temperature-sensitive replication origin shuttle plasmids were used such as pts1 and 2 [ 13 ], pcl52.2 [ 10 ], pmad [ 12 ], and pbt2 [ 11 ], which are derived from pe194 ts [ 7 ] or pg-host vector [ 8 ], for the construction of site- or gene-specific inactivation. In this chapter, major emphasis will be to discuss various systematic methods for the construction and authentication of the desired gene knockouts in S. aureus.

158 Genetic Interruption of Target Genes for Investigation of Virulence Factors Materials Materials required for the interruption of S. aureus chromosomal gene are the same basic materials and instruments required to study the molecular genetics of S. aureus or any microorganisms. Some of the basic materials and instruments are listed below. 2.1 Basic Equipments 2.2 Growth Media and Phage Transduction Buffer 2.3 Biochemical Reagents and Kits Thermocycler (polymerase chain reaction machine), water baths, incubator, incubator shaker, agarose gel electrophoresis system, gene pulser, microcentrifuge, UV transilluminator, and bead beater. 1. Luria Broth (LB): LB is typically used for the growth of E. coli strains. The composition of LB medium is 0.5 % yeast extract, 0.5 % sodium chloride, and 1.0 % tryptone at ph Staphylococcus -specific growth media (all media or buffers should be sterilized by autoclaving or filter sterilizing). (a) TSB: 3.0 % tryptic soya broth. (b) TSA: 3.0 % tryptic soya broth and 1.5 % agar. (c) B medium: 0.1 % glucose, 1 % casamino acid, 2.5 % yeast extract, 2.5 % sodium chloride, and 0.1 % K 2 HPO 4 at ph 7.5. Medium can be filter sterile or autoclave without glucose. 3. Phage dilution buffer for phage transduction: 1 mm MgSO 4, 4 mm CaCl 2, 50 mm Tris Cl, ph 8.0, 10 mm NaCl, 1.0 % casamino acid, and 0.1 % gelatin. 1. Taq polymerase with proofreading activity such as pfu or pwo may be used to prevent incorporation of errors during PCR of the DNA fragment containing the desired target gene region to be interrupted. 2. PCR reaction buffer: 50 mm KCl, 10 mm Tris HCl, ph 8.3, 1.5 mm MgCl 2, 0,01 % gelatin, and 0.2 mm dntps for PCR reaction pmol of each of the primers and genomic or plasmid DNA as template. Oligonucleotide primers: Primers are designed using DNA sequence data or using any primer design program from the Internet or commercially available primer design program (Invitrogen, CA). They are generally nucleotides in length and the calculated melting temperature ( T m ) is approximately between 58 and 65 C ( see Note 1 ). 4. Appropriate restriction enzymes and ligase enzyme for manipulation and construction of the interrupted gene construct are required. 5. Plasmid and genomic DNA isolation kits.

159 152 Adhar C. Manna 6. PCR production purification kit. 7. Lysostaphin (Sigma). 8. Agarose. 2.4 Bacterial Strains, Plasmids, Phages, and Growth Conditions 1. Bacterial strains: Standard E. coli strains such as JM101, DH5α, XL1 blue, or any suitable cloning strain for DNA manipulation can be used. S. aureus strain RN4220, a restriction-deficient derivative of strain , [ 14 ] is used as the initial recipient for the plasmid construct from E. coli. Any suitable desired S. aureus strain, such as the laboratory derivative of RN 8325 strain, community-associated methicillin-resistant S. aureus MW2 isolate (CA-MRSA), hospital-associated MRSA COL, Newman, or any suitable strain where the final gene interruption will be performed, is required. 2. Plasmids: The plasmids used to construct S. aureus mutant strains are standard E. coli cloning vectors such as PCR DNA fragment cloning vector, any puc series, or any suitable vector. E. coli S. aureus temperature-sensitive replication origin shuttle vectors such as pcl52.2 [ 10 ], pbt2 [ 11 ], pmad [ 12 ], pts1, or pg-host [ 8 ] vector. Most of these plasmids are derived from S. aureus origin pet194 ts vector [ 7 ]. 3. Phages: Various S. aureus -specific phages are used for mobilization of mutation or plasmid DNA from one S. aureus strain to another S. aureus strain. Several commonly used S. aureus - specific phages are φ11, φ13, φ80, φ85, and Φ52A for general transduction ( see Note 2 ). 4. Antibiotic resistance determinant: A limited number of useful markers are currently available, including tetracycline ( tetk ) derived from pcw59 [ 13 ], chloramphenicol encoded by pts2, erythromycin ( ermc ) encoded by pe194 [ 8 ], and kanamycin (ppq126) [ 9 ]. Recently, gene disruption without any antibiotic marker in S. aureus has been shown very successful. In addition, the reporter-encoded genes such as gfp or rfp (green or red fluorescence protein) may be used. 5. Antibiotics and selection agents: Various shuttle vectors used for interruption of S. aureus chromosomal genes carry at least two antibiotic resistance genes in addition to the gene knockout marker. Three major shuttle vectors pcl52.2, pbt2, and pmad are used mostly for gene knockout experiments in S. aureus. Antibiotics used for these vectors are in the following concentrations: In E. coli, pcl52.2, 75 μg/ml of spectinomycin; pbt2 and pmad, μg/ml of ampicillin; in S. aureus for plasmid, pcl52.2, 5 μg/ml of tetracycline; pbt2, 10 μg/ml of chloramphenicol; and pmad, 5 μg/ml of erythromycin; while for chromosomal copy: μg/ml of erythromycin, 3 μg/ml of tetracycline, 10 μg/ml of chloram-

160 Genetic Interruption of Target Genes for Investigation of Virulence Factors 153 phenicol, and 40 μg/ml of kanamycin. For blue color selection 150 μg/ml of 5-bromo-4-chloro-3-indolyl-β- d -galactopy ranoside (X-gal) is used on plates. 6. Growth conditions: The S. aureus cells are grown in tryptic soy broth (TSB), B medium, or on tryptic soy agar (TSA) supplemented with appropriate antibiotics when necessary. The cells can be grown overnight in TSB and then inoculated in fresh TSB (at an initial OD 600 ~0.05) and grown with continuous aeration in a shaker at 37 C or suitable temperature. Growth can be monitored by measuring changes in turbidity at nm in a spectrophotometer. 3 Methods 3.1 Cloning and Manipulation of the Desired Target Gene Genomic DNA Isolation DNA Fragment Amplifi cation by PCR Cloning and Interruption of the Target Gene Genomic DNA as template DNA can be isolated using two methods either using genomic DNA isolation kit or by phenol chloroform extraction with a modification by including an incubation at 37 C for 30 min in the presence of lysostaphin (100 μg/ml) to cell suspension. To clone the target gene for manipulation, primers are designed from 0.3 to 1.0 kb flanking each side of the target gene of interest to be interrupted. In addition primers may be incorporated with suitable restriction endonuclease sites to facilitate cloning of the amplified fragment into the cloning vector or insertion of the gene blocker ( see Note 3 ). Amplified PCR fragment can be cloned into a PCR TA cloning vector using commercial kit or digested PCR-generated fragment with suitable restriction enzyme(s) can be cloned directly into a suitable vector for further manipulation. The gene interruption can be done using different criteria as (a) complete or partial deletion of the target gene and insertion of an antibiotic resistance cassette, (b) insertion of an antibiotic resistance cassette within the target gene, and (c) complete or part of deletion of the gene. To achieve these scenarios several methods can be followed. More suitable way of gene interruption is to delete the entire open reading frame of the target gene or the region between the promoter and most of the open reading frame starting from the N-terminal. Several approaches can be adopted for the deletion of the target gene and also insertion an antibiotic resistance gene (Fig. 1 ): 1. Deletion of the region with suitable restriction endonucleases and insertion of a marker gene such as ermc or tetk.

161 154 Adhar C. Manna a Target Gene X P vector Deletion 4 1/2 b Deletion and insertion c Insertion d Cut with 1 and Target Gene X P Deletion by PCR vector antibiotic marker e f H C Target Gene X E vector H C Deletion and insertion by PCR H P Target Gene X H P E E H UP region P P Down stream region E P Antibiotic marker P Deletion by loop out by PCR Target gene region Primer 1 EcoRI Primer 2 Fig. 1 Schematic diagrams of various approaches of construction of the interruption of the target gene. Several approaches are shown as ( a ) deletion of the region with suitable restriction endonucleases, number indicates the different restriction sites and P denotes the promoter region; ( b ) deletion of the region with suitable restriction endonucleases and insertion of a marker gene; ( c ) insertion of an antibiotic marker gene directly without any deletion into a suitable restriction site; ( d ) deletion of a portion of the target gene by PCR out the entire plasmid construct and ligated; ( e ) amplifi cation of the upstream (primer 1 with HindIII site ( H ) and primer 2 with PstI site ( P )) and the downstream (primer 3 with PstI site ( P ) and primer 4 with EcoRI site ( E )) fragments as well as antibiotic marker gene with primers with PstI site at the ends; and ( f ) using mutagenesis method by looping out the region to be deleted using relatively long oligonucleotide primers incorporated with restriction site in the middle and subsequently insertion of a gene E

162 Genetic Interruption of Target Genes for Investigation of Virulence Factors Using quick change mutagenesis kit or mutagenesis method by looping out the region to be deleted using relatively long oligonucleotide primers incorporated with restriction site in the middle and subsequently insertion of a gene blocker. This can be done by PCR method or by using a clone of this DNA fragment M13 vector and subsequently using ssdna for mutagenesis. 3. PCR amplification of the region of the plasmid construct without the region to be deleted with two suitable primers containing suitable restriction site using pfu Taq polymerase (Phusion high-fidelity DNA polymerase, NEB, or any company), where an antibiotic resistance gene can be cloned. 4. Amplification of the upstream (primer 1 with HindIII site and primer 2 with PstI site) and the downstream (primer 3 with PstI site and Primer 4 with EcoRI site) fragments. Two fragments can be cloned into the multiple cloning region of temperature- sensitive shuttle or a suitable cloning vector. A fragment containing the entire antibiotic resistance gene flanking with PstI site at the both ends can be inserted at the PstI site to construct deletion and insertion construct of the target gene. 5. An antibiotic resistance gene can be inserted directly without any deletion into a suitable restriction site for the interruption of the target gene. 6. Overlapping or short gun PCR cloning. Several primers are designed in such a way that some of the primers will have overlapped DNA sequence for annealing of PCR products. Primers A and B are designed to PCR the upstream region (~ kb) of the deletion region, primers C and D are to PCR the downstream region (~ kb) of the deletion region, and primers E and F are to PCR an antibiotic marker gene (if any for insertional interruption). Now primers B and E will have about 16-nucleotide overhang sequences and complementary to each other, similarly primers F and C will have similar length complementary overhang at their 5 ends. PCR amplification of three fragments is carried out with suitable template DNAs separately. Equal amounts of PCR products are mixed and final PCR amplification for the final deletion or deletion and insertion DNA fragment is performed with primers A and D. The desired PCR product is isolated and cloned into a suitable vector ( see Notes 4 and 5 ) Cloning into a Shuttle Vector Once basic manipulation has been done in case of non-shuttle vector, the desired manipulated gene fragment with or without an inserted antibiotic resistance gene can be digested with suitable restriction enzyme(s) and cloned into the temperature-sensitive

163 156 Adhar C. Manna shuttle vector such as pcl52.2, pbt2, or pmad. Restriction digestion, PCR amplification, and DNA sequencing may verify the authentication of the construct. This final construct is now ready for the introduction into S. aureus strain. 3.2 Electro- Transformation Competent Cells Preparation Transformation of Plasmid Construct Most of the S. aureus strains are not efficient to accept plasmid DNA from non- Staphylococcus origin. A restriction modificationdeficient strain, RN4220 [ 14 ], is commonly used to accept initially the plasmid DNA from non- Staphylococcus origin such as E. coli. 1. RN4220 strain can be streaked on TSA plate from frozen stock or inoculated in TSB to prepare overnight culture. 2. Either single colony or 1:100 dilution of an overnight culture of RN4220 is inoculated in ml of B medium and incubate with shaking at 200 rpm at 37 C until the culture reaches to the early exponential phase of growth (i.e., OD 600 = ). 3. Culture is transferred into 50 ml sterile tubes and harvested by centrifugation at 4,500 g (tabletop Eppendorf centrifuge type 5810R) for 10 min at room temperature (RT). 4. Cell pellet is washed twice quickly by dissolved in sterile water in one-fourth volume (1/4) of the original culture volume and centrifuging at 4,500 g for 10 min at RT ( see Note 6 ). 5. Next, the cell pellet is dissolved in one-eighth volume (1/8) of the original culture volume in 10 % cold glycerol and incubated for min at 4 C and then harvested by centrifuging at 4,500 g for 10 min at 4 C. 6. Finally, the prepared competent cells are dissolved in onehundredth volume (1/100) of the original culture volume. 7. Prepared competent cell is ready for electro-transformation of the plasmid construct or cells in 60 μl aliquot can be stored at 80 C for further use. Plasmid DNA construct from non- Staphylococcus origin such as from E. coli can be transformed into S. aureus either by protoplast transformation or by electroporation. Most commonly and easy method of plasmid DNA transformation is electroporation, which will be discussed here. 1. To 60 μl of freshly prepared or frozen from 80 C RN4220 competent cells, add μg of plasmid DNA construct and incubate on ice for 5 10 min. 2. Transfer the cell and DNA mixture to a 0.1 cm gap electroporation cuvette already in ice and electroporate at room temperature, 100 Ω, 25 μf, and 2.4 kv ( see Note 7 ). 3. Immediately add ml of B medium or TSB and transfer to a suitable tube for incubation with shaking at 30 C for 1 h ( see Note 8 ).

164 Genetic Interruption of Target Genes for Investigation of Virulence Factors Plate 0.1 ml or more by concentrating onto TSA plates incorporating the appropriate antibiotic for the plasmid and incubate at 30 C for h. 5. Screening of the transformants for the presence of the plasmid can be performed by the isolation of plasmid DNA using plasmid mini kit with modification by including incubation with lysostaphin ( see Note 9 ). 3.3 Isolation of Plasmid DNA 3.4 Preparation of Phage Stock and Transduction of Plasmid Preparation of Phage Lysates 1. Grow S. aureus strains containing plasmid DNA with appropriate antibiotic (s) in 10 ml of TSB at a suitable temperature (normally at 37 C, otherwise for temperature-sensitive replication origin plasmid at 30 C) with shaking at 200 rpm for overnight. 2. Harvest the culture at 4,500 g (Eppendorf tabletop centrifuge type 5810R) for 10 min at 4 C. 3. Resuspend the pellet with 0.6 ml of TE (10 mm Tris HCl, ph 8.0, and 1 mm EDTA, ph 8.0). Add 0.5 ml of cold acetone ( 20 C) and incubate on ice for 15 min. 4. Centrifuge, discard supernatant, and wash with 1.0 cold TE. 5. Add 0.25 ml P1 solution (Qiagen plasmid isolation kit or any commercial or 50 mm Tris HCl ph 7.5, and 10 mm EDTA ph 8.0) to suspend the cell pellet and add lysostaphin ( μg/ml). Incubate at 37 C for 30 min. 6. Follow the standard routine protocol for plasmid DNA isolation to isolate plasmid DNA. 7. The presence and the authenticity of the plasmid DNA construct can be verified by restriction enzyme digestion and running in an agarose gel. Transfer of plasmid DNA and chromosomal mutation or gene knockout locus from strain to strain can be achieved by staphylococcal- specific transducing phages. The stock phages are prepared for phage transduction by propagating RN4220 strain and preparing phage lysate. Once the stock phages in RN4220 are made, those can be used to prepare phage lysate by infecting S. aureus strain harboring plasmid or having inactivated locus for transferring the plasmid- or gene-inactivated locus to different S. aureus strain. 1. Grow a lawn of cells (i.e., RN4220 or strain containing plasmid DNA or having chromosomal mutation with suitable selection marker) on TSA plate for overnight. 2. Scoop out 6 7 loopful of cells from plate in phage buffer and dissolve to a uniform cell suspension. 3. Mix 0.2 ml of cell suspension and 0.2 ml of stock phage lysate (i.e., Φ11 or Φ80) ( cfu/ml) and incubate for 5 min at room temperature for the infection or absorption of phages.

165 158 Adhar C. Manna 4. Add 3.0 ml of soft agar TSA (0.7 % agar in TSB or 1:1 dilution of TSA and TSB) from 42 C, quickly mix by inverting tube and overlay on to TSA plate containing 50 mm CaCl After 20 min at room temperature, plates are incubated at 37 C for 3 4 h for clearing ( see Note 10 ). 6. Add 5.0 ml of TSB on to each plate and scoop out the top layer into a 50 ml tube and vortex for 1 min each for several times for uniform suspension and wait for 30 min ( see Note 11 ). 7. Centrifuge for 20 min at 4,500 g at RT. The supernatant is recentrifuged and the final supernatant is passed through a 0.22 or 0.45 μm syringe filter. The phage stock can be stored at 4 C for several months Phage Transduction 3.5 Construction of Putative Mutant in S. aureus by Allele Replacement with Temperature Shifting Phage transduction can be utilized to transfer plasmid DNA or chromosomal mutation with selection marker from strain to strain. 1. Grow the strain to be transduced on TSA plate for overnight. 2. Scoop out 6 7 loopful of the cells from plate in the phage dilution buffer. Resuspend by pipetting back and forth. 3. Mix well 0.2 ml of cells and 0.25 ml of phage lysate prepared from strain containing either plasmid DNA or chromosomal gene mutation with suitable marker (~10 9 cfu/ml). Incubate for 5 10 min at RT for absorption of phages. 4. Add 2.5 ml of sodium citrate (0.02 M) per tube and immediately centrifuge at 4,500 g for 6 min ( see Note 12 ). 5. Cell pellet is dissolved in 1.0 ml of TSB containing 0.5 % of sodium citrate and incubate at 37 C (or 30 C) for 1 h. 6. Add 2.5 ml of soft agar from 42 C per tube and immediately pour onto TSA plate containing appropriate selection marker (plasmid-encoded or chromosomal gene knockout marker). If required these plates can have sodium citrate (0.05 %) to eliminate external phages. 7. Wait for 20 min before transferring plates into 30 or 37 C incubator for incubation for h for the appearance of antibiotic- resistant colonies ( see Note 13 ). Construction of putative mutant in S. aureus can be done using two basic methods, transposon mutagenesis (will not be discussed here) and site-specific targeted mutagenesis. Site-specific targeted gene interruption involves two-step strategies that proceed by homologous recombination between a target gene and homologous sequences carried on a plasmid, which is temperature sensitive for DNA replication. After transformation of plasmid construct into the desired host strain, integration of the plasmid into the chromosome by a single crossover event is selected during growth at the nonpermissive temperature (42 44 C) while maintaining

166 Genetic Interruption of Target Genes for Investigation of Virulence Factors 159 selection pressure. Subsequent growth of the co-integration mutants at the permissive temperature (30 C) leads to a second recombination event (Fig. 2 ), resulting in their resolution and the loss of plasmid DNA. Using these principles we will describe three strategies for the construction of site-specific targeted gene interruption in Staphylococcus: (1) using positive selection with antibiotic gene at the gene interruption site [ 16 ], (2) selection by colorimetric screening of the candidate clones [ 12 ], and (3) using commercial kit [ 17 ]. It should be pointed out that the restrictive temperature for temperature-sensitive replication may vary by 1 3 C depending on the strain and will need to be tested empirically. Moreover, temperature-sensitive ( ts ) replication mutations revert to temperature independence at a significant frequency. This should be kept in mind during temperature shift experiments Positive Selection Pressure with Antibiotic Gene 1. S. aureus strain containing the plasmid construct is grown overnight at the permissive temperature of 30 C in 10 ml of TSB in the presence of appropriate antibiotics such as tetracycline (5 μg/ml) and erythromycin (5 μg/ml) for pcl52.2 containing inactivated gene X with ermc gene marker. 2. Culture is diluted from 10 5 to 10 8, and 0.1 ml of dilutions is plated in duplicate onto TSA containing appropriate antibiotics. Plates are incubated at either the nonpermissive temperature of 42 C or the permissive temperature at 30 C as control. 3. Colonies growing at 42 C are subcultured twice to single colonies on TSA containing appropriate antibiotics and 0.05 % sodium citrate (if plasmid construct is introduced into host by transduction) at 42 C to ensure pure single crossover integrants. 4. Several rounds of temperature shifts from 30 to 42 C are carried out in 10 ml of TSB in the presence of the gene knockout selective antibiotic or no antibiotic for 8 10 h. Each time a 1/200 dilution of the grown culture is inoculated into fresh TSB. 5. After 3 4 rounds of dilutions and temperature shifts have been carried out, 0.1 ml volume of dilution from 10 5 to 10 8 is then plated onto TSA plates containing either single (geneinactivated cassette) or double antibiotics (plasmid-encoded and gene- inactivated cassette). Plates are incubated in 30 or 37 C for h. The colonies are scored and compared for any differences in cfu ( see Note 14 ). 6. If a substantial difference in the number of colonies formed between the two plates, then colonies from single antibiotic (potential double crossover) plates are cross-streak onto fresh TSA plates containing single antibiotic against double antibiotics. Plates are incubated at 30 or 37 C for overnight.

167 160 Adhar C. Manna Fig. 2 Schematic representation of allelic replacement. ( a ) genetic components required for generation of a plasmid construct for gene interruption by allelic exchange. Construct can be constructed using any of the approaches described in Fig. 1 and here use PCR method to generate DNA fragments specifi c for regions fl anking the gene of interest. Small arrows indicate the position of PCR primers, while the hatched box represents an antibiotic resistance marker; ( b ) complete plasmid construct; and ( c ) representation of an S. aureus strain with chromosomal wild-type gene of interest ( large circle with arrow ) and plasmid with mutant allele ( small circle ). (d ) and ( e ) a single-point crossover integration event results in both the wild-type and mutant copies of the target gene in the chromosome. ( f ) and ( g ) a second crossover event results in a single copy (mutated) of the gene in the chromosome (Adopted from ref. [ 20 ], Humana, NJ, USA)

168 Genetic Interruption of Target Genes for Investigation of Virulence Factors The colonies growing only on single antibiotic (i.e., erythromycin) but not on double antibiotics are the potential double crossover or mutant strains. The authenticity of the putative mutant strains or the presence of a stably interrupted gene can be verified using several methods that will be discussed later in Subheading To avoid any unnecessary genetic variability due to the temperature shifts, the chromosomal gene interruption region can be transferred by phage transduction. Phage lysate can be made from the mutant strain and transduction can be performed using fresh new strain to transfer the interrupted desired locus. The authenticity of the mutant strain can be verified by using various methods as described in Subheading Colorimetric Screening of the Candidate Clones This approach used the same temperature-sensitive replication origin shuttle vector and site-specific recombination event, while the selection for allelic replacement utilizes the color selection instead of an antibiotic marker. The shuttle vector pmad [ 12 ] has extended multiple cloning sites, antibiotic resistance genes for E. coli (i.e., ampicillin) and S. aureus (i.e., erythromycin), replication origins from pbr322 ( E. coli ) and pe194 ts ( S. aureus ), and a constitutively expressed promoter region of the S. aureus clpb gene along with promoterless bgab gene from B. stearothermophilus encoding a thermostable β-galactosidase for blue color on selection plate. 1. Plasmid pmad construct containing manipulated target gene (deletion) is transferred by electroporated into RN4220 electrocompetent cells and selected on TSA containing erythromycin and X-Gal at 30 C. 2. Plasmid DNA construct isolated from blue colony of the RN4220 background is confirmed and transferred into a suitable S. aureus strain, where final target gene interruption will be performed. 3. Pick two blue color colonies and grow separately in TSB containing erythromycin at permissive temperature at 30 C and confirm the presence of plasmid construct by analysis. Cultures are diluted to suitable dilutions and plated on TSA containing erythromycin and X-Gal. 4. Plates are incubated at 39 or 42 C to obtain integrants resulting from single crossover event via homologous sequences. Clones resulting from the integration will be blue. 5. Several light blue colonies are inoculated in TSB in the absence of antibiotic and cultured for 6 h, followed by incubation at 39 or 42 C for 3 h ( see Note 15 ).

169 162 Adhar C. Manna 6. Cultures are diluted to various dilutions, plated on TSA plates containing X-Gal without any antibiotics and incubated at 30 C for h. 7. The appearance of white colonies (10 30 %) on X-Gal plates indicates the excision of and loss of the plasmid vector. These colonies are potential mutant of the targeted gene appeared due to the double-point crossover between the homologous sequences in the plasmid and the chromosome. 8. Several white colonies are cross-streak on TSA X-Gal versus TSA erythromycin X-Gal plates to check the loss of plasmid vector. Erythromycin-sensitive colonies are supposed to be putative desired deletion mutant, which can be confirmed by using more direct genetic approaches such as PCR, Southern, and/or Northern analyses ( see Note 16 ) Using Commercial Kit 3.6 Screening for Potential Putative Mutant Site-specific chromosomal mutagenesis can be achieved using the commercial kit such as the TargeTron gene knockout system (Sigma, USA). TargeTron system is based on the group II introns from Lactococcus lactis and without use of any antibiotic marker [ 17 ]. Like transposons, group II introns can inactivate genes by inserting to a site-specific manner by retrohoming mechanism. Group II introns insert themselves via the activity of an RNA protein complex (RNP) expressed from a single plasmid provided in the kit. The RNA portion of the RNP is easily mutated to retarget (mutate) insertion into a user-specified chromosomal gene. Somewhat group II introns are like programmable restriction enzymes, with the added activity of inserting RNA into a cleaved DNA sequence. This system has been applied to various bacteria including S. aureus [ 17 ]. Detailed protocol for TargeTron can be downloaded from Sigma website ( ). Briefly, step 1, identify and select DNA target sites in the gene of interest from a computer algorithm of TargeTron Design Website; step 2, synthesize three primers, which will be used to mutate (retarget) and PCR out about 350 bp gene-mutated DNA fragment; step 3, the mutated PCR product is ligated into a linearized vector that contains the remaining intron components. The ligated reaction is transformed into the host followed by expression of the retargeted intron and selected for kanamycin marker that is activated upon chromosomal insertion. Finally, the insertion of marker and mutation is screened by using various methods as described later. To confirm that a successful allelic exchange event has occurred resulting a stably inherited mutated form of the gene, several approaches are used. As a quick method, PCR amplification across the mutated gene will reveal whether the size of the template is consistent with the presence of the mutated allele. However, the

170 Genetic Interruption of Target Genes for Investigation of Virulence Factors 163 absolute confirmation of the integrity of the mutant can be determined by genetic (Southern blot) and functional (Northern and/ or Western blots) analyses of the wild-type and the mutant strains with a probe specific for the gene of interest. These approaches required genomic DNA and the total RNA (and/or total cell extract) from the wild-type and the mutant strains, which can be isolated using stand protocols. The genomic DNA can be isolated by using genomic isolation kit, phenol chloroform extraction, or mechanical breaking of cells by bead beater or boiling diluted cells. 1. Screening by PCR: Isolation of genomic DNA from S. aureus strains has been described previously. Briefly, the isolation of genomic DNA by mechanical methods will be discussed here for quick PCR for clone analysis. Harvest ml of grown culture and dissolve the cell pellet in TE (10 mm Tris HCl, ph 7.5, and 1 mm EDTA, ph 8.0). Add half volume of glass beads (0.2 mm diameter) (0.2 ml) to the cell in a 2.0 ml tube and beat at 5 K for s, twice. Centrifuge at 15,000 g in a microcentrifuge for 5 min to remove cell debris and unbroken cells. Use 2 5 μl of supernatant as template for PCR with suitable primers. The rest of the supernatant can be stored at 20 C ( see Note 17 ). 2. Genetic confirmation by Southern blot analysis: Southern blot analysis is performed using genomic DNA isolated by either genomic isolation kit or phenol chloroform extraction method to find out the presence of the mutated copy of the target gene in the mutant strains. Change of the size of the mutated gene can be determined by comparing the wild-type copy of the gene using a probe that is specific for regions flanking the insertion site of the antibiotic marker. Genomic DNA of the wild-type and the mutant strains is digested with suitable restriction enzymes and performed Southern blotting using standard protocol [ 18 ]. 3. Functional confirmation by Northern or Western blot analysis: Expression of the target gene can be analyzed at the transcriptional and translational level. A comparative analysis of the wild type and mutant can be used to confirm the loss of transcription and production of the inactivated gene in the mutant strain. Northern blot analysis can be found in these publications [ 16, 18, 19 ]. Briefly, total cellular RNA can be isolated from either overnight or post-exponential phase growth cultures of the wildtype and isogenic mutant strains by using TRIzol reagent method (Invitrogen, CA, or any commercial company) using bead beater as described [ 16, 19 ]. The concentration of total RNA can be determined by measuring the absorbance at 260 nm. Ten micrograms of each RNA sample can be resolved on formaldehyde agarose gels and capillary blotted onto Hybond XL membrane

171 164 Adhar C. Manna (Amersham). For detecting the specific targeted transcript, the DNA probe is labeled with [-32P]dCTP using the random primed DNA labeling kit (Roche Diagnostics GmbH) or any nonradioactive labeling kit. Hybridization can be performed overnight under aqueous conditions at 64 C. After hybridization, the blots are washed and autoradiographed or detected for fluorescence band. The loss of any transcript of the interrupted gene will indicate the mutant strains are real mutant ( see Note 18 ). If an antibody for the encoded protein of interest is available, Western blot comparative analysis of the wild-type and mutant strains can be used to confirm the loss of function or phenotype in the mutant strain. Western analysis method can be obtained as described [ 19 ]. Briefly, whole-cell extracts from the wild-type and the mutant strains can be prepared from the overnight or post- exponential phase of growth. Incubate cell suspension with lysostaphin at 37 C for 1 h and followed by sonication. The concentration of total proteins of the lysates is determined by using the Bio-Rad (Hercules, CA) protein estimation kit using bovine serum albumin as the standard. Western blotting assays are performed by running equal amount of protein in a polyacrylamide- SDS gel, transferring separated proteins onto a nitrocellulose membrane, and detecting with primary (antibody raised against target gene product) and secondary antibodies as described [ 19 ]. 4 Notes 1. When designing primers avoid polybase sequences and region of predicted secondary structure in the primers. 2. It is important to know the sensitivity of a particular phage to a specific S. aureus strain before using for experiment. The phage Φ11 can be used for transduction of any NCTC8325 (human isolate) derivative strains such as RN (threeprophage- cured derivative of NCTC8325; rsbu and tcar ), RN6390 (derivative of , less producer of SigB due to the mutation in the rsbu gene), SH1000 (functional rsbu derivative of rsbu ), and HG003 ( rsbu and tcar repaired of ) [ 15 ] and clinical isolates like Newman, UAMS-1, MW2, and USA300 strains, while Φ80 phage can be used for transduction of COL strain. Master stock lysate of any phage can be prepared by infecting S. aureus RN4220 strain. Subsequently, this stock lysate can be used to infect putative gene knockout strain for preparation phage lysate that can be used to transfer of the gene knockout region into new strain or the transformation of plasmid DNA from one S. aureus strain to other.

172 Genetic Interruption of Target Genes for Investigation of Virulence Factors In general, longer homologous flanking sequences in both the ends yielded higher frequency in S. aureus ; however, variations at different genetic loci may occur. PCR amplification of the desired DNA fragment can be performed using standard PCR protocol as described by the manufacturer or by optimized laboratory protocol. The authenticity of the amplified DNA fragment can be verified by analyzing it on an agarose gel. 4. If necessary primers A and D may have restriction site at the 5 ends to facilitate cloning into a suitable vector. 5. It is important to select carefully a site near the N-terminal region for insertion of an antibiotic resistance gene cassette to inactivate the entire target gene. Otherwise, inserting near the C-terminal may lead to a partial or complete functional target gene product. Although these are the few basic approaches described here, other suitable approaches can be used based on standardized approaches in the individual laboratory. 6. Pellet should be dissolved by pipetting back and forth and advisable not to vortex to avoid lysis of cells. 7. Storing cuvette in ice or pre-chill can reduce killing of the cells due to generation of heat within the sample during this process with high voltage. 8. Selection of incubation temperature is important for recovery of competent cells as well as expression of temperature- sensitive replication origin plasmid. 37 C temperature can be used, which can lead to integration or loss of plasmid. 9. After harvesting and washing cells containing plasmid DNA are incubated with lysostaphin at 37 C for 30 min for efficient lysis of Staphylococcus cells ( Staphylococcus cells are resistant to lysozyme). 10. A control without added phage can be done to compare the formation of the lawn versus clearing. 11. It is very important to have uniform suspension for the recovery of the phages. 12. External phages (i.e., Φ11) can be killed by citrate as they are sensitive to citrate. Sodium citrate solution can be made freshly for better result and it can go off after several weeks storage at room temperature. 13. The basic protocols describe here can be varied depending on the laboratories. Instead of preparing initial cells on plate, one can grow cells in broth. In addition, the step 2 may be optional and cell and phage mixture can be poured directly onto the selection plates containing % sodium citrate. Transductants should be subcultured twice to a single colony on TSA containing sodium citrate to ensure the loss of transducing phage. Very occasionally strains that have previously

173 166 Adhar C. Manna been recipients in the transduction experiments may become lysogenized with phage, resulting in strains that are resistant to superinfection. In such a case, transduction will not be successful unless a different phage or strain is used for the experiments. 14. The double-point crossover strains will retain the antibiotic resistance encoded by the cassette marking the mutant gene interruption. It will lose the antibiotic resistance that is encoded by the plasmid. 15. Light blue colonies indicate integration of a single plasmid into the chromosome, while dark blue colonies are indicative of the presence of multiple copies of plasmid. 16. A parallel experiment with the wild-type strain without any plasmid vector can be performed as a control. This strain can serve as one of the wild-type strains as control for phenotypic characterization and genetic and functional analyses of the mutant strain. 17. One can perform colony PCR by isolating genomic DNA from a single colony. Pick and suspend single colony in 0.2 ml of TE (addition of lysostaphin and short incubation may be performed for efficient lysis) and boil for 5 min to release genomic DNA. Subsequently, PCR reaction can be performed using 2 5 μl of supernatant as template and suitable primers to find out the presence of the mutated allele in the putative mutant strains. 18. It may be noted that it would be difficult to conclude if the transcription of the target gene is undetectable, in that case PCR and Southern blot analysis are the best approaches to confirm the allelic replacement in the mutant strains. References 1. Klevens RM, Morrison MA, Nadle J et al (2007) Invasive methicillin-resistant Staphylococcus aureus infections in the United States. JAMA 298: DeLeo FR, Chambers HF (2009) Reemergence of antibiotic-resistant Staphylococcus aureus in the genomics era. J Clin Invest 119: Shoham M (2011) Antivirulence agents against MRSA. Future Med Chem 3: Foster T (1998) Molecular genetic analysis of staphylococcal virulence. In: Williams P, Ketley J, Salmond GPC (eds) Methods in microbiology, bacterial pathogenesis, vol 27. Academic, San Diego, pp Boyce JM (1997) Epidemiology and prevention of nosocomial infections. In: Crossley KB, Archer GL (eds) The staphylococci in human disease. Churchill Livingstone, NY, pp Novick RP (1991) The Staphylococcus as a molecular genetic system. In: Novick RP (ed) Molecular biology of the Staphylococci. VCH, New York, pp O Reilly M, de Azavedo JC, Kennedy S et al (1986) Inactivation of the alpha-haemolysin gene of Staphylococcus aureus by sitedirected mutagenesis and studies on the expression of its haemolysins. Microb Pathog 1: Maguin E, Prevost H, Ehrlich SD et al (1996) Efficient insertional mutagenesis in lactococci and other gram-positive bacteria. J Bacteriol 178: Luchansky JB, Benson AK, Atherly AG (1989) Construction, transfer and properties of a

174 Genetic Interruption of Target Genes for Investigation of Virulence Factors 167 novel temperature-sensitive integrable plasmid for genomic analysis of Staphylococcus aureus. Mol Microbiol 3: Lee CY (1992) Cloning of genes affecting capsule expression in Staphylococcus aureus strain. Mol Microbiol 6: Bruckner R (1997) Gene replacement in Staphylococcus carnosus and Staphylococcus xylosus. FEMS Microbiol Lett 151: Arnaud M, Chastanet A, Debarbouille M (2004) New vector for efficient allelic replacement in naturally nontransformable, low-gccontent, gram-positive bacteria. Appl Environ Microbiol 70: Greene C, McDevitt D, Francois P et al (1995) Adhesion properties of mutants of Staphylococcus aureus defective in fibronectinbinding proteins and studies on the expression of fnb genes. Mol Microbiol 17: Kreiswirth BN, Lofdahl S, Betley MJ et al (1983) The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature 305: Herbert S, Ziebandt A-K, Ohlsen K et al (2010) Repair of global regulators in S. aureus 8325 and comparative analysis with other clinical isolates. Infect Immun 78: Manna A, Cheung AL (2001) Characterization of sarr, a modulator of sar expression in Staphylococcus aureus. Infect Immun 69: Yao J, Zhong J, Fang Y et al (2006) Use of targetrons to disrupt essential and nonessential genes in Staphylococcus aureus reveals temperature sensitivity of Ll.LtrB group II intron splicing. RNA 12: Maniatis T, Fritsch EF, Sambrook J (1989) Molecular cloning: a laboratory manual, 2nd edn. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 19. Ballal A, Manna AC (2009) Expression of sara -family gene s in S. aureus strains. Microbiology 155: Fitzgerald JR (1998) Targeted gene disruption for the analysis of virulence of Staphylococcus aureus. In: Ji Y (ed) Methods in molecular biology: MRSA protocols. Humana, NJ, pp

175 Chapter 10 Molecular Analysis of Staphylococcal Superantigens Wilmara Salgado-Pabón, Laura C. Case-Cook, and Patrick M. Schlievert Abstract Staphylococcal superantigens (SAgs) comprise a large family of exotoxins produced by Staphylococcus aureus strains. These exotoxins are important in a variety of serious human diseases, including menstrual and nonmenstrual toxic shock syndrome (TSS), staphylococcal pneumonia and infective endocarditis, and recently described staphylococcal purpura fulminans and extreme pyrexia syndrome. In addition, these SAg exotoxins are being increasingly recognized for their possible roles in many other human diseases, such as atopic dermatitis, Kawasaki syndrome, nasal polyposis, and certain autoimmune disorders. To clarify the full spectrum of human diseases caused by staphylococcal SAgs, it is necessary to have assays for them. At present there are 23 characterized, serologically distinct SAgs made by S. aureus : TSS toxin- 1(TSST-1); staphylococcal enterotoxins (SEs) A, B (multiple variant forms exist), C (multiple minor variant forms exist), D, E, and G; and SE-like H, I, J, K, L, M, N, O, P, Q, R, S, T, U, V, and X. The most straightforward way to analyze S. aureus strains for SAgs is through polymerase chain reaction for their genes; we provide here our method for this analysis. Although it would be ideal to confirm that all of the same SAgs are produced by S. aureus strains that have the genes, antibody reagents for SAg detection are only available for TSST-1; SEs A E and G; and enterotoxin-like proteins H, I, Q, and X. We provide a Western immunoblot procedure that allows in vitro quantification of these SAgs. Key words Superantigens, Staphylococcus aureus, Toxic shock syndrome, Pneumonia, Infective endocarditis, Purpura fulminans, Extreme pyrexia 1 Introduction Staphylococcus aureus causes a large number of human diseases, ranging from benign pimples and boils to life-threatening toxic shock syndrome (TSS), necrotizing pneumonia, infective endocarditis, purpura fulminans, and extreme pyrexia syndrome [ 1 7 ]. The organism has an array of cell-surface and cell-secreted virulence factors that allow it to cause illnesses [ 6 ]. The surface virulence factors allow the organism to colonize the host through adhesion to mucosal surfaces and resistance to phagocytosis. The secreted factors, including exoenzymes and exotoxins, allow the organism to interfere with normal immune system function, spread Yinduo Ji (ed.), Methicillin-Resistant Staphylococcus aureus (MRSA) Protocols, Methods in Molecular Biology, vol. 1085, DOI / _10, Springer Science+Business Media, LLC

176 170 Wilmara Salgado-Pabón et al. into surrounding tissues, and access nutrients through cell damage. Among the secreted virulence factors that have known roles in serious human diseases are the superantigens (SAgs) [ 7, 8 ]. SAgs are simple protein exotoxins secreted by S. aureus strains, with one exception, as variable traits, meaning that some strains make the proteins, whereas others do not [ 7, 8 ]. The SAg family made by S. aureus includes TSST-1, the cause of nearly all menstrual TSS and half of nonmenstrual TSS [ 2, 9 11 ]; staphylococcal enterotoxin (SE) serotypes A, B n, C n (in which n denotes that multiple variant forms exist), D, E, and G; and SE-like serotypes H, I, and J X [ 12 ]. Incidentally, there is no enterotoxin F, because this protein was renamed TSST-1 in Of these SAgs, SEs A E and G have the ability to induce emesis in monkeys and are thus correctly referred to as SEs [ 12 ]. The remaining SAgs either have not been tested for emetic activity or lack emetic activity; and they are thus correctly referred to as enterotoxin-like proteins (SE-like G, H, and J X) and TSST-1 [ 12 ]. All SEs and SE-like SAgs are able to cause nonmenstrual TSS illnesses [ 7, 8 ], but only SEG appears also to be associated rarely with menstrual TSS [ 13 ]. For purposes of this chapter, we provide methods to study TSST-1, SEs A E and G, and SE-like proteins H X. Their genes have been well characterized, and specific DNA primers may be made for their detection [ 12 ]. We also provide methods for quantifying production of selected SAg proteins to confirm gene function. These include tests for TSST-1; SEs A E; and SE-like proteins G, H, and Q. Many of these proteins appear to be made in higher concentrations in vitro than the other SAgs, and they have been associated with human diseases [ 2, 7, 8, 10, 11, 13, 14 ]. Assays for other SAgs can be developed based on the techniques provided. TSS is defined by the presence of fever, hypotension/shock, a red rash, desquamation of the skin on recovery, and a variable multiorgan component [ ]. Many TSS patients do not meet all five of these defining criteria, which has led to the establishment of categories of illness including probable TSS and toxin-mediated disease [ 18, 19 ]. Thus, although it is clear that SAgs cause TSS, the spectrum of TSS illnesses remains to be defined completely. It is relatively easy to identify menstrual TSS, but there are large numbers of categories of nonmenstrual TSSlike illnesses, many of which are only now being associated with SAg production and S. aureus. Nonmenstrual TSS-like illnesses include illness associated with wounds, boils, and abscesses [ 19 ]; postsurgical [ 19 ]; post- respiratory virus TSS [ 5, 20 ]; purpura fulminans [ 5 ]; extreme pyrexia syndrome; necrotizing pneumonia [ 1, 14 ]; and recalcitrant erythematous desquamating disorder of patients with acquired immunodeficiency syndrome [ 21 ]. Other illnesses that may be associated with staphylococcal SAg production include infective endocarditis, atopic dermatitis and anaphylactic reactions [ 22, 23 ], nasal polyposis [ 3 ], mycosis fungoides

177 Molecular Analysis of Staphylococcal Superantigens 171 (cutaneous T-cell lymphoma) [ 24 ], Kawasaki-like illness [ 25 ], and some cases of acute onset rheumatoid arthritis. To understand the role of staphylococcal SAgs in human illnesses, assays have been developed for their measurement. These include polymerase chain reaction (PCR)-based techniques to demonstrate the presence of the genes, followed by antibody-based assays for protein production. These latter antibody assays were previously unnecessary for measures of TSST-1 and SEs B and C, because there was a one-to-one correlation between the presence of the genes and production of high levels of protein by the strains [ 8, 26 ]. This is not the case with other SAgs, e.g., SEA-positive strains may make undetectable protein (<5 pg/ml to 5 μg/ml) in vitro, depending on the strain analyzed. SAgs have an unusual mechanism of action in their activation of the immune system, and thus, they are often used as probes of immune system function. Such studies are likely to become even more important as the spectrum of SAg illnesses expands, including into autoimmunity. SAgs act by causing T-lymphocyte proliferation independent of the antigenic specificity of the T cell; rather, such proliferation is dependent on the composition of the variable region of the β-chain of the typical α β T-cell receptor (TCR) [ 7, 27 ]. Thus, TSST-1 stimulates all human T cells with the β-chain TCR variable region 2 (VβTCR-2), but not other T cells. The consequence of this stimulation is that VβTCR-2 T cells may expand to become % of all of a TSS patient s T cells during acute TSS, as opposed to 10 % normally. The ability of the SAgs to stimulate T cells also depends on the proteins abilities to bind to major histocompatibility complex II (MHC II) molecules on the surface of antigen-presenting cells, most importantly macrophages [ 7 ]. The consequence of the cross bridging of VβTCR on T cells with MHC II on macrophages is massive cytokine release by macrophages (tumor necrosis factor-α [TNF-α] and interleukin-1β) and T cells (TNF-β and interferon-γ) and consequent TSS illness [ 7 ]. Presumably, variations in amounts and types of SAgs made by S. aureus strains control the severity and type of illness produced. 2 Materials 2.1 S. aureus Strains 1. Control S. aureus strains for detection of SAg genes: TSS strain MN8 for TSST-1 and atopic dermatitis strain MN22 for all others; the latter strain is a naturally occurring clinical isolate with the genes for all SAgs except TSST-1 ( see Note 1 ). 2. Control S. aureus strains for detection of SAg production: strain MN8 for production of TSST-1; CDC 11 for SEA; community- associated methicillin-resistant USA400 necrotizing pneumonia isolate c for SEB; community-associated

178 172 Wilmara Salgado-Pabón et al. methicillin-resistant USA400 necrotizing pneumonia isolate MW2 for SEC and SEH; isolate KSI1410 for SED; FRI 918 for SEE; MN6 for SEG; and MNNJ for SE-like Q ( see Note 2 ). Production of the remaining SAgs is not well characterized; thus, we do not present data related to detection of their proteins. 3. SAgs SEs A E, SE-like H, and TSST-1: these may be purchased from Toxin Technology (Sarasota, FL), to serve as control proteins. It is important to assay these proteins by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) since commercially available proteins sometimes have significant contaminants. The Schlievert s laboratory makes all necessary SAgs to serve as controls. A detailed description of their production is beyond the scope of this chapter but has been provided elsewhere [ 4 ]. 4. Todd Hewitt broth for growth of S. aureus strains. 2.2 Polymerase Chain Reaction 1. Bacteria grown overnight in 25 ml of THB. 2. DNeasy Tissue Kit (Qiagen, Valencia, CA) for DNA extraction. 3. Taq DNA polymerase (Qiagen) or Phusion high-fidelity DNA polymerase (NEB). 4. Primers ( see Table 1 ) from Integrated DNA Technologies (IDT, Coralville, IA). They are ordered DESALT and on a Table 1 PCR primers for SAg genes (TSST-1, SEs, and SE-like [SE l ]) presented from 5 to 3 Primer name Primer sequence Estimated size (bp) SEA forward GATTCACAAAGGATATTGTTGATAAATAT 400 SEA reverse GTCCTTGAGCACCAAATAAATC SEB forward GTATGATGATAATCATGTATCAGCAA 625 SEB reverse CGTAAGATAAACTTCAATCTTCACAT SEC forward GAGTCAACCAGACCCTATGCC 650 SEC reverse CGCCTGGTGCAGGCATC SED forward GCATTACTCTTTTTTACTAGTTTGGTA 530 SED reverse CCTTGCTTGTGCATCTAATTC SEE forward CTGAATTACAAAGAAATGCTTTAAGC 420 SEE reverse GCCTTGCCTGAAGATCTA SEG forward AATTCCCAACCCGATCCTAAAATAG 708 SEG reverse TCAGTGAGTATTAAGAAATACTTCCATTTTAATAC SE l -H forward TCACATCATATGCGAAAGCAG 357 SE l -H reverse TAGCACCAATCACCCTTTCC (continued)

179 Molecular Analysis of Staphylococcal Superantigens 173 Table 1 (continued) Primer name Primer sequence Estimated size (bp) SE l -I forward CAAGGAGATATTGGTGTAGGTAAC 657 SE l -I reverse TTAGTTACTATCTACATATGATATTTCAACATC SE l -J forward CAGCGATAGCAAAAATGAAACA 450 SE l -J reverse CCCTCTTCTAGCGGAACAAC SE l -K forward TGGATCAATGGAAATCAACAAAA 420 SE l -K reverse CGGGCTACCCGAAAAATAAT SE l -L forward CTGTTTGATGCTTGCCATTG 370 SE l -L reverse GCGATGTAGGTCCAGGAAC SE l -M forward GATGTTGGAGTTTTGAATCTTAGGAAC 654 SE l -M reverse TCAACTTTCGTCCTTATAAGATATTTCTACATC SE l -N forward GATGTAGACAAAAATGATTTAAAGAAAAAATC 684 SE l -N reverse TTAATCTTTATATAAAAATACATCGATATGATAATTAG SE l -O forward AATGAAGAAAATCCTAAAATTGAGG 699 SE l -O reverse TTATGTAAATAAATAAACATCAATATGATAGTC SE l -P forward ACCAACCGAATCACCAGAAG 400 SE l -P reverse GTTCAAAAGACACCGCCAAT SE l -Q forward GATGTAGGGGTAATCAACCTTAG 500 SE l -Q reverse CTCTCTGCTTGACCAGTTCC SE l -R forward TACTATGGGGAATGTTGAATCC 558 SE l -R reverse GGTATAAAGGGAACCAAATCC SE l -S forward CTAACTCTTGAATTGTAGGTTCC 332 SE l -S reverse CTCCACACAACTATTATCAAACG SE l -T forward TCGGGTGTTACTTCTGTTTGC 170 SE l -T reverse GGTGATTATGTAGATGCTTGGG SE l -U forward AAACCAGAACAATTGAATAAAGCG 714 SE l -U reverse TTATTTTTTGGTTAAATGAACTTCTACATTAATAG SE l -X forward TCTATGGGGGAACATTTGGA 420 SE l -X reverse CCGCCATCTTTTGTATTTATGA TSST-1 forward GAAATTTTTCATCGTAAGCCCTTTGTTG 655 TSST-1 reverse TTCATCAATATTTATAGGTGGTTTTTCA 0.05-μmol scale. Once received, resuspend the primers in distilled deionized water to a final concentration of 50 pmol/μl ( see Note 3 ). 5. TempAssure single tubes, strips, or plates (0.2 ml) to carry out the reactions (USA Scientific, Ocala, FL). 6. PCR thermocycler, no gradient required.

180 174 Wilmara Salgado-Pabón et al. 7. DNA gel: (a) Type 1 agarose. (b) Tris acetate EDTA (TAE) buffer or Tris borate EDTA buffer (TBE) made at a 50 or 5 concentration, respectively. The 50 TAE buffer is made with 242 g of Tris base, 57.1 ml glacial acetic acid, 100 ml of 0.5 M EDTA (ph 8.0), and distilled deionized water to a final volume of 1 l. The 5 TBE buffer is made with 54 g Tris base, 27.5 g boric acid, 20 ml of 0.5 M EDTA (ph 8.0), and distilled deionized water to a final volume of 1 l. The 0.5 M EDTA (ph 8.0) is made with 186 g EDTA per liter (ph to 8.0 with ~20 g/l of sodium hydroxide pellets). 8. DNA gel apparatus QS-710 (International Biotechnologies, New Haven, CT) kb plus DNA ladder. 10. Premixed ethidium bromide solution, 10 mg/ml (Bio- Rad). This chemical is a DNA intercalating agent and very hazardous. If made in the lab, ethidium bromide must be weighed out only under a chemical hood and handled with gloves. 2.3 Antisera 2.4 Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-PAGE) 1. Polyclonal hyperimmune antisera against the SAgs SEs A E, SE-like H, and TSST-1 (Toxin Technology, Sarasota, FL) ( see Note 4 ). It is important to note that these commercially available antisera are made monospecific by various absorption techniques, and this may interfere with some assays. Hyperimmune antisera against SEG and SE-like Q are not commercially available, but we produce antisera in rabbits. 2. Antisera made by immunization of rabbits with the various purified SAgs. It is our experience that injection of 25 μg of SAg emulsified in incomplete Freund s adjuvant into the nape of the neck of rabbits every other week for three to four injections results in high-level serum antibody titers % Acrylamide/Bis, 37.5:1 (2.6 % C) from Bio-Rad. Acrylamide is neurotoxic; care should be taken when working with this compound. 2. TEMED M Tris HCl, ph 8.8 for resolving (lower) gel. Store at room temperature M Tris HCl, ph 6.8 for stacking (upper) gel. Store at room temperature % solution of ammonium persulfate (APS) in deionized distilled water. Prepare fresh each time (for adequate gel polymerization) % SDS in deionized distilled water.

181 Molecular Analysis of Staphylococcal Superantigens Running buffer (4 l): g Tris base, g glycine, 2 g of SDS, and deionized distilled water up to 4 l. The final concentrations are 0.05 M Tris base, 0.4 M glycine, and 0.1 % (w/v) SDS. Store at room temperature. 8. Sample buffer (2 ): M Tris HCl, ph 6.8, 4 % (w/v) SDS, 20 % (v/v) glycerol, 2 % (v/v) 2-mercaptoethanol, and % (w/v) bromophenol blue in deionized distilled water. Sample buffer can be made more concentrated if a larger sample volume is desired. 9. Prestained molecular weight markers (SeeBlue Plus2; Invitrogen, Carlsbad, CA). 10. SDS-PAGE and Western transfer apparatus: we use a Bio- Rad mini PROTEAN 3 Cell and Western transfer apparatus (Hercules, CA). 2.5 Western Immunoblotting 1. Transfer buffer: for transfer buffer without methanol, dissolve 6 g of Tris base and 7.3 g of glycine in up to 2 l of deionized distilled water. For transfer buffer with methanol, dissolve 6.04 g of Tris and 28.8 g of glycine in 1.6 l of deionized distilled water, and add 200 ml of methanol and deionized distilled water to a final volume of 2 l. 2. Immunoblot polyvinyl difluoride (PVDF) membrane (Bio- Rad) and methanol to equilibrate the PVDF membrane. 3. Tris-buffered saline (TBS): 0.61 g Tris base, 4.38 g NaCl, and deionized distilled water to a final volume of 500 ml. For TBS- Tween- 20 (TBST), add 250 μl of Tween 20 to a 500-ml volume of TBS. Final concentrations are 0.01 M Tris HCl, ph 7.5, 0.05 M NaCl, and 0.5 % (v/v) Tween Blocking solution: 1 % (w/v) bovine serum albumin (BSA) in TBST. For example, add 0.3 g of BSA to a 30-ml volume of TBST. 5. Primary antibody: usually μl in 20 ml of TBST. 6. Secondary antibody: usually μl in 20 ml of TBST. Alkaline phosphatase-conjugated anti-rabbit IgG (Sigma-Aldrich). 7. Alkaline phosphatase (AP) buffer: 20-ml volume per blot containing 1 ml of 1 M Tris HCl, ph 9.6, 80 μl of 1 M MgCl 2, and 19 ml of deionized distilled water. AP buffer can be made in larger volumes (e.g., l) and stored at room temperature. 8. NBT substrate: nitroblue tetrazolium dye to a final concentration of 2 mg/ml of water. Store at 20 C. 9. BCIP substrate: 5-bromo-4-chloro-3 indolyl phosphate to a final concentration of 5 mg/ml of dimethylformamide (DMF). Dissolve 0.05 g of BCIP in 10 ml of DMF and store at 20 C covered in foil (light sensitive). Note that DMF is volatile and toxic; review the chemical safety information before handling this product.

182 176 Wilmara Salgado-Pabón et al. 2.6 Density Scans 1. Image J 1.34S program from NIH (this can be downloaded from ). 3 Methods For assessing the presence of the genes for all known SAgs and the proteins for SEs A E and G, SE-like H and Q, and TSST-1, strains to be analyzed plus controls are cultured aerobically (with shaking at 200 rpm) at 37 C until the organisms are well into stationary phase. Most SAgs are made either during the exponential phase (from an initial absorbance of 0 to 1.0 at 600 nm wavelength; examples are SEA and SE-like K) or post exponential phase (from 1.0 to approx. 3.0 absorbance at 600 nm; examples are SEB, SEC, and TSST-1). We use THB as the growth medium. 3.1 Polymerase Chain Reaction 1. Grow bacteria overnight in 25 ml of THB at 37 C with shaking at 200 rpm. Add the grown culture (1.5 ml) to a microcentrifuge tube and spin down at 14,000 g for 2 min. Aspirate the supernate, and extract the DNA from the pellet according to the protocol found on page 33 of the DNeasy Tissue Handbook provided by the supplier of the kit. There are two deviations from the DNeasy method: (a) Add 20 μl of lysostaphin to the DNeasy enzymatic lysis buffer ( see Note 5 ). Lysostaphin can be purchased from Sigma- Aldrich and is resuspended in distilled water to a final concentration of 1 mg/ml (it can be stored frozen with repetitive freeze/thaws at 20 C until used). The enzymatic lysis buffer is made fresh for each batch of bacteria grown. (b) Instead of performing elutions twice with 200 μl of EB buffer each time, elute the DNA twice with 100 μl of water each time. 2. After the DNA is extracted in a final volume of 200 μl, make the PCR reaction mixture, and keep it on ice during the preparation. To perform PCR of the genes, add 1 μl of bacterial DNA to a 0.2-ml tube to make a 50-μl total volume reaction. Follow the manufacturer s instruction for the addition of primers, reaction buffer, dntps, and polymerase, as they vary depending on the polymerase of choice. The PCR reaction can also be performed in 30-μl volumes. Include positive and negative control bacterial DNA samples. 3. After all reaction mixtures are made, tightly close the caps of the tubes, and insert the tubes into PCR thermocycler. Calculate the annealing temperature optimal for the primer pair according to the polymerase used (Taq usually requires lower annealing temperatures than Phusion). The New England Biolabs (NEB) website provides annealing temperatures for a primer pair according

183 Molecular Analysis of Staphylococcal Superantigens 177 to the polymerase of choice. Follow the cycle settings of the polymerase used for a total of 30 cycles. The initial DNA denaturation step can be carried out for 1 3 min, and the final elongation step can be carried out for 4 min. The extension time will depend on the polymerase used and the expected DNA fragment size, estimate accordingly. When the cycles are completed, keep the reaction mixture at 4 C until the DNA gel is prepared and ready to be subjected to electrophoresis. 4. To make the DNA gel, dilute 50 TAE or 5 TBE buffer to 1 with distilled water. Prepare 0.8 % agarose gels by adding 4 g of agarose to 500 ml of 1 TAE or TBE buffer. Microwave the mixture until it becomes clear. Allow the hot gel mixture to cool on the bench until bottle is cool to the touch. It is important that the gel mixture is cool enough so ethidium bromide vapors are not created when added to the gel. Add 20 μl of ethidium bromide (from 10 mg/ml premixed solution) to 500 ml of TBE or TAE gel mixture. Pour the gel into the gel tray until the bottom of the tray is covered with cm of gel. Add a comb to the gel with the appropriate number of wells (samples + ladder). 5. Once the gel has completely solidified, remove the comb, and place the gel in the gel-running apparatus. Completely submerge the gel in the same 1 buffer used to prepare the DNA gel (addition of ethidium bromide to the buffer is not required, but it increases the quality of detection of the DNA fragments). 6. Add DNA ladder (2 4 μl) to the leftmost lane, and add 10 μl of PCR products individually to additional wells (DNA loading dye should be added to the mixture if not included in the polymerase kit). DNA loading dye (6 ) can be made with 25 mg of bromophenol blue, 25 mg of xylene cyanol FF, and 1.5 g of Ficoll to a final volume of 10 ml. Attach the gel apparatus cathode and anode to a power supply, and electrophorese the samples at approx. 100 V for 1 h. 7. Take the gel to an ultraviolet (UV) light box and expose to UV light. The UV light will cause the DNA to luminesce, allowing detection of the PCR products. Products under 100 bp in length are assumed to be degraded DNA or remnants of primers. Figure 1 shows the results of testing a strain of S. aureus (FRI913) for the presence of SAg genes. The strain is positive for the SEA, SEC, SEE, TSST-1, and SE-like L, Q, and X genes ( see Note 6 ). 3.2 Growth and Preparation of S. aureus for SAg Protein Assays 1. Inoculate S. aureus strains into 10 ml THB in 125-ml Erlenmeyer flasks, and culture aerobically until stationary phase. 2. Place the samples in 50-ml conical centrifuge tubes (Falcon polypropylene; Becton, Dickinson, and Company), and add 40 ml of absolute ethanol (4 vol) to the cultures to precipitate

184 178 Wilmara Salgado-Pabón et al. Fig. 1 PCR screen for the presence of superantigens using chromosomal DNA from the S. aureus strain FRI 913 SAgs while killing the S. aureus cells. We have found that this 80 % final concentration of ethanol will precipitate 100 % of SAgs in as little as 2 h; the treated cells may remain at room temperature or 4 C for months without losing the ability to be resolubilized. 3. Collect the precipitates by centrifuging at 1,000 g for 15 min. Pour off the ethanol, and place the samples flat under a laminar flow hood for 30 min to dry off the remaining ethanol ( see Note 7 ). 4. Resuspend the samples in 1 ml of distilled water (10 times concentrated relative to the original supernate concentration), and centrifuge in a microfuge (14,000 g for 5 min). 5. Treat a small volume (100 μl) of the clarified supernates with 100 μl of 2 SDS-PAGE sample buffer, and boil for 3 5 min, or leave at room temperature overnight to denature the proteins. 3.3 Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-PAGE) As stated previously, we use the Bio-Rad mini PROTEAN 3 Cell and Western transfer apparatus. The gel apparatus is equipped with a minigel system that is 1.0 mm or 1.5 mm thick. The glass slides are carefully washed with soap and water, then rinsed with ethanol, and dried. The apparatus is assembled and the gels are poured. 1. Prepare the stacking (upper) gel and the resolving (lower) gel by following the amounts and order listed in Table 2 ( see Note 8 ). Volumes are calculated for two gels. Mix and pour the resolving gel first; when done polymerizing, mix and pour the stacking gel. Alternatively, prepare the stacking gel without TEMED and add when ready to be poured.

185 Molecular Analysis of Staphylococcal Superantigens 179 Table 2 Preparing the stacking (upper) gel and the resolving (lower) gel Stacking 1.0 mm resolving 1.5 mm resolving Percent gel 4 % 12 % 16 % 12 % 16 % 40 % Bis-acrylamide 0.3 ml 4.8 ml 6.4 ml 7 ml 8 ml 0.5 M Tris HCl, ph μl 1.5 M Tris HCl, ph ml 5.0 ml 4.0 ml 5.0 ml 10 % SDS 30 μl 160 μl 160 μl 200 μl 200 μl 10 % APS 30 μl 200 μl 200 μl 250 μl 250 μl ddh 2 O ml 6.82 ml 5.22 ml 7.83 ml ml TEMED 10 μl 20 μl 20 μl 25 μl 25 μl Final volume 3 ml 16 ml 16 ml 20 ml 20 ml Final volumes are enough for two gels 2. Pour the solution with a 10- or 5-ml pipet into the glass plates leaving space for the stacking gel and comb (leftover gel is thrown away after it polymerizes in the tube). To make a smooth line, the gel can be overlaid with saturated butanol or distilled water. Let the gel polymerize for at least 15 min (if butanol is used, wash it off with distilled water), and dry between plates with filter paper. 3. Pour the stacking gel, put the comb in place, and allow the gel to polymerize for ~30 min. Use leftover gel to check for correct polymerization. Gels can be stored with the combs for a few weeks wrapped in paper towel and soaked in SDS-PAGE running buffer (usually in a resealable bags). 4. Carefully remove the comb, rinse the wells with running buffer to remove unpolymerized gel from the wells (otherwise it will interfere with loading of the sample), and place the gel in the apparatus for electrophoresis. The wells can be easily rinsed with the use of a 12-ml syringe and an 18-gauge needle. 5. Add running buffer to the upper and lower chambers, according to the manufacturer s instructions, and 20 μl of each sample to the wells using a pro pipet equipped with extended tips. Control SAg samples loaded at 10.0, 1, 0.1, 0.01, and μg/ml should be loaded for quantification. Molecular weight markers are loaded as recommended by the supplier. The unknown samples can be diluted 10- and 100-fold to ensure that the SAg concentrations are in the range of appropriate quantification.

186 180 Wilmara Salgado-Pabón et al. 6. Completely assemble the apparatus with electrodes, and turn on the apparatus. 7. Electrophorese the samples at V until the bromophenol blue marker dye reaches the bottom of the resolving gel ( see Note 9 ). Turn off the apparatus. The gels are now ready to be used for Western immunoblotting. 3.4 Western Immunoblotting for SAgs Resolved proteins are transferred to PVDF membranes for Western immunoblotting. These directions assume use of the Bio-Rad mini PROTEAN 3 Cell and Western transfer apparatus. 1. Equilibrate the PVDF membrane by wetting in absolute methanol. Pour 1 Western transfer buffer in a glass dish, and place two sponges (included with the apparatus) and two pieces of 3MM paper cut to the size of the PVDF membrane in the glass dish (per gel). 2. Remove the SDS-PAGE gel from the apparatus, separate the glass plates containing the gel with a spatula, remove the stacking gel with a spatula, and place the plate with the gel attached in the glass dish with transfer buffer. Remove the gel from its glass plate using gentle agitation and a spatula, and then place on a piece of wetted 3MM paper. In order, place the following on the transfer cassette: one piece of wetted sponge, the piece of 3MM paper with attached gel, the PVDF membrane, the second piece of 3MM paper, and the second piece of wetted foam. Be careful not to allow air bubbles to become trapped between the 3MM paper with gel, the PVDF membrane, and the second piece of 3MM paper, to ensure uniform transfer. Set up the cassette with the black side down, and add the stack toward the clear side. When inserted into the transfer apparatus, the black side is toward the cathode (which is marked as black). 3. Fill the transfer tank with transfer buffer, place a magnetic stir bar at the bottom of the apparatus, and insert the closed cassette. 4. Place the transfer apparatus onto a magnetic plate (to help dissipate heat), and perform electrotransfer of the samples onto the PVDF membrane for about 1 h at 200 ma at 4 C. Ice packs fitted to the transfer apparatus are available for transfers done at room temperature. Transfers done in buffer without methanol require min (45 60 min is enough for transfers done in buffer containing methanol). 5. Disassemble the apparatus, and remove the PVDF membrane. Nitrocellulose and Nytran membranes can also be used, but PVDF membranes are more durable and useful for protein sequencing ( see Note 10 ). 6. Quick rinse the membrane twice with 30-ml volumes of TBS in a large petri dish to remove residual detergent.

187 Molecular Analysis of Staphylococcal Superantigens Block the PVDF membrane for at least 30 min with a 30-ml volume of TBST containing 1 % BSA, and gently shake on a platform shaker at room temperature ( see Note 11 ). Alternatively, membranes can be block overnight at 4 C. 8. Quick rinse the membrane twice with 30-ml volumes of TBST and add primary antibody (usually μl) in TBST-1 % BSA. Shake for at least 30 min at room temperature. 9. Perform three, 5-min washes with 30-ml volumes of TBST on a platform shaker. 10. Add secondary antibody (usually μl) in a 30-ml volume of TBST-1 % BSA. Shake for at least 30 min at room temperature. 11. Perform three 5-min washes with 30-ml volumes of TBST on a platform shaker. 12. Quick rinse twice with 30-ml volumes of TBS to remove residual detergent, and incubate membrane for 5 min in a 30-ml volume of AP buffer. 13. Discard AP buffer, and place the membrane in a new large petri dish (a disposable container is required as the substrates are corrosive). Add a 30-ml volume of AP buffer containing 1 ml of NBT and 400 μl of BCIP (AP buffer plus substrates can be prepared up to 1 h in advance and kept at room temperature). Agitate the membrane at room temperature until the standard SAg samples have reacted, turning the membrane slightly purple (the time to stop the reaction is just when the background also begins to turn purple). Stop the reaction by pouring copious distilled water on the membrane. 14. Remove the membrane from the substrate solution, put in between paper towels to dry, and keep away from the light (the membrane will continue to develop in the light as long as the membrane is wet). The membrane can be air-dried quickly by placing the membrane sandwiched in between paper towels on the laminar flow hood. 15. Photograph the PVDF membrane, and upload the image onto a computer. Fluorescent imaging systems, like the Odyssey, can be used to scan the membrane for protein quantification. 3.5 Determination of Density For measuring SAgs, we use the NIH imaging program, Image J, to capture the density of the protein bands. To do this, we use the program to draw around each stained band and determine its density. The background density is determined from three regions of the PVDF membrane that do not contain protein and subtracted from the SAg values. It is important to note that S. aureus makes protein A, which has the ability to bind IgG nonspecifically and thus will also come through in the membranes. The protein A bands are not present in

188 182 Wilmara Salgado-Pabón et al. the same molecular weight range as the SAgs and thus, do not interfere with band quantification. Standard amounts of SAg are used to prepare a standard curve by plotting band density versus the logarithm of the SAg concentration. This typically gives a straight line with an R 2 value >95. The amount of SAg made by the unknown samples is derived from the graph. 4 Notes 1. S. aureus strains may be stored indefinitely lyophilized or frozen at 20 or 80 C. To store strains, grow the organisms in THB until stationary phase; usually overnight will suffice. Collect the cells by centrifugation (1,000 g, 15 min), and suspend them in 1/10 vol with THB supplemented with 10 % rabbit blood (for lyophilization) or THB containing 10 % glycerol (for freezing). The S. aureus cells may then be lyophilized in ampoules or frozen. 2. If the investigator wishes to assess only whether or not SAgs are produced by the strains and not quantify the SAgs, double immunodiffusion may be used instead of Western immunoblotting. It is our experience that the antisera and control SAgs available from Toxin Technology are suitable for such analyses. Double immunodiffusion is performed after growing the strains in THB and concentrating the culture fluids by treatment with 4 vol of ethanol to precipitate SAgs and resuspension to one-tenth the original volume. Microscope slides are used to prepare the double immunodiffusion gels. These are coated with 4 ml of 0.75 % agarose melted in phosphate- buffered saline (0.005 M sodium phosphate, ph 7.2; 0.15 M NaCl). After the slides have solidified, wells 4 mm in diameter and 4 mm from each other are punched in the agarose in a hexagonal pattern. Control SAg (20 μl of μg/ml) and samples to be tested (20 μl) are added to adjacent wells. The slides are incubated for 4 h at 37 C in a humidified chamber or overnight at room temperature after addition of 20 μl of antiserum to a center well. The slides are read for precipitation lines forming lines of identity with control SAgs. In this assay, staphylococcal protein A does not interfere with the reactions, because rabbit IgG does not precipitate with protein A, even though it will react with rabbit IgG. It is our experience that this assay can be used with 100 % effectiveness to detect SEB, SEC, SED, SEE, SE-like H, and TSST-1 qualitatively. 3. When PCR is performed, the investigator may wish to use multiplex analysis in which multiple assays are performed in the same reaction tube, with agarose gel electrophoresis used to separate the different samples based on size. We do not

189 Molecular Analysis of Staphylococcal Superantigens 183 routinely perform such assays. However, such analyses are possible if the researcher uses primers of different sizes. Some of the primer combinations given in Table 1 can be used for this purpose. 4. It is our experience that the antisera and SAgs purchased from Toxin Technology are stable when stored at 4 C as long as they do not become contaminated. We have retained such preparations for up to 1 year without loss of activity. If the researcher wishes to store samples frozen, the preparations should not be repetitively frozen and thawed. 5. Lysostaphin is required for lysis of S. aureus cells. Despite the fact that many textbooks state that Gram-positive bacteria can be easily lysed with lysozyme, this is not the case with staphylococci. 6. In our experience, it is always best to determine the SAg gene composition of the strains to be tested prior to performing assays for the proteins. This allows conservation of expensive antisera and control SAgs (purchased from Toxin Technology). If the investigator wishes to test only for SEB, SEC, and TSST- 1, only assay for either the genes or SAg proteins needs be performed. We find that there is a one-to-one correlation with the presence of the genes and their production. These proteins typically are made in concentrations of μg/ml of culture fluid when cells are grown aerobically. Other SAg testing requires assays for both the genes and the proteins: the proteins may or may not be made by the strains, and if made, the proteins may be present in very low concentrations. 7. It is unnecessary to dry the samples completely. We allow air to blow across the tubes until excess ethanol is removed and the surface of the residual pellet has a dull finish. 8. Ammonium persulfate is inactivated by oxygen; thus, vigorous mixing is strongly discouraged. If the gels do not polymerize, it is possible that the ammonium persulfate is too old (we purchase new ammonium persulfate every 6 months) or that the compound is inactivated by exposure to air. In the latter case, this can be overcome by mixing the gel in a side-arm flask and deaerating the solution while mixing. This can be done by connecting the side-arm flask to a vacuum for about 2 min while mixing. 9. The molecular weights of all SAgs are between 22,000 and 30,000. This corresponds to a gel region with minimal other contaminating staphylococcal proteins. It is worth noting that the SAgs separated by this method will be near the gel bottom. Thus, the researcher may wish to electrophorese the samples until the bromophenol blue dye is only three-fourths of the way to the bottom.

190 184 Wilmara Salgado-Pabón et al. 10. We use PVDF membranes for Western immunoblotting for two reasons: first, they are sturdy and resist tearing, and second, we often electrophorese second samples with the intent of staining the PVDF membrane with Coomassie brilliant blue dye to allow visualization of all proteins. In this case we may wish to cut out and partially destain proteins for submission for direct protein sequence analysis. This is easily accomplished with the use of PVDF membranes. 11. Three percent gelatin may also be used in place of 1 % BSA. In that case, be sure to incubate with blocking solution at 37 C to prevent the gelatin from solidifying. References 1. (1999) From the Centers for Disease Control and Prevention. Four pediatric deaths from community-acquired methicillin-resistant Staphylococcus aureus Minnesota and North Dakota, JAMA 282: Bergdoll MS, Crass BA, Reiser RF et al (1981) A new staphylococcal enterotoxin, enterotoxin F, associated with toxic-shock-syndrome Staphylococcus aureus isolates. Lancet 1: Bernstein JM, Ballow M, Schlievert PM et al (2003) A superantigen hypothesis for the pathogenesis of chronic hyperplastic sinusitis with massive nasal polyposis. Am J Rhinol 17: Blomster-Hautamaa DA, Schlievert PM (1988) Preparation of toxic shock syndrome toxin-1. Methods Enzymol 165: Kravitz G, Dries DJ, Peterson ML et al (2005) Purpura fulminans due to Staphylococcus aureus. Clin Infect Dis 40: Lowy FD (1998) Staphylococcus aureus infections. N Engl J Med 339: McCormick JK, Yarwood JM, Schlievert PM (2001) Toxic shock syndrome and bacterial superantigens: an update. Annu Rev Microbiol 55: Dinges MM, Orwin PM, Schlievert PM (2000) Exotoxins of Staphylococcus aureus. Clin Microbiol Rev 13: Schlievert PM (1986) Staphylococcal enterotoxin B and toxic-shock syndrome toxin-1 are significantly associated with non-menstrual TSS. Lancet 1(1149): Schlievert PM, Shands KN, Dan BB et al (1981) Identification and characterization of an exotoxin from Staphylococcus aureus associated with toxic-shock syndrome. J Infect Dis 143: Schlievert PM, Tripp TJ, Peterson ML (2004) Reemergence of staphylococcal toxic shock syndrome in Minneapolis-St. Paul, Minnesota, during the surveillance period. J Clin Microbiol 42: Lina G, Bohach GA, Nair SP et al (2004) Standard nomenclature for the superantigens expressed by Staphylococcus. J Infect Dis 189: Jarraud S, Cozon G, Vandenesch F et al (1999) Involvement of enterotoxins G and I in staphylococcal toxic shock syndrome and staphylococcal scarlet fever. J Clin Microbiol 37: Fey PD, Said-Salim B, Rupp ME et al (2003) Comparative molecular analysis of communityor hospital-acquired methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 47: Davis JP, Chesney PJ, Wand PJ et al (1980) Toxic-shock syndrome: epidemiologic features, recurrence, risk factors, and prevention. N Engl J Med 303: Shands KN, Schmid GP, Dan BB et al (1980) Toxic-shock syndrome in menstruating women: association with tampon use and Staphylococcus aureus and clinical features in 52 cases. N Engl J Med 303: Todd JK, Kapral FA, Fishaut M et al (1978) Toxic shock syndrome associated with phage group 1 staphylococci. Lancet 2: Parsonnet J (1998) Case definition of staphylococcal TSS: a proposed revision incorporating laboratory findings. Int Congr Symp Ser 229: Reingold AL, Hargrett NT, Dan BB et al (1982) Nonmenstrual toxic shock syndrome: a review of 130 cases. Ann Intern Med 96: MacDonald KL, Osterholm MT, Hedberg CW et al (1987) Toxic shock syndrome: a newly recognized complication of influenza and influenza like illness. JAMA 257:

191 Molecular Analysis of Staphylococcal Superantigens Cone LA, Woodard DR, Byrd RG et al (1992) A recalcitrant, erythematous, desquamating disorder associated with toxin-producing staphylococci in patients with AIDS. J Infect Dis 165: Hofer MF, Harbeck RJ, Schlievert PM et al (1999) Staphylococcal toxins augment specific IgE responses by atopic patients exposed to allergen. J Invest Dermatol 112: Hofer MF, Lester MR, Schlievert PM et al (1995) Upregulation of IgE synthesis by staphylococcal toxic shock syndrome toxin-1 in peripheral blood mononuclear cells from patients with atopic dermatitis. Clin Exp Allergy 25: Jackow CM, Cather JC, Hearne V et al (1997) Association of erythrodermic cutaneous T-cell lymphoma, superantigen-positive Staphylococcus aureus, and oligoclonal T-cell receptor V beta gene expansion [published erratum appears in Blood :3496]. Blood 89: Leung DY, Meissner HC, Fulton DR et al (1993) Toxic shock syndrome toxin-secreting Staphylococcus aureus in Kawasaki syndrome. Lancet 342: Bohach GA, Fast DJ, Nelson RD et al (1990) Staphylococcal and streptococcal pyrogenic toxins involved in toxic shock syndrome and related illnesses. Crit Rev Microbiol 17: Marrack P, Kappler J (1990) The staphylococcal enterotoxins and their relatives. Science 248:

192 Chapter 11 Investigation of Staphylococcus aureus Adhesion and Invasion of Host Cells Junshu Yang and Yinduo Ji Abstract The continuous emergence of multidrug-resistant bacterial pathogens is a major problem in public health. Many mechanisms may be involved in such resistance in Staphylococcus aureus. Increasing data have shown that S. aureus can invade different types of host cells, which may contribute to escape from host immune defense as well as evade the toxicity of certain antibiotics. The organism produces various cell wallassociated molecules, particularly fibronectin-binding proteins, which are important for the bacterial cells to adhere to and internalize into the host cells. Thus, the expression levels of these factors affect the bacterial capacity of adhesion and invasion. In this study, we found that different human MRSA isolates possessed different abilities to adhere to and invade the epithelial cells. Key words Staphylococcus aureus, MRSA, Adhesion, Invasion, Epithelial cells 1 Introduction Staphylococcus aureus is a major human and animal pathogen. This organism can cause a wide variety of superficial and severe diseases, such as pneumonia, endocarditis, and toxic shock syndrome [ 1 ]. In order for S. aureus to initiate and establish infections, it must adhere to host cells [ 2 ]. S. aureus expresses a series of microbial surface components that recognize and interact with the extracellular matrix components of the host [ 3 ]. The expression of these surface proteins is upregulated and involved in bacterial adhesion and invasion at early stage of infection by different regulators, such as agr [ 4 ] and sae [ 5, 6 ]. Fibronectin-binding proteins are the main surface-associated proteins that function as adhesins by assembling the extracellular matrix protein Fn that bridges to the host cell receptors such as α 5 β 1 -integrin [ 5 ]. The adherence of S. aureus to host cell integrins activates Src family protein tyrosine kinase pathway that triggers the rearrangement of the actin cytoskeleton and is required for the host cells to uptake the bacteria [ 7 9 ]. Yinduo Ji (ed.), Methicillin-Resistant Staphylococcus aureus (MRSA) Protocols, Methods in Molecular Biology, vol. 1085, DOI / _11, Springer Science+Business Media, LLC

193 188 Junshu Yang and Yinduo Ji The increasing studies have demonstrated that S. aureu s can invade different types of host cell, which may allow the bacteria to evade the host immune system and decrease the potency of certain antibiotics [ 10 ]. In addition, we have demonstrated that α-toxin, an extracellular protein, is able to interfere the adhesion and internalization of S. aureus by binding to the α 5 β 1 -integrin [ 11 ]. We found that the downregulation of α-toxin dramatically enhances bacterial adhesion and invasion into the epithelial cells, whereas the capacity of bacterial adhesion and invasion is retarded by overproduction of α-toxin or the addition of extra α-toxin into the culture medium [ 11 ]. Recently, we revealed that the H35A mutated α-toxin is also able to inhibit S. aureus ability to adhere to and internalize into epithelial cells [ 12 ]. Taken together, the above data suggest that the secreted proteins including α-toxin may have an effect on bacterial adhesion and invasion. This chapter describes a method, which can be used for the comparative analysis of MRSA adhesion and invasion of a variety of host cells. 2 Materials 2.1 Cell Culture and Lysis 1. RPMI medium Fetal bovine serum (FBS). 3. Sterile PBS. 4. Trypsin EDTA. 5. Tryptic soy broth (TSB). 6. Tryptic soy broth agar (TSA) plates. 7. Antibiotic/antimycotic (Invitrogen): Aliquot in 1.5-ml tubes at 1 ml. 8. RPMI medium 1640 supplemented with 10 % FBS containing 100 μg/ml gentamicin, 5 μg/ml lysostaphin (Sigma) % Triton X Methods 3.1 Bacteria Culture 1. S. aureus isolates are incubated overnight (16 h) in 5 ml of TSB with shaking (225 rpm) at 37 C. 2. The bacterial cells are harvested by centrifugation for 10 min at 3,200 g. 3. Prior to infection, bacterial cells are washed once in PBS, and cell density is adjusted to approximately at OD 600 nm, and they are kept on ice. 4. Total 150 μl of diluted bacterial solution (OD 600 = 0.200) is added to a tube containing 5 ml RPMI medium 1640/10 % FBS.

194 Investigation of Staphylococcus aureus Adhesion and Invasion of Host Cells Cell Culture (See Note 1 ) 3.3 Invasion Assay (See Note 1 ) 1. A549 human epithelial cells are incubated in tissue culture plates ( mm, Sarsted) in RPMI medium 1640 with 10 % FBS and 1 % antibiotic antimycotic at 37 C, 5 % CO 2 incubator. 2. The epithelial cells are subcultured every 2 3 days. Day 1 1. A549 cells are grown to 70 % confluence in the culture plates. 2. The old media are removed, and cells are washed with 3.0 ml warm PBS. 3. A solution of 400 μl of trypsin is added and incubated for 3 5 min at room temperature. 4. A total of 2 ml of warm RPMI medium 1640 with 10 % FBS and 1 % antibiotic/antimycotic is added, and all cells are suspended. 5. The suspended cells (2 ml) are transferred into a new tube containing 8 ml of RPMI medium 1640 with 10 % FBS and 1 % antibiotic/antimycotic. 6. The cells are mixed and transferred into each well (1 ml/well) of 24-well culture plate as needed. 7. The culture plates containing the cells are put in a 37 C, 5 % CO 2 incubator. Day 2 1. The old media are removed from each well of the cell culture plate, and 1 ml of warm fresh RPMI medium 1640 containing 10 % FBS is added into each well. The epithelial cells are incubated overnight at 37 C, 5 % CO 2 incubator. 2. The bacterial cells are incubated overnight in 5 ml TSB (with or without antibiotic) at 37 C with shaking (225 rpm). Day 3 1. The bacteria cells are harvested from overnight culture by centrifugation at 3,200 g for 10 min. 2. The collected bacterial cells are washed once with PBS. 3. The bacterial cells are spun down and resuspended in 5 ml ice cold PBS. 4. The bacterial cells are diluted, and the optical density is adjusted to approximately 0.20 at OD 600 nm. 5. The total 150 μl of diluted bacterial solution (OD 600 = 0.20) is added into a new sterile tube containing 5 ml RPMI medium 1640 containing 10 % FBS. This is called the original bacterial culture.

195 190 Junshu Yang and Yinduo Ji 6. The old media are removed from each well of the 24-well tissue culture plate, and 1 ml warm RPMI medium 1640 containing 10 % FBS is added into each well. 7. The original bacterial cultures are mixed by vortex, and 500 μl of such bacterial solution is added into appropriate wells of the tissue culture plate. 8. The tissue culture plates are tilted back and forth for six times and spun at 100 g for 5 min. 9. The tissue culture plates are incubated for 2 h in the 37 C, 5 % CO 2 incubator. 10. In order to calculate the amount of bacterial cells added in each well, the original bacterial cultures are diluted by serial dilutions of 10 1, 10 2, 10 3, and 10 4 with PBS and plated out 25 μl four times on TSA plates ( see Note 5 ). 11. The tissue culture plate is taken from the incubator, the supernatants are collected from wells for a total bacterial count, and the supernatants are discarded from invasion wells. 12. The epithelial cells are washed three times with 1 ml of warm PBS. 13. A total of 1 ml RPMI medium 1640 containing 10 % FBS is added into each well for a total bacterial count. 14. A total of 1 ml RPMI medium 1640 containing 10 % FBS, 100 μg/ml gentamicin, and 5 μg/ml lysostaphin is added into each invasion well. 15. The tissue culture plate is incubated for 1 h in the 37 C, 5 % CO 2 incubator. 16. For total bacterial count, the supernatants are collected from each wells of total count, diluted by serial dilutions of 10 1, 10 2, 10 3, and 10 4 with PBS and plated out 25 μl four times on TSA plates ( see Note 2 ). 17. The supernatants are discarded from invasion wells, and the cells are washed three times with 1 ml warm PBS μl trypsin is added into each well and incubated for 3 5 min at room temperature. 19. The cells are carefully resuspended and transferred in to 1.5 ml tubes on ice. 20. Another 400 μl of % Triton X-100 is added into each well to wash the wells and then transferred into the corresponding 1.5 ml tubes. 21. The collected cells are mixed by vortex for 30 s; diluted by serial dilutions of 10 1, 10 2, 10 3, and 10 4 with PBS; and plated out 25 μl four times on TSA plates ( see Note 2 ). 22. The TSA plates are incubated overnight at 37 C.

196 Investigation of Staphylococcus aureus Adhesion and Invasion of Host Cells 191 Day 4 1. The colonies on all plates are counted. 2. The average cfu, cfu/well, growth index, % invasion, corrected invasion, and relative invasion are calculated with the following formulas: Cfu = number of colonies counted. Cfu/well = (avg. cfu/.025 ml) DF total volume in well. Growth index = total cfu/original cfu. % Invasion = internalized cfu/original cfu 100. Corrected invasion = % invasion/growth index. Relative invasion = (corrected invasion of mutant/corrected invasion of control). 3. The figure of relative invasion can be created in the Excel file [ 6 ]. 3.4 Adhesion Assay (See Note 1 ) Day 1 1. A549 cells are grown to 70 % confluence in the culture plates. 2. The old media are removed, and cells are washed with 3.0 ml warm PBS. 3. A solution of 400 μl of trypsin is added and incubated for 3 5 min. 4. The total of 2 ml of warm RPMI medium 1640 containing 10 % FBS and 1 % antibiotic/antimycotic is added, and all cells are suspended. 5. The suspended cells (2 ml) are transferred into a new tube containing 8 ml of RPMI medium 1640 containing 10 % FBS and 1 % antibiotic/antimycotic. 6. The cells are mixed and transferred into each well (1 ml/well) of 24-well culture plate as needed. 7. The culture plates containing the cells are put in 37 C, 5 % CO 2 incubator ( see Note 2 ). Day 2 1. The old media are removed from each well of the tissue culture plate, and 1 ml of warm fresh RPMI Medium 1640 containing 10 % FBS is added into each well. The cells are incubated overnight at 37 C, 5 % CO 2 incubator. 2. The bacterial cells are incubated overnight in 5 ml TSB (with or without antibiotic) at 37 C with shaking (225 rpm). Day 3 1. The bacterial cells are harvested from overnight culture by centrifugation at 3,200 g for 10 min. 2. The collected bacterial cells are washed once with PBS.

197 192 Junshu Yang and Yinduo Ji 3. The bacterial cells are spun down and resuspended in 5 ml ice cold PBS. 4. The bacterial cells are diluted, and the optical density is adjusted to approximately 0.20 at OD 600 nm. 5. A total 150 μl of diluted bacterial solution (OD 600 = 0.20) is added into a new sterile tube containing 5 ml RPMI medium 1640 containing 10 % FBS ( see Note 3 ). This will be the original bacterial culture. 6. The old media are removed from each well of the 24-well tissue culture plate, and 1 ml warm RPMI medium 1640 containing 10 % FBS ( see Note 3 ) is added into each well. 7. The tissue culture plates are tilted back and forth six times and spun at 100 g for 5 min. 8. The tissue culture plates are incubated for 1 h in the 37 C, 5 % CO 2 incubator. 9. In order to calculate the number of bacterial cells added in each well, the original bacterial cultures are diluted by serial dilutions of 10 1, 10 2, 10 3, and 10 4 with PBS and plated out 25 μl four times on TSA plates ( see Note 4 ). 10. The tissue culture plate is taken out from incubator after 1 h incubation, and the supernatants are discarded. 11. The epithelial cells are washed three times with 1 ml of warm PBS. 12. A total of 150 μl trypsin is added into each well and incubated for 3 5 min at the room temperature. 13. The cells are carefully resuspended and transferred into a 1.5 ml Eppendorf tubes on ice. 14. Another 400 μl of % Triton X-100 is added into each well to wash the wells and transferred into the corresponding 1.5-ml tubes. 15. The collected cells are mixed by vortex for 30 s; diluted by serial dilutions of 10 1, 10 2, 10 3, and 10 4 with PBS; and plated out 25 μl four times on TSA plates ( see Note 2 ). 16. The TSA plates are incubated overnight at 37 C. Day 4 1. The colonies on all plates are counted. 2. The average cfu, cfu/well, % adhesion, and relative adhesion are calculated using the following formulas: Cfu = number of colonies counted. Cfu/well = (avg. cfu/.025 ml) dilution factor (DF) total volume in well.

198 Investigation of Staphylococcus aureus Adhesion and Invasion of Host Cells 193 % adhesion = adhered and internalized cfu/original inoculum s cfu 100. Relative adhesion = (% adhesion of mutant/% adhesion of control). 3. The figure of relative adhesion can be created in the Excel file [ 6 ]. 4 Notes 1. A common problem in the adhesion and invasion assay is bacterial contamination. To avoid potential contamination, the adhesion and invasion assay should be performed in a biosafety hood, and gloves should be worn. 2. In order to avoid cross contamination between different samples, all plates should be dried before starting an assay, and all plates should be completely dry before placed in the 37 C incubator. 3. The RPMI medium 1640 containing 10 % FBS should not contain antibiotics antimycotic. 4. Let the plates sit until late afternoon, and then put them in a 37 C incubator. 5. The bacterial solution should be mixed using vortex before it is inoculated into the wells of the tissue culture plate. Acknowledgments This work was partially supported by grant AI from the National Institute of Allergy and Infectious Disease and by USDA- MAES competitive grant. We thank the Network on Antimicrobial Resistance in Staphylococcus aureus (NARSA) Program for clinical MRSA isolates supported under NIAID/NIH Contract No. N01-AI References 1. Lowy FD (1998) Staphylococcus aureus Infections. N Engl J Med 339: von Eiff C, Becker K, Machka K et al (2001) Nasal carriage as a source of Staphylococcus aureus bacteremia. N Engl J Med 344: Foster TJ, Höök M (1998) Surface protein adhesins of Staphylococcus aureus. Trends Microbiol 6: Novick RP (2003) Autoinduction and signal transduction in the regulation of staphylococcal virulence. Mol Microbiol 48: Liang X, Yu C, Sun J et al (2006) Inactivation of a two-component signal transduction system, SaeRS, eliminates adherence and attenuates virulence of Staphylococcus aureus. Infect Immun 74:

199 194 Junshu Yang and Yinduo Ji 6. Liang X, Ji Y (2007) Comparative analysis of staphylococcal adhesion and internalization by epithelial cells. Methods Mol Biol 391: Sinha B, Francois PP, Nusse O et al (1999) Fibronectin-binding protein acts as Staphylococcus aureus invasin via fibronectin bridging to integrin alpha5beta1. Cell Microbiol 1: Agerer F, Michel A, Ohlsen K et al (2003) Integrin-mediated invasion of Staphylococcus aureus into human cells requires Src family protein-tyrosine kinases. J Biol Chem 278: Wang B, Yurecko R, Dedhar S et al (2006) Integrin-linked kinase is an essential link between integrins and uptake of bacterial pathogens by epithelial cells. Cell Microbiol 8: Alexander EH, Hudson MC (2001) Factors influencing the internalization of Staphylococcus aureus and impacts on the course of infections in humans. Appl Microbiol Biotechnol 56: Liang X, Ji Y (2006) Alpha-toxin interferes with integrin-mediated adhesion and internalization of Staphylococcus aureus by epithelial cells. Cell Microbiol 8: Yang J, Liang X, Ji Y (2013) The mutated staphylococcal H35A α-toxin inhibits adhesion and invasion of Staphylococcus aureus and group A streptococci. Virulence 4:77 81

200 Chapter 12 Investigation of Biofilm Formation in Clinical Isolates of Staphylococcus aureus James E. Cassat, Mark S. Smeltzer, and Chia Y. Lee Abstract Invasive methicillin-resistant Staphylococcus aureus (MRSA) infections are often characterized by recalcitrance to antimicrobial therapy, which is a function not only of widespread antimicrobial resistance among clinical isolates, but also the capacity to form biofilms. Biofilms consist of ordered populations of bacterial colonies encased in a polysaccharide and/or proteinaceous matrix. This unique physiologic adaptation limits penetration of antimicrobial molecules and innate immune effectors to the infectious focus, increasing the likelihood of treatment failure and progression to chronic infection. Investigation of mechanisms of biofilm formation and dispersal, as well as the physiologic adaptations to the biofilm lifestyle, is therefore critical to developing new therapies to combat MRSA infections. In this chapter, we describe two in vitro methods for the investigation of staphylococcal biofilm formation, a microtiter plate-based assay of biofilm formation under static conditions and a flow cell-based assay of biofilm formation under fluid shear. We also detail an in vivo murine model of catheter-associated biofilm formation that is amenable to imaging and microbiologic analyses. Special consideration is given to the conditions necessary to support biofilm formation by clinical isolates of S. aureus. Key words Polysaccharide intercellular adhesion, Poly- N -acetylglucosamine, Microbial surface components recognizing adhesive matrix molecules, Flow cell, Implant-associated biofilm, S. aureus, MRSA 1 Introduction Staphylococcus aureus is among the most prominent of all bacterial pathogens. It is a commensal inhabitant of a significant proportion of the healthy population, but it also has the capacity to cause a diverse array of infections ranging from relatively superficial skin infections to serious, life-threatening infections including endocarditis, pneumonia, and osteomyelitis. Many forms of staphylococcal infection are associated with the formation of a bacterial biofilm on either native tissues (e.g., cartilage, bone) or implanted biomaterials (e.g., catheters, orthopedic devices). This biofilm significantly impairs antimicrobial therapy even in those cases caused by strains that are sensitive to the relevant antibiotics [ 1, 2 ]. For this reason, Yinduo Ji (ed.), Methicillin-Resistant Staphylococcus aureus (MRSA) Protocols, Methods in Molecular Biology, vol. 1085, DOI / _12, Springer Science+Business Media, LLC

201 196 James E. Cassat et al. considerable effort has been expended to define the specific staphylococcal factors that promote biofilm formation and/or persistence within a biofilm. In general, biofilm formation in all bacterial species involves four relatively distinct phases. The first phase is nonspecific interactions that promote the transient adherence to a substrate. These interactions are defined by general characteristics of the bacterium and the substrate (e.g., hydrophobicity). We have not investigated these interactions in detail, but we have found that some microtiter plates work better than others, and this presumably reflects subtle differences in surface chemistry. With that in mind, we have included information regarding the specific components that we have found most reliable. The second phase is attachment to the substrate via specific bacterial adhesins. In S. aureus and many other Grampositive pathogens, there is considerable evidence to suggest that this stage is mediated by the surface-exposed protein adhesins referred to as microbial surface components recognizing adhesive matrix molecules (MSCRAMMS) [ 3, 4 ]. This is consistent with the need to coat the substrate used for in vitro studies with plasma proteins to support biofilm formation by clinical isolates. It should be noted that, in our experience, plasma coating is not necessary with Staphylococcus epidermidis, and there are exceptions to the rule in S. aureus [ 5 ]. However, they are rare, and we have written this chapter to emphasize the rule rather than the exception. The third phase is the accumulation phase, in which bacteria adhere to each other in a fashion that ultimately results in the formation of a mature biofilm. In S. epidermidis, this is closely correlated with the presence and expression of the ica (intercellular adhesin) operon and the consequent production of the polysaccharide intercellular adhesion (PIA) [ 6, 7 ]. The ica operon is present in most S. aureus isolates, and in some cases, it is required for biofilm formation [ 8 ]. However, that is clearly not the case in all strains [ 9, 10 ]. This may reflect the existence of an alternative means of accumulation, such as the elaboration of a proteinaceous matrix or extracellular DNA [ 11, 12 ], or simply the fact that PIA production is important under growth conditions that are not reflected in current in vitro biofilm models. Indeed, there is evidence that ica is expressed preferentially under in vivo growth conditions, and vaccine targeting of PIA is protective in a murine model of S. aureus infection [ 13, 14 ]. This further emphasizes the need to verify the results of any in vitro biofilm assay using appropriate in vivo models, and it is for this reason that we have included a discussion of a murine model of catheter-based biofilm formation in this chapter. The fourth and final phase of biofilm formation is dispersal or release of bacteria from the biofilm. Although this can occur as a function of shear forces rather than any specific bacterial attribute, many bacteria also use specific mechanisms of dispersal, and in the case of S. aureus, there is evidence to suggest that production of

202 MRSA Biofilm Assays 197 phenol-soluble modulins (PSMs) may be important in that regard [ 15 ]. Induction of the accessory gene regulator ( agr ), which results in expression of the PSM δ-toxin, results in detachment of S. aureus from mature biofilms [ 16 ]. Studies from several laboratories have demonstrated that expression of agr is negatively correlated with biofilm formation in both S. aureus and S. epidermidis [ 5, 17 ]. Interestingly, PSMs may also have a role in the stabilization of biofilms by aggregation into amyloid fibers [ 18 ]. A second mechanism for staphylococcal release from biofilms is the growth-phase dependent elaboration of extracellular proteases that cleave MSCRAMMS resulting in biofilm dispersal [ ]. Finally, bacteria may produce products capable of disassembly as a biofilm matures, as was demonstrated for d -amino acids [ 22 ]. To investigate staphylococcal biofilms, a number of in vitro and in vivo methods have been employed. The two most common in vitro methods are the microtiter plate-based assay and the flow cell-based assay, while the most common in vivo method is the use of an implanted biomaterial that is either inoculated directly or preinoculated prior to implantation [ ]. The microtiter platebased assay of static biofilm formation is particularly useful for comparison of multiple strains including large-scale screens of mutant libraries. When such screens are applied to the coagulasenegative staphylococci in general, and Staphylococcus epidermidis in particular, they are relatively straightforward by comparison with microtiter plate assays used to assess biofilm formation in other bacterial species. However, in the case of clinical isolates of S. aureus, including MRSA, we have found it necessary to employ specific modifications including precoating of the wells of the microtiter plate with plasma proteins and supplementation of the medium with both salt and glucose. In this chapter, we describe the microtiter plate assay in the specific context of clinical isolates of S. aureus and the use of these modifications. A second in vitro method, which is also generally dependent on coating with plasma proteins and supplementation of the growth medium, is the use of flow cells. In this method, bacteria are allowed to attach to a surface and then monitored with respect to their ability to remain attached to the substrate and differentiate into mature biofilms under the constant pressure of fluid shear force. Although flow cells are not as amenable to large-scale screens, we have found that they provide a more reproducible and accurate assessment of the capacity of S. aureus clinical isolates to form a biofilm. They also provide a means of analyzing structural differences in biofilm architecture and isolating bacteria and/or spent media for analysis of physiological and metabolic changes associated with the adaptive response to growth in a biofilm. While a primary focus of this chapter is on the use of in vitro assays to assess biofilm formation in clinical isolates of S. aureus, it is important to emphasize that in vitro methods do not

203 198 James E. Cassat et al. necessarily reflect events that occur in vivo. Several in vivo methods to assess biofilm formation have been described, and these generally fall into one of two categories. The first focuses directly on staphylococcal diseases that are generally thought to include a biofilm component (e.g., endocarditis, osteomyelitis, septic arthritis). A discussion of these models is also beyond the scope of this chapter, but examples are easily found in the staphylococcal literature. The second approach uses some form of implanted device in an attempt to focus more directly on implant-associated biofilms. We use a model in which a small piece of Teflon catheter is implanted subcutaneously in mice and used as a substrate for colonization. We have the advantage of using bioluminescent derivatives of S. aureus clinical isolates and the IVIS imaging system. However, because this system is not widely available, we restrict technical comments in this chapter to our use of an implanted catheter model evaluated by direct microbiological analysis of explanted catheters [ 1 ]. 2 Materials 2.1 Microtiter Plate Biofilm Assay 2.2 Flow Cell Biofilm Assay 1. Biofilm media: Tryptic soy broth (BD Biosciences) supplemented with 3.0 % NaCl and 0.5 % dextrose. 2. Carbonate-bicarbonate buffer (Sigma, St. Louis, MO). 3. Lyophilized human plasma (Sigma): Prepare a 20 % suspension by resuspending 5 ml of lyophilized human plasma in 20 ml of filter-sterilized carbonate-bicarbonate buffer ( see Note 1 ). 4. Phosphate-buffered saline (PBS) (10 PBS stock): 1.37 M NaCl, 27 mm KCl, 100 mm Na 2 HPO 4, and 18 mm KH 2 PO 4. Adjust the ph to 7.4 with HCl if necessary, and autoclave before storing at room temperature. Prepare a working solution by diluting one part with nine parts of water. 5. Flat-bottomed polystyrene 96-well tissue culture plates (Corning, Corning NY). 1. IBI Scientific Flow Cell Kit (IBI Scientific) L Polycarbonate media reservoir. 3. Lyophilized human plasma (Sigma). 4. Carbonate-bicarbonate buffer (Sigma). 5. Autoclavable tubing (Cole Parmer). 6. Luer-Lok syringes (Fisher). 7. Male and female Luer-Lok connectors. 8. Three-way stopcock (Baxter Pharmaseal). 9. Tabletop incubator (LabLine Thermal Rocker: S1087-1; Cardinal Health) ( see Note 2 ).

204 MRSA Biofilm Assays Peristaltic pump (Ismatec Low Flow, High Accuracy, 12 channel; IBI Scientific). 11. Insulin syringes (Fisher). 2.3 Catheter-Based Model of In Vivo Biofilm Formation 1. Six- to eight-week-old NIH Swiss female mice ( see Note 3 ) gage Teflon intravenous catheters (# or similar; Fisher): Precut catheters into 1-cm segments and sterilize by autoclaving prior to surgery. 3. Vetbond tissue adhesive (Fisher). 4. 2,2,2-Tribromoethanol (TBE) (Sigma-Aldrich) ( see Note 4 ): Prepare a stock solution of TBE by mixing 25 g of TBE with 15.5 ml of tert-amyl alcohol (Sigma-Aldrich) in a dark bottle. Stir for h at room temperature until the TBE is completely dissolved. Wrap the stock solution in foil and keep at room temperature (the stock solution is both hydroscopic and photosensitive). Prepare a working solution of TBE prior to surgery by mixing 0.5 ml of the TBE stock with 39.5 ml of PBS or 0.9 % saline. Stir in a dark bottle until complete resuspension has occurred (this may take several hours). Filter sterilize the resuspended working solution and then store in the dark at 4 C. The working solution, stored properly, can be used for several months. 5. Fisher Scientific Sonic Dismembrator model 500 (# ) with 1.2-in. tapped horn (# ) and 1/8-in.-diameter microtip (# ). 6. PBS: Prepare as described in Subheading 2.1, item Tryptic soy agar (BD Biosciences). 3 Methods 3.1 Microtiter Plate Biofilm Assay Day Day 2 1. Add 200 μl of 20 % human plasma into the required number of wells and incubate overnight at 4 C. 2. Start overnight cultures of each test strain in biofilm medium (tryptic soy broth supplemented with 0.5 % dextrose and 3.0 % NaCl). 1. Remove plasma from the wells by gentle aspiration with a sterile pipet tip. Care must be taken to avoid forceful suction of plasma from the well. Slowly and gently move the vacuum tip down the side of the well until all fluid has been removed. Take care not to aspirate the contents from the bottom of the well. 2. After ensuring that all overnight cultures grew to a comparable extent, dilute overnight cultures 1:200 in sterile biofilm medium ( see Note 5 ).

205 200 James E. Cassat et al. Fig. 1 Diagram of IBI scientifi c fl ow cell 3. Inoculate microtiter plate wells with 200 μl of diluted cultures. Fill the desired number of replicate wells for each strain. Include control wells consisting of sterile biofilm medium alone. Incubate the plate at 37 C without shaking for 24 h Day Day Flow Cell Biofilm Assay Plasma Coating 1. Aspirate bacterial cultures from each well using the method described in Subheading 3.1.2, step 1. Wash the wells gently three times with 200 μl of sterile PBS. 2. Fix with 200 μl of 100 % ethanol. Immediately aspirate off the ethanol, and let the microtiter plate dry for 10 min with the lid off in a sterile hood. 3. Stain the biofilm by adding 200 μl of crystal violet to each well for exactly 2 min. Gently aspirate off the crystal violet from each well. 4. Gently wash the wells three times with 200 μl of sterile PBS. Allow the plate to dry overnight with the lid on. 1. Elute crystal violet by filling the wells with 100 μl of 100 % ethanol for 10 min. 2. Gently pipet the eluted stain from each well into a new microtiter plate. Read the absorbance using an enzyme-linked immunosorbent assay plate reader at an absorbance of 595 nm ( see Note 6 ). Diagram of the IBI Scientific flow cell (Fig. 1 ). Plasma coating should be performed in a sterile environmental hood if possible. 1. Resuspend 5 ml of lyophilized human plasma in 20 ml of carbonate bicarbonate buffer. 2. Connect a sterile section of tubing fitted with a female Luer connector at one end to the flow cell output manifold.

206 MRSA Biofilm Assays 201 Fig. 2 A 20-mL sterile male Luer-Lok fi tted syringe is connected to a small (<6 in.) section of sterile tubing by means of a female Luer-Lok adapter. The other end of the sterile tubing is subsequently attached to the fl ow cell output manifold. This apparatus is used to introduce plasma into the fl ow cell circuit Connect a 20-mL Luer-Lok syringe to the female Luer connector (Fig. 2 ). 3. Connect a sterile section of tubing fitted with a female Luer connector at one end to the flow cell input manifold. Place this section of tubing into a sterile 50-mL beaker containing the resuspended 20 % human plasma (Fig. 3 ). 4. Open all six pinch clamps on the flow cell apparatus. Slowly draw plasma into the flow cell tubing by exerting a slight pressure on the plunger of the syringe connected to the flow cell output manifold. Continue drawing plasma into the flow cell until each chamber is filled ( see Note 7 ). 5. Close all six pinch clamps. To ensure sterility after drawing plasma into the flow cell, attach a 20-mL Luer-Lok syringe to the female Luer adapter connected to the flow cell input manifold. Rinse the connection with 70 % isopropanol to remove residual plasma. 6. Incubate the entire flow cell apparatus at 4 C for 24 h Establishing Flow of Medium 1. Prior to sterilization of the media reservoir containing a sufficient quantity of biofilm medium ( see Note 8 ), attach a three- way stopcock to the external tubing connected to the media reservoir (Fig. 4, inset). Wrap the stopcock in foil to ensure sterility once autoclaved. Confirm that the stopcock is in the off

207 202 James E. Cassat et al. Fig. 3 A small (<6 in.) section of sterile tubing containing a female Luer-Lok adapter at one end is connected to the fl ow cell input manifold. This female Luer-Lok-equipped end of the sterile tubing is subsequently placed in a 50-mL beaker containing 25 ml of resuspended 20 % human plasma Fig. 4 Prior to sterilization of the media reservoir, a three-way stopcock is fi tted to the external tubing and placed in the off position position such that the biofilm medium cannot exit the reservoir during sterilization. 2. Using aseptic technique, carefully remove the 20-mL Luer-Lok syringe and female Luer adapter from the tubing section connected to the flow cell input manifold. Replace the female

208 MRSA Biofilm Assays 203 Fig. 5 The female Luer-Lok adapter on the section of tubing connected to the fl ow cell input manifold is removed and replaced with a male Luer-Lok adapter. The fl ow cell may now be aseptically connected to the sterilized media reservoir by means of the three-way stopcock Luer adapter with a threaded male adaptor. Connect the threaded male Luer adapter to the three-way stopcock attached to the sterile media reservoir (Fig. 5 ). 3. Remove the 20-mL Luer-Lok syringe from the section of tubing connected to the flow cell output manifold. Insert this section of tubing into a vessel suitable for collecting flow cell effluent waste ( see Note 9 ). Connect the flow cell to a peristaltic pump by placing each of the three pieces of tubing between the flow cell input manifold and the bubble trap apparatus in adjacent pump channels (Fig. 6 ). 4. Open all six pinch clamps on the flow cell apparatus. Turn the three-way stopcock connected to the media reservoir to the on position, such that the medium can now enter the flow cell apparatus. 5. After ensuring that all tubing connections are intact, turn on the peristaltic pump at a rate of 1.5 ml/min (approx. 0.5 ml/ min per flow cell chamber). Prepare the bubble trap apparatus by turning one of the bubble trap stopcocks to the on (vertical) position until sterile medium has filled approximately half of the bubble trap (lower right). Repeat this process for the remaining two bubble traps and then return the bubble trap stopcock to the off (horizontal) position (Fig. 7 ). 6. Allow fresh biofilm medium to flow through the flow cell apparatus for min to remove all the plasma. If bubbles

209 204 James E. Cassat et al. Fig. 6 The fl ow cell is connected to a peristaltic pump by placing each of the three pieces of tubing between the fl ow cell input manifold and the bubble trap apparatus into adjacent pump channels Fig. 7 Bubble traps in the fl ow cell apparatus are sequentially fi lled by turning a bubble trap stopcock to the on position. Each bubble trap cylinder is fi lled approximately half full with medium, and then the bubble trap stopcock is returned to the off position. This process is repeated for each of three bubble traps per fl ow cell have accumulated in the flow cell chambers, they can be removed by turning the chamber vertically and lightly tapping on the surface. Remove all bubbles in or near the flow cell chamber before inoculation.

210 MRSA Biofilm Assays 205 Fig. 8 Tubing just upstream of the fl ow cell chamber is prepared for inoculation by cleansing with a sterile alcohol pad followed by application of self-sealing tape (included in the IBI Scientifi c Flow Cell Kit) Inoculation of Flow Cell Chambers 1. Prepare strains by setting up an overnight broth culture in biofilm medium. Prior to inoculation of the flow cell, standardize each culture to be tested based on spectrophotometer readings ( see Note 10 ). 2. Turn off the peristaltic pump and close all pinch clamps on the flow cell apparatus. 3. Clean the section of tubing between the upstream pinch clamps and the flow cell chamber with a sterile alcohol pad to prepare for inoculation. Apply a small piece of self-sealing tape (included in the IBI Scientific Flow Cell Kit) to this section of tubing, and clean the tape with a sterile alcohol pad (Fig. 8 ). 4. Draw up 0.5 ml of each standardized bacterial culture into an insulin syringe. Working on one chamber at a time, carefully insert the needle through the self-sealing tape and into the lumen of the flow cell tubing (Fig. 9 ). 5. Open the downstream pinch clamp, and slowly inject the bacterial suspension making sure that the turbid suspension fills the flow cell chamber. Take care not to introduce bubbles into the chamber. After injection, carefully remove the needle and clean the self-sealing tape with a sterile alcohol pad once more. Close the downstream pinch clamp. Repeat this process for each strain in the respective flow cell chambers. 6. After inoculation, place the flow cell chamber upside down in an incubator to allow bacteria to attach (Fig. 10 ). Use a small weight to stabilize the flow cell in a flat position. Ensure that

211 206 James E. Cassat et al. Fig. 9 The needle of an insulin syringe containing the fl ow cell inoculum is carefully inserted through the self-sealing tape and into the lumen of the tubing just upstream of the fl ow cell chamber. The bacterial inoculum (0.5 ml) is slowly introduced into the fl ow cell chamber while the upstream pinch clamp is closed and the downstream pinch clamp is open. After full injection of the inoculum, the injection site is cleaned with a sterile alcohol pad, and the downstream pinch clamp is closed Fig. 10 After inoculation, the fl ow cell chamber is placed upside down in a 37 C incubator. Growth at 37 C is maintained without medium fl ow for 1 h, after which the fl ow cell is returned to an upright position and medium fl ow is resumed

212 MRSA Biofilm Assays 207 Fig. 11 The fl ow cell tubing should not be impacted as it enters or exits the incubator. The fl ow cell chamber should be level with the incubator surface at all times throughout the experiment (a small weight may be used for this purpose) the upstream and downstream tubing is not pinched as it enters or exits the incubator (Fig. 11 ). 7. Incubate the inoculated flow cell with the flow off for 1 h at 37 C. 8. Return the flow chamber to the upright position, and start the peristaltic pump at a flow rate of 1.5 ml/min ( see Note 11 ). Incubate the flow cell at 37 C for the remainder of the experiment. 9. Observe the bubble trap periodically to ensure that it is approximately half full, adjusting the stopcocks as necessary to allow more medium to enter the cylinder. 3.3 Catheter-Based Model of In Vivo Biofilm Formation Preparation of Bacterial Inocula 1. Grow each bacterial strain at 37 C with constant aeration to the desired concentration, as measured by optical density (OD) ( see Note 12 ). Harvest bacterial cells by centrifugation, and resuspend in PBS containing 10 % dimethyl sulfoxide and 5 % bovine serum albumin. 2. After determining viable colony counts by plating on suitable growth medium, store aliquots at 80 C. 3. Prior to injection, thaw the aliquots on ice and wash twice with sterile PBS.

213 208 James E. Cassat et al Implantation of Subcutaneous Catheter Segments Inoculation of Catheter Lumen Assessment of Catheter Infection 1. Anesthetize mice by injecting cc of TBE intraperitoneally (approx mg of TBE/g of body weight). Induction of anesthesia should occur within 5 15 min. 2. After ensuring adequate anesthesia, shave the dorsal flanks of each mouse. Clean the shaved areas first with Betadine and then with alcohol. Allow the area to dry before making incisions. 3. Make a small ( 1 cm) incision in the shaved area over one flank by lifting the skin and cutting with surgical scissors. Using forceps or a blunt probe, insert the catheter segment into the incision and approx. 3 cm cephalad into the sc space. Ensure that the catheter does not shift back toward the incision site. Close the wound with surgical adhesive. Repeat this process for the other flank (i.e., two catheters per mouse). 1. Prepare inocula by filling insulin syringes with 100 μl of bacterial suspension consisting of the desired number of colonyforming units. 2. Ensure that the surgical wound is closed and that the adhesive is completely dry before inoculation ( see Note 13 ). 3. Working from the cephalad side of the catheter, carefully insert the needle subcutaneously and into the lumen of the catheter. It is helpful to use one hand to secure the catheter and surrounding skin while manipulating the syringe with the other hand. 4. Slowly inject the bacterial suspension into the lumen of the catheter. Forceful injections will increase the chances of inoculating outside of the catheter. 5. Carefully remove the needle and gently clean the injection site with isopropanol. 6. Monitor infected mice for signs of distress until awake and mobile ( see Note 14 ). 1. At the desired time point(s), humanely euthanize mice according to the protocols approved at the researcher s institution. 2. Using aseptic technique, make a small incision with surgical scissors and carefully remove each catheter from the sc space using sterile forceps. 3. To remove nonadherent or loosely adherent bacteria from the catheter, carefully dunk the catheter into sterile PBS three times before placing it into a sterile container containing 5 ml of sterile PBS. 4. Sonicate the explanted catheters to remove adherent bacteria. We have found that 5 min of sonication (using the Fisher Sonic Dismembrator at a setting of 2) is sufficient to remove a prototypic clinical isolate of S. aureus from both 2- and 10-day-old catheter-associated biofilms ( see Note 15 ).

214 MRSA Biofilm Assays Make serial dilutions of each sample and plate on an appropriate medium to obtain quantitative colony counts. Correct for the dilution factor and the volume plated to determine the total number of bacteria recovered per explanted catheter. 4 Notes 1. This formulation provides enough plasma to coat just over one full plate (125 wells). While this adds considerable expense to the protocol, we have tried alternative concentrations (as low as 5 %) and have found that this increases variability between wells. Nevertheless, variability is unavoidable, and for this reason it is mandatory that all assays be done in replicates. We typically employ at least four and sometimes eight wells per test strain. 2. This incubator has a heated platform with a removable cover, which allows us to do our assays on the benchtop while maintaining 37 C in the flow cell itself. A standard laboratory incubator can be used assuming it can accommodate all components of the flow cell system or has ports that can be used to extend the tubing from the media reservoir/pump to the spentmedium collection vessel. 3. There are a number of suitable choices for murine species. We chose to use NIH Swiss mice based on studies indicating that these mice are also an appropriate choice for our other experiments investigating the pathogenesis of staphylococcal septic arthritis. 4. There are a number of options for murine anesthesia. We have found that administration of TBE results in a rapid and predictable anesthesia with a relatively low incidence of adverse reactions or overdose. 5. If cultures did not grow comparably, it may be necessary to make appropriate modifications to the starting dilution. Note that we have also tried alternative starting densities for these assays and have found that a 1:200 dilution, which corresponds to an OD (560 nm) of approx. 0.05, yields the most reproducible results. 6. It may be necessary to dilute the eluted stain in PBS in order to obtain an absorbance value within the linear range of the plate reader. Results can be expressed in terms of absolute absorbance value, but we often express our results relative to a well-characterized reference strain. This is particularly appropriate when screening mutants generated in the reference strain. 7. To avoid wasting plasma, do not open the stopcocks on the bubble trap at this time. If bubbles accumulate during this step, ensure that they do not remain inside the flow chamber

215 210 James E. Cassat et al. itself before incubating at 4 C. Bubbles inside the tubing are acceptable at this point. 8. A sufficiently sized sterile media reservoir must be used to ensure that the flow of medium is not compromised once established. The 10-L media reservoir from IBI Scientific (Fig. 4 ) comes prefitted with tubing and is highly recommended. Ensure that the media reservoir is sufficiently sterilized by autoclaving, because the biofilm medium in the reservoir can become contaminated easily. 9. Alternatively, the flow cell output manifold may be removed, and each of the three flow cell chamber effluents may be collected individually for subsequent analyses. 10. With our prototype clinical isolate (UAMS-1) and its corresponding mutants, we typically use 0.5 ml of a standardized overnight culture to inoculate each flow cell [ 5 ]. 11. Flow rate is an experimentally defined parameter. Setting a flow rate that is too slow will result in planktonic growth within the flow chamber, owing to a failure to remove nonadherent cells. Setting a flow rate that is too fast will prevent biofilm growth, owing to the presence of high shear forces. It may be necessary to set up multiple experiments with varying flow rates, especially when comparing S. aureus mutants thought to be impaired in biofilm formation. 12. The relationship between OD and viable cell counts depends on many factors and should be determined empirically for each isolate of S. aureus. 13. It is highly recommended that infected mice be sufficiently anesthetized such that after inoculation the bacterial suspension can settle in the lumen of the catheter without being disturbed by movement of the mouse. 14. Signs of distress in mice include any of the following: rapid breathing rate; slow, shallow, or labored breathing; rapid weight loss; ruffled fur or rough hair coat; hunched posture; difficulty moving; hypothermia or hyperthermia; anorexia; diarrhea; or constipation. 15. Since strains of S. aureus have varying capacities for both adherence and persistence within a biofilm, it is highly recommended that additional mice be included in the experimental protocol for the purpose of determining the appropriate amount of sonication. Using aseptic technique, sonicate the catheter in 5 ml of PBS for 30 s (this volume of PBS allows sufficient space for the sonicating tip to operate without touching the catheter segment). Remove 100 μl for serial dilution and subsequent determination of colony-forming units. Repeat this step after another 30 s of sonication.

216 MRSA Biofilm Assays 211 References 1. Lewis K (2001) Riddle of biofilm resistance. Antimicrob Agents Chemother 45: Keren I, Kaldalu N, Spoering A et al (2004) Persister cells and tolerance to antimicrobials. FEMS Microbiol Lett 230: Patti JM, Allen BL, McGavin MJ et al (1994) MSCRAMM-mediated adherence of microorganisms to host tissues. Annu Rev Microbiol 48: Sillanpaa J, Xu Y, Nallapareddy SR et al (2004) A family of putative MSCRAMMs from Enterococcus faecalis. Microbiology 150: Beenken KE, Blevins JS, Smeltzer MS (2003) Mutation of sara in Staphylococcus aureus limits biofilm formation. Infect Immun 71: Cafiso V, Bertuccio T, Santagati M et al (2004) Presence of the ica operon in clinical isolates of Staphylococcus epidermidis and its role in biofilm production. Clin Microbiol Infect 10: Fitzpatrick F, Humphreys H, O Gara JP (2005) The genetics of staphylococcal biofilm formation-will a greater understanding of pathogenesis lead to better management of device-related infection? Clin Microbiol Infect 11: Cramton SE, Gerke C, Schnell NF et al (1999) The intracellular adhesin ( ica ) locus is present in Staphylococcus aureus and is required for biofilm formation. Infect Immun 67: Beenken KE, Dunman PM, McAleese F et al (2004) Global gene expression in Staphylococcus aureus biofilms. J Bacteriol 186: Fitzpatrick F, Humpreys H, O Gara JP (2005) Evidence for icaadbc -independent biofilm development mechanism in methicillinresistant Staphylococcus aureus clinical isolates. J Clin Microbiol 43: O Neill E, Pozzi C, Houston P et al (2007) Association between methicillin susceptibility and biofilm regulation in Staphylococcus aureus isolates from device-related infections. J Clin Microbiol 45: Rice KC, Mann EE, Endres JL et al (2007) The cida murein hydrolase regulator contributes to DNA release and biofilm development in Staphylococcus aureus. Proc Natl Acad Sci USA 104: Fluckiger U, Ulrich M, Steinhuber A et al (2005) Biofilm formation, icaadbc transcription, and polysaccharide intercellular adhesin synthesis by staphylococci in a device- related infection model. Infect Immun 73: McKenney D, Pouliot KL, Wang Y et al (1999) Broadly protective vaccine for Staphylococcus aureus based on an in vivo-expressed antigen. Science 284: Yao Y, Sturdevandt DE, Otto M (2005) Genome wide analysis of gene expression in Staphylococcus epidermidis biofilms: insights into the pathophysiology of S. epidermidis biofilms and the role of phenol-soluble modulins in formation of biofilms. J Infect Dis 191: Yarwood JM, Bartels DJ, Volper EM et al (2004) Quorum sensing in Staphylococcus aureus biofilms. J Bacteriol 186: Vuong C, Gerke C, Somerville GA et al (2003) Quorum-sensing control of biofilm factors in Staphylococcus epidermidis. J Infect Dis 188: Schwartz K, Syed AK, Stephenson RE et al (2012) Functional amyloids composed of phenol soluble modulins stabilize Staphylococcus aureus biofilms. PLoS Pathog 8:e Boles BR, Thoendel M, Roth AJ et al (2010) Identification of genes involved in polysaccharide- independent Staphylococcus aureus biofilm formation. PLoS One 5:e Mrak LN, Zielenska AK, Beenken KE et al (2012) saers and sara act synergistically to repress protease production and promote biofilm formation in Staphylococcus aureus. PLoS One 7:e Zielenska AK, Beenken KE, Mrak LN et al (2012) sara -mediated repression of protease production plays a key role in the pathogenesis of Staphylococcus aureus USA300 isolates. Mol Microbiol 86: Kolodkin-Gal I, Romero D, Cao S et al (2010) D-amino acids trigger biofilm disassembly. Science 328: Christensen GD, Simpson WA, Bisno AL et al (1983) Experimental foreign body infections in mice challenged with slime-producing Staphylococcus epidermidis. Infect Immun 40: Rupp ME, Ulphani JS, Fey PD et al (1999) Characterization of Staphylococcus epidermidis polysaccharide intercellular adhesin/hemagglutinin in the pathogenesis of intravascular catheter-associated infection in a rat model. Infect Immun 67: Kadurugamuwa JL, Sin L, Albert E et al (2003) Direct continuous method for monitoring biofilm infection in a mouse model. Infect Immun 71:

217 Chapter 13 Transcriptomic Analysis of Staphylococcus aureus Using Microarray and Advanced Next-Generation RNA-seq Technologies Ting Lei, Aaron Becker, and Yinduo Ji Abstract The transcriptome has shown tremendous potential for the comprehensive investigation of gene expression profiles and transcriptional levels in comparative biology, the identification of regulatory mechanism of transcriptional regulators, and the evaluation of target gene for developing new chemotherapeutic agents, vaccine, and diagnostic methods. The traditional microarray and advanced next-generation RNA sequencing technologies (RNA-seq) provide powerful and effective tools for the determination of the transcriptome of bacterial cells. In this chapter, we provide a detailed protocol for scientists who want to investigate gene expression profiles by performing microarray and/or RNA-seq analysis, including different RNA purification methods, mrna enrichment, decontamination, cdna synthesis, fragmentation, biotin labeling for hybridization using Affymetrix Staphylococcus aureus chips, quantitative real-time reverse transcription PCR, and RNA-seq data analysis. Key words Microarray analysis, Advanced next-generation RNA sequencing technologies (RNA- Seq), Real-time reverse transcription (RT) polymerase chain reaction (PCR), Gene expression 1 Introduction As we know, there are thousands of genes and their products (i.e., RNA and proteins) in any given living organism that function in a complex and orchestrated way to allow the organism to survive in a variety of environments. Traditional methods in molecular biology generally work on a one gene in one experiment basis, which means that the throughput is very limited, and the whole picture of gene function is hard to obtain. Elucidating the global interaction of all of the genes in an organism and the expression dynamics of certain pivotal genes during the growth, development, and pathogenic processes of some pathogens can provide better clues for elucidating pathogenesis and developing antimicrobial agents and preventive vaccines [ 1, 2 ]. For achieving these aims, Yinduo Ji (ed.), Methicillin-Resistant Staphylococcus aureus (MRSA) Protocols, Methods in Molecular Biology, vol. 1085, DOI / _13, Springer Science+Business Media, LLC

218 214 Ting Lei et al. microarray, RNA-seq, and real-time RT-PCR provide scientists with powerful and effective tools. A microarray, also known as a biochip, is an orderly arrangement of samples, providing a medium for matching known and unknown DNA samples based on base-pairing rules and automating the process of identifying the unknowns [ 1 ]. With the microarray assay, investigators are able to measure changes of the whole genome on a single chip and see the big picture of the interactions among thousands of genes simultaneously. Regulatory systems are part of important networks modulating the expression of S. aureus genes, including genes that control antibiotic resistance. Therefore, the elucidation of the regulons of these regulatory systems is important for us to better understand the molecular mechanisms of pathogenesis. Using a microarray-based approach, different S. aureus regulons including Agr [ 3 ], ArlRS [ 4 ], SaeRS [ 5 ], YhcSR/AirSR [ 6, 7 ], Sar [ 3 ], SigB [ 8 ], Rot [ 9 ], and Mgr [ 10 ] have been revealed. DNA microarray techniques have been used to characterize the mode of action for drugs against different bacterial pathogens [ ]. The advanced next-generation RNA sequencing (RNA-seq) is a high-throughput technology that has been extensively utilized for transcriptomic studies. When compared with the microarray assay, RNA-seq has numerous advantages because of the application of next-generation sequencing (NGS) technology [ 15 ]; RNAseq provides excellent genome coverage and can generate more than 600 million reads in a single run [ 16 ]. An RNA-seq analysis can capture almost all of the expressed transcripts of an organism so that it is possible to discover new transcripts, new splicing alternatives, and single base pair mutations as well as deletions and insertions. Moreover, RNA-seq analysis has low background noise but high sensitivity, requires less RNA, and is becoming more costeffective with the rapid advancement in NGS technology [ 17 ]. Therefore, RNA-seq has already become popular in functional genomic research and is likely to replace the microarray approaches in transcriptomic studies [ 18 ]. Recently, the RNA-seq technologies have been increasingly used for bacterial transcriptomic analysis. Novel genes, regulatory small RNAs, and transcription regulation networks have been detected [ 16, 19 ]. The Illumina RNA-seq has been used to examine the transcriptome of the S. aureus N315 isolate. It was revealed that approximately 10 % of the transcripts were previously uninvestigated [ 20 ]. This allows researchers to further explore their biological functions in S. aureus. Real-time RT-PCR has also been widely applied in investigating gene expression levels owing to its high specificity and sensitivity, the ease of calculating the exact amount of original template RNA molecules, and the fact that it is easier to manipulate compared to northern blotting [ 21, 22 ]. Real-time RT-PCR is still the most efficient and sensitive method to measure gene transcription levels and is the reference for RNA-seq analysis quality [ 23 ]. We have

219 Transcriptomic Analysis 215 been using microarrays, RNA-seq, and real-time RT-PCR to explore the functions of certain genes important for survival and/ or pathogenesis of S. aureus. In this chapter, we introduce the protocol of RNA preparation, microarray, RNA-seq using Illumina, and real-time RT-PCR for S. aureus. 2 Materials 2.1 Cell Culture and Lysis 2.2 RNA Purification (See Note 1 ) 2.3 cdna Synthesis and Fragmentation 2.4 cdna Labeling 2.5 Real- Time RT-PCR 1. Tryptic Soy Broth medium. 2. Bacterium strain, Staphylococcus aureus. 3. Lysostaphin (Sigma). 4. Lysozyme (Sigma). 1. Wizard SV Total RNA Isolation System (Promega, Madison, WI). 2. MICROB Express Bacterial mrna Enrichment Kit (Ambion, Life Technologies ). 3. Nuclease-free tubes (15 and 1.5 ml) and tips. 4. DEPC-treated water. 5. Isopropanol, 70 % ethanol, and dehydrated ethanol. 6. Phenol: Chloroform, ph 4.5 (Phenol: Chloroform: Isoamyl alcohol is 25:24:1). 7. DNA-free Kits (Ambion). 8. Mini-BeadBeater-8 (BioSpec Products, Inc). 9. Ambion Single Place Magnetic Stand (Ambion). 1. Random hexamers (250 ng/μl) mm dntp (datp, dctp, dttp, dgtp, each 2.5 mm). 3. SuperScript III Reverse Transcriptase (200 U/μl), 5 first strand cdna synthesis buffer, 0.1 M DTT (Invitrogen, Carlsbad, CA). 4. RNase H (5 U/μl, Biolabs). 5. QIAquick PCR Purification Kit (Qiagen). 1. Terminal transferase with 5 Reaction Buffer and CoCl 2 (25 mm), Biotin-ddUTP (Roche). 2. Wizard SV Gel and PCR Clean-up System (Promega). 3. NeutrAvidin. 1. Control DNA template, usually titrated vector DNA or PCR products ( copies). 2. Primers used for real-time PCR.

220 216 Ting Lei et al. 3. Spectrofluorometric thermal cycler (optimal cycling conditions will vary on different real-time instruments). In this protocol, Mx3000PTM from Stratagene is employed. 4. Real-time PCR Kit, including 2 Brilliant SYBR Green qpcr master mix. 5. Optically clear 96-well plate for RT-PCR well plate optically clear sealing film for RT-PCR. 3 Methods 3.1 Total RNA Extraction and Purification of S. aureus Method 1: Isolation of Total RNA from S. aureus Using Wizard SV Total RNA Isolation System (Promega) 1. Incubate S. aureus : Isolates are cultured overnight at 37 C in TSB with appropriate antibiotics, if applicable, and with shaking (225 rpm). The following day, prepared 1 % dilutions of overnight cultures in fresh TSB and culture until the OD 600nm reaches This should take only a few hours. If growth is too slow, reduce the dilution factor. 2. Transfer 3 ml of culture to a 10 ml tube. Centrifuge for 2 min at 14,000 g. 3. Carefully remove the supernatant, leaving the pellet as dry as possible. 4. Resuspend the pellet in 100 μl of freshly prepared TE, add 6.5 μl of lysostaphin (2 mg/ml) and 6 μl of lysozyme (50 mg/ml), mix, and incubate the tube at 37 C for 6 8 min (not longer than 10 min). Mix one time during the incubation period. 5. Add 75 μl of SV RNA lysis buffer. 6. Add 350 μl of RNA dilution buffer. Gently mix by inversion until the content becomes clear. Do not centrifuge. 7. Add 200 μl of 95 % ethanol to the cleared lysate and mix by pipetting to cut the genomic DNA until the content becomes clear. 8. Transfer the transparent content into a spin column, which has been put in a collection tube, and centrifuge the spin column assembly at 14,000 g for 1 min. 9. Discard the follow-through solution, and add 600 μl of SV RNA wash solution to the spin column. Centrifuge the spin column assembly at 14,000 g for 1 min. 10. Empty the collection tube as before and prepare the DNase I incubation mix by combining (in this order) 40 μl yellow core buffer, 5 μl of 0.09 M MnCl 2, and 5 μl of DNase I enzyme per sample in a sterile tube. Apply 50 μl of this freshly prepared DNase I incubation mix directly to the membrane inside the spin basket, making sure that the solution is in contact with and thoroughly covering the membrane.

221 Transcriptomic Analysis Incubate for 15 min at room temperature and then add 200 μl of SV DNase stop solution to the spin column and centrifuge at 14,000 g for 1 min. 12. Add 600 μl of SV RNA wash solution and centrifuge at 14,000 g for 1 min. 13. Empty the collection tube and add 250 μl of SV RNA wash solution. Centrifuge at high speed for 2 min. 14. Transfer the spin column to a sterile 1.5 ml centrifuge tube, remove the cap of the tube, and apply 100 μl of nuclease-free water to the column membrane. Be sure to completely cover the surface of the membrane with the water. Centrifuge at 14,000 g for 1 min. Remove the spin column and discard. Cap the elution tube containing the purified RNA and immediately move to DNase I treatment or store at 70 C. 15. Add 11 μl of 10 DNase I buffer and 2 μl of DNase I (2 U/μl) to the RNA solution to digest the contaminated genomic DNA. Mix and spin briefly to collect the solution at the bottom of the tube, and keep the tube at 37 C for 30 min. 16. Add 1/10 volume of DNase I inactivator (Ambion) to the RNA solution to remove the DNase I. Mix and keep it at room temperature for 2 min (mixing once during this period). 17. Centrifuge the reaction at 12,000 g for 2 min. Transfer the supernatant containing the RNA to a sterilized clean tube, careful not to carry over any DNase I inactivator. 18. Measure the quality and quantity of purified RNA by using a photometer (1OD 260 = 40 μg, the ratio of OD 260 /OD 280 should be among ). The purified RNA should be stored at 70 C Method 2: Extracting Total RNA from S. aureus Using Phenol 1. Culture the bacterium at 37 C to the stationary phase (OD 600nm = ), then dilute the cells 1:100 with fresh TSB, and continue to culture at 37 C to the mid-exponential phase (OD 600nm = ). 2. Collect the bacteria of 30 ml cultures by centrifuging at 8,000 g for 10 min and discard the supernatants. 3. Resuspend the pellets in 1 ml of TE (50 mm Tris HCl, 1 mm EDTA) containing glucose (25 %). 4. Add μl of lysostaphin (2 mg/ml), mix gently, and then incubate at 37 C for 10 min. [ Alternatively, use this method to disrupt the bacterial cell wall : Suspend the bacteria pellets in 1.5 ml of DEPC water, then transfer the cell suspension to a 2 ml Eppendorf tube containing approximately equal volumes (about 1 ml) of silica/zirconia beads (0.1 mm size). Insert the tube into the wells of the shaker of a Mini-BeadBeater-8 and shake the tube vigorously at the maximum speed for 3 min.

222 218 Ting Lei et al. After the BeadBeater machine stops, transfer 1 ml of supernatant to a sterile Eppendorf tube ( see Note 2 ).] 5. Add 1 ml lytic buffer (20 mm NaAc, ph 5.5; 1 mm EDTA; 1 % SDS) to the bacteria solution and gently mix by inversion several times until the mixture becomes clear. 6. Add 2 ml of acidic phenol/chloroform; vigorously mix the mixture by inversion for 3 5 min. 7. Centrifuge the mixture at 12,000 g for 20 min at 4 C, carefully transfer the upper aqueous phase to a new tube, and extract the supernatant again with acidic phenol/chloroform and chloroform separately. 8. Carefully transfer the supernatant to a new tube without disturbing the interface. 9. Add an equal volume of cold isopropyl alcohol to solution and mix it by inversion. Keep the tube at 20 C for 3 h or overnight to precipitate the RNA. 10. Centrifuge the RNA at 12,000 g for 15 min at 4 C. Remove the solution, wash RNA pellets with 70 % alcohol, and dry the RNA pellets at room temperature for 5 10 min. 11. Redissolve the RNA pellets with 100 μl of nuclease-free water. 12. Remove the genomic DNA contamination and check the quality and quantity of RNA following the steps of Method 1 (Subheading ). 3.2 Microarray Analysis Synthesis of First Strand cdna 1. Put the reagents in a sterilized 0.2 ml tube as follows: Total RNA Random primer x μl (12 μg) 3 μl (750 ng) 2. Add DEPC water to the total volume 30 μl, mix, and centrifuge briefly. 3. Incubate at 70 C for 10 min and keep at 25 C for 10 min. Finally, put the reaction on ice for at least 2 min. 4. Add the following components into the above RNA/primer mixture in the indicated order: (a) 5 first strand cdna synthesis buffer (b) 0.1 M DTT (c) 10 mm dntp (d) SuperRNase In. (e) SuperScript III (f) Nuclease-free H 2 O 12 μl 6 μl 3 μl 1.5 μl 5 μl 2.5 μl

223 Transcriptomic Analysis 219 The total volume of the reaction is 60 μl. Mix by pipetting up and down several times and centrifuge briefly. Incubate at 25 C for 10 min, at 37 C for 60 min, then at 42 C for 60 min. 5. Terminate the reactions by keeping the tube at 70 C for 10 min, then hold at 4 C. 6. Centrifuge the reaction tube briefly to collect products, add 20 μl of 1 N NaOH, mix, and keep at 65 C for 30 min to remove the RNA. Then add 10 μl of 1 N HCl to neutralize the solution. 7. The synthesized cdna products can be stored at 20 C Purifi cation and Quantifi cation of cdna Synthesis Products cdna Fragmentation Use the QIAquick PCR Purification Kit to clean up the cdna synthesis product following the protocol provided by the supplier (Qiagen, see Note 3 ). 1. Prepare the following reaction mixture on ice ( see Note 4 ): 10 DNase I Buffer 5 μl cdna DNase I (2 U/μl) Nuclease-free H 2 O X μl (6 μg) 0.18 μl (the concentration is 0.6 U/μg cdna) up to 50 μl 2. Mix gently and centrifuge briefly to collect the reaction mixture. Incubate the reaction at 37 C for 10 min. Inactivate the enzyme at C for 10 min Quality Control/ Agarose Gel Electrophoresis Terminal Labeling For quality control, pre- and post-fragmented cdna samples are analyzed by agarose gel electrophoresis (Fig. 1 ). 1. Cast a 2 % agarose gel containing 0.5 μg/ml of ethidium bromide (EB) using TAE. 2. Analyze the fragmented cdna (~500 ng) and the total cdna (~500 ng) as a control by electrophoresis. Use 100 bp DNA ladder (Promega) as a marker for size determination. The desired result should yield a majority of the DNA fragments within a distribution of bp. The 3 termini of the fragmentized cdna are labeled using the biotin-ddutp by terminal transferase (Roche). 1. Prepare the following reaction mix: 5 Reaction Buffer 14 μl 5 CoCl 2 (25 Mm) 14 μl Biotin-ddUTP Terminal deoxyribonucleotide transferase Fragmentized cdna The total volume 1 μl 2 μl 39 μl (4 5 μg) 70 μl

224 220 Ting Lei et al. Fig. 1 Two percent agarose gel analysis of pre- and post-fragmented cdna. Lane 1, 6: 100 bp DNA marker; Lane 2, 3: total cdna; Lane 4, 5 fragmented cdna 2. Incubate the reaction for 1 h at 37 C. Add 1.5 μl of 0.5 M EDTA to terminate the reaction. (This labeled fragmented cdna can be used for microarray directly.) 3. Remove unincorporated biotin label either by using the QIAGEN RNA/DNA Mini Columns or by ethanol precipitation (if using ethanol, add 50 μg of glycogen as a carrier, 1/10 volume of 3 M sodium acetate, and 2.5 volume of ethanol to samples to precipitate the labeled fragmentized cdna). Follow this by twice washing the pellets with 750 μl of 70 % ethanol. Then, for either method, dissolve the cdna in μl of nuclease-free water. 4. Quantify the cdna product by 260 nm absorbance. Typical yields for the procedure are 3 4 μg of cdna Analysis of the Labeling Effi ciency by Gel Shift Assay 1. Prepare a NeutrAvidin solution (2 mg/ml in 50 mm Tris HCl, ph 7.0). 2. Prepare ng aliquots of fragmented and biotinylated sample in a fresh tube, add 5 μl of 2 mg/ml NeutrAvidin to each sample, mix, and incubate at room temperature for 5 min. 3. Run the cdna sample in a 4 20 % TBE polyacrylamide gel at 150 V until the front dye (red) almost reaches the bottom. 4. Stain the gel with 1 solution of SYBR Green II or 0.5 μg/ml of EB solution. 5. Place the gel on the UV light box and produce an image.

225 Transcriptomic Analysis Hybridization, Signal Detection, and Data Collection 3.3 Real- Time RT-PCR cdna Synthesis Preparing the Real-Time PCR Reaction (See Note 5 ) The Genechips of S. aureus are supplied by Affymetrix. Follow the supplier s protocol for hybridization, signal detection, image scanning, and data collection. 1. Set up a 20 μl reaction by adding the following components: 1 2 μl of random primers (100 ng, included in the cdna synthesis kit) 1 μl of dntp mix (10 mm each) 1 μg of total RNA 2. Add nuclease-free water to 13 μl of total volume. 3. Heat the mixture at 65 C for 10 min, then chilled it on ice immediately. 4. Collect the contents of the tube by brief centrifugation. Add the following reagents to the tube: 4 μl of 5 First-Strand Buffer 2 μl of 0.1 M DTT 5. Incubate the reaction at 25 C for 2 min, add 1 μl of SuperScript III Reverse Transcriptase (200 units), and incubate the reaction at 25 C for 10 min, followed by 42 C for 50 min. 6. Inactivate the enzymes by heating the reaction to 70 C for 15 min. 1. Thaw the Brilliant SYBR Green qpcr master mix at room temperature, store it on ice, and keep the unused portion at 4 C in a dark container ( see Note 6 ). Dilute the reference dye 1:500 in nuclease-free water if it will be used in the reaction. Dilute the primers to a concentration of 3 μm. Dilute the template cdna for a final concentration of 20 ng/μl. 2. Set up the reaction mixture. For a single reaction mixture of 15 μl, add the following components into each well of the 96-well plate: 7.5 μl of 2 master mix 1.0 μl of upstream and downstream primer (3.0 μm each), respectively μl of diluted preference dye (optional, final concentration: 30 nm) 1.0 μl of diluted cdna template (The amount of cdna could vary from 1 to 1,000 ng depending on the abundance of the specific mrna in the cells or the diluted genomic DNA in control experiment.) Adjust the final volume to 15 μl with nuclease-free water. Gently mix the reactions without creating bubbles, and centrifuge the reactions briefly ( see Note 7 )

226 222 Ting Lei et al. 3. Seal the 96-well plate with an optically clear thermostable film. Put the plate with the reaction mixtures onto the RT-PCR instrument ( see Note 8 ). 4. Run the PCR program according to the following procedure being applied to the amplification of bp DNA fragment: Cycle(s) Temperature Duration of cycle 1 (denature) 95 C 5 min 40 (amplification) 95 C 30 s C 1 min 72 C 30 s 1 (dissociation) 95 C 1 min C 1 min After the program is finished (about 2.5 h), save and then analyze the data on the computer using the software provided by the manufacturer. 3.4 RNA-seq Analysis mrna Enrichment Total RNA Precipitation ( See Note 9 ) Anneal RNA and Capture Oligonucleotide Mix MICROBExpress Bacterial mrna Enrichment system is utilized for bacterial RNA-seq analysis with the paired-end Illumina RNAseq technologies. 1. Precipitate the RNA by adding the following and mixing well: 0.1 volume 5 M ammonium acetate or 3 M sodium acetate, 5 μg glycogen (optional) ( see Note 10 ), volumes 100 % ethanol. 2. Leave the mixture at 20 C overnight or quick-freeze it in ethanol and dry ice or in a 70 C freezer for 30 min. 3. Recover the RNA by centrifugation at 12,000 g for 30 min at 4 C. 4. Carefully remove and discard the supernatant. Then centrifuge the tube briefly a second time, and aspirate any additional fluid. 5. Add 1 ml ice cold 70 % ethanol, and vortex the tube. 6. Re-pellet the RNA by centrifuging for 10 min at 4 C. Remove the supernatant as in step Repeat steps 5 and Dissolve the RNA in 15 μl TE (10 mm Tris HCl ph 8, 1 mm EDTA) or the RNA Storage Solution. 1. Add 200 μl Binding Buffer into a 1.5 ml tube and add total RNA (2 10 μg in a maximum volume of 15 μl) to the Binding Buffer. Close the tube and tap or vortex gently to mix. 2. Add 4 μl of Capture Oligo Mix to the RNA in Binding Buffer. Close the tube and tap or vortex gently to mix, and microfuge briefly to get the mixture to the bottom of the tube.

227 Transcriptomic Analysis Incubate the mixture at 70 C for 10 min denatures secondary structures in RNA, including the 16S and 23S rrnas. 4. Incubate the mixture at 37 C for 15 min ( see Note 11 ) to allow the capture oligonucleotides to hybridize to homologous regions of the 16S and 23S rrnas. Prepare the Oligo MagBeads Capture the rrna and Recover the Enriched mrna Precipitate and Resuspend the Enriched mrna 1. Add 50 μl Oligo MagBeads to a 1.5 ml tube ( see Note 12 ). Capture the Oligo MagBeads by placing the tube on a magnetic stand. Discard the supernatant by aspiration. 2. Add 50 μl nuclease-free water to the captured Oligo MagBeads. Remove the tube from magnetic stand and resuspend the beads by brief gentle vortexing. Recapture the Oligo MagBeads with a magnetic stand and discard the nuclease-free water. 3. Add 50 μl Binding Buffer to the captured Oligo MagBeads. Remove the tube from magnetic stand and resuspend the beads by brief gentle vortexing. Recapture the Oligo MagBeads with a magnetic stand, and discard the Binding Buffer. 4. Add fresh Binding Buffer to the captured Oligo MagBeads. Remove the tube from magnetic stand and resuspend the beads by brief gentle vortexing. Place the Oligo MagBead slurry in a 37 C incubator, and allow the temperature to equilibrate to 37 C. 1. Gently vortex the tube of washed and equilibrated Oligo MagBeads from Subheading Prepare the Oligo MagBeads. Add 50 μl of Oligo MagBeads to the RNA/Capture Oligo Mix from Subheading Anneal RNA and Capture Oligonucleotide Mix. 2. Very gently vortex or tap the tube to mix and microfuge very briefly to get the mixture to the bottom of the tube. 3. Incubate 15 min at 37 C. 4. Capture the Oligo MagBeads by placing the tube on the magnetic stand. Carefully remove the supernatant with a pipette which contains the enriched mrna and transfer it to a collection tube on ice. 5. Add 100 μl wash solution that has been prewarmed to 37 C to the captured Oligo MagBeads. Remove the tube from the magnetic stand, and resuspend the beads. Recapture the Oligo MagBeads with a magnetic stand and pool the supernatant with the RNA already in the collection tube. 1. Add 1/10th volume 3 M sodium acetate (35 μl), 1/50th volume glycogen (5 mg/ml) to the pooled mrna (the volume should be 350 μl), and briefly vortex to mix. 2. Add 3 volumes ice cold 100 % ethanol (1,175 μl) and vortex to mix thoroughly. 3. Precipitate at 20 C for at least 1 h.

228 224 Ting Lei et al. 4. Centrifuge for 30 min at 10,000 g and carefully decant and discard the supernatant. 5. Add 750 μl ice cold 70 % ethanol and vortex briefly. Centrifuge for 5 min at 10,000 g. Discard the supernatant. 6. Repeat step Air dry the pellet for 5 min. 8. Resuspend the RNA pellet in 25 μl nuclease-free water. Rehydrate the RNA for 15 min at room temperature ( see Note 13 ). The mrna sample is ready for sequencing Next-Generation Sequencing of Enriched mrna Samples The following is the workflow for a paired-end RNA-seq method. 1. Sample quality assessment. The mrna isolates are quantified using a fluorometric RiboGreen assay. Total RNA integrity is assessed using capillary electrophoresis (Agilent Bioanalyzer 2100), generating an RNA integrity number (RIN). For samples to pass the initial QC step, they need to quantify higher than 1 μg and have a RIN of 8 or greater, and then they are converted to Illumina sequencing libraries. 2. Library creation. mrna samples are converted to Illumina sequencing libraries using Illumina s TruSeq RNA Sample Preparation Kit (Cat. # RS or RS ) (please see for a detailed list of kit contents and methods). In summary, 1 μg of total RNA is oligo-dt purified using oligo-dt- coated magnetic beads, fragmented, and then reverse transcribed into cdna. The cdna is fragmented, blunt-ended, and ligated to indexed (bar-coded) adaptors and amplified using 15 cycles of PCR. Final library size distribution is validated using capillary electrophoresis and quantified using fluorometry (PicoGreen) and via qpcr. Indexed libraries are then normalized, pooled, and then size selected to 320 bp ± 5 % using Caliper s XT instrument. 3. Cluster generation and sequencing. TruSeq libraries are hybridized to a paired-end flow cell, and individual fragments are clonally amplified by bridge amplification on the Illumina cbot. Once clustering is complete, the flow cell is loaded on the HiSeq 2000 and sequenced using Illumina s SBS chemistry. Upon completion of read 1, a 7 bp index read is performed. Finally, the library fragments are resynthesized in the reverse direction and sequenced from the opposite end of the read 1 fragment thus producing the template for paired-end read Primary analysis and demultiplexing. Base call (.bcl) files for each cycle of sequencing are generated by Illumina Real-Time Analysis (RTA) software. The base call files and run folders are then exported to servers. Primary analysis and demultiplexing

229 Transcriptomic Analysis 225 are performed using Illumina s CASAVA software The end result of the CASAVA workflow is demultiplexed FASTQ files that are ready for subsequent transcriptome analysis Data Analysis Upload the Data Quality Control with FastQC Transfer the FASTQ Files to Sanger Type ( See Note 15 ) Map the Short Reads to the Reference Genome ( See Note 16 ) The massive data generated by the high-throughput NGS technology requires complex computations. However, the computational resources can be difficult to use. In addition, the integrative analysis, which uses multiple data sources and multiple computational tools, further complicates the reproducibility [ 19 ]. All these problems impede the scientists without programming or informatics expertise. Galaxy ( ) is an open web-based platform integrated with comprehensive computational tools that enables users to perform bioinformatic analysis of genomic data on an interactive, user-friendly workbench. It also enables descriptive information about datasets, tools, as well as their invocation, which guarantees the exact reproducible analyses. In this chapter, we provide a brief workflow of the gene differential expression analysis between two S. aureus samples using Galaxy. For more detailed information of how to use Galaxy, please visit the website main.g2.bx.psu.edu/ for more resources. 1. Import the FASTQ files of the two bacterial samples through Get Data or the Shared Data/Data Libraries. 2. Import the whole genome sequence file as a reference genome. It is usually fna type. 3. Import the strain-specific genomic annotation file of S. aureus ( see Note 14 ). The annotation files are usually gtf or gff format. The operation will be shown in History panel on the right. It is important to always verify the integrity of a dataset before starting to analyze it. 1. Click NGS: QC and manipulation/fastqc: Read QC, select a FASTQ file in Short read data from your current history, and then execute. 2. Click the eye icon in the current step in the History to display the file in the center pane. Check the sequence quality through Per base sequence quality. For each base, the quality score should be above 30. Click NGS: QC and manipulation/fastq Groomer: to change the current FASTQ format to Sanger format. Select a FASTAQ file under File to groom and select Sanger under Input FASTQ quality scores type and then execute. Click NGS: Mapping/Map with Bowtie for Illumina, select the uploaded reference genome under Will you select a reference genome from your history or use a built-in index?, select Paired- end

230 226 Ting Lei et al. under Is this library mate-paired?, choose the uploaded Forward and Reverse FASTQ files (already transferred to Sanger format) under Forward FASTQ file and Reverse FASTQ file, select Full parameter list under Bowtie settings to use, and adjust the proper number under Trim n bases from high-quality (left) end of each read before alignment (-5) and Trim n bases from lowquality (right) end of each read before alignment (-3) according to the adapter length and the per base sequence quality score. The adapter sequence will be trimmed from 5 end, and the bases with poor quality will be trimmed from 3 end, and then execute. Remove Unmapped Reads Compare the mrna Transcription Levels Between Two Samples Select NGS: SAM Tools/Filter SAM, select mapped SAM files from Map with Bowtie for Illumina, click Add new Flag and select the read that is unmapped under Type, and then execute. 1. Select NGS: Picard (beta)/sortsam, select filtered SAM files under BAM/SAM file, select coordinate under Output Sort Order, and then click Create. 2. Select NGS: RNA Analysis/Cuffdiff, input the uploaded gene annotation gtf files under Transcripts ( see Note 17 ), input the sorted SAM files of the two samples under each SAM or BAM file of aligned RNA-Seq reads respectively, and then execute. 3. There are 11 results returned on the History panel. For gene differential expression analysis of prokaryotes, the valuable result is Cuffdiff on data X, data Y, and data Z: transcript differential expression testing or Cuffdiff on data X, data Y, and data Z: gene differential expression testing. Click the eye icon to view the results or click the save button to download the results for further analysis. 4 Notes 1. Ribonucleases are extremely difficult to inactivate. Avoid inadvertently introducing RNase activity into your RNA sample during or after the isolation procedure. You should use sterile technique when handling all the reagents and wear gloves at all times. Treatment of non-disposable glassware and plastic wares is necessary to ensure they are free of RNase. Bake glassware at 200 C overnight, and thoroughly rinse plastic ware with 0.1 N NaOH, 1 mm EDTA followed by RNase-free water. Treat solutions supplied by the user by adding diethylpyrocarbonate (DEPC) to 0.1 % and then incubating overnight at room temperature and autoclaving for 30 min to remove any trace of DEPC. 2. This method isolates large amounts of total RNA from S. aureus. Therefore, the method chosen is dependent on how much RNA you want to prepare for your assay.

231 Transcriptomic Analysis Removal of all residual ethanol from the spin column is critical for the success and reproducibility of the following step. To ensure ethanol removal, the column should be centrifuged for at least 10 min at high speed in a clean Eppendorf tube following the wash step. 4. The amount of DNase I required for the cdna fragmentation can vary from supplier to supplier. A titration experiment should be performed with each new batch of enzyme. The high active enzyme should be diluted with 1 DNase I buffer first, and the DNase I should be added to the reaction last. 5. When designing the RT-PCR experiment, standard and blank controls, and/or no reverse transcriptase controls must be considered. Good quantitative PCR (qpcr) results must also contain those data. 6. The SYBR Green dye and the reference dye are light sensitive. They should be stored away from light. 7. The bubbles in the reaction mixture may interfere with fluorescence detection. Prepare the reaction mixture carefully to avoid forming bubbles. 8. The 96-well plate with reaction mixtures should be sealed tightly with optically clear thermostable film because reaction mixture evaporation may lead to the loss of the reaction volume and cause the polymerase to malfunction. 9. RNA integrity is critically important for the success of the MICROB Express procedure. Even moderate levels of RNA degradation can lead to inefficient removal of rrna by the capture reagents. Verify the integrity of the RNA by comparing the intensity of the 23S and 16S rrna signals; in the highquality RNA samples, the 23S rrna band will be 1.5- to 2-fold brighter than the 16S rrna band. In addition, it is extremely important not to overload the MICROB Express system. The recommended total bacterial RNA is 10 μg. If more than 10 μg RNA is added, rrna removal will be incomplete. 10. The glycogen acts as carrier to increase precipitation efficiency from dilute RNA solutions; it is unnecessary for solutions with 200 μg RNA/ml. 11. To reach a more complete binding of capture oligonucleotide to rrnas, the incubation time can be extended to 1 h. 12. The volume of 50 μl Oligo MagBeads is for one RNA sample. Oligo MagBeads for up to ten RNA samples (500 μl) can be processed in a single 1.5 ml tube. 13. It is not recommended to heat the RNA sample(s) to 70 C for dehydration, if the RNA sample is in nuclease-free water, because non-chelated divalent cations can cause hydrolysis of RNA at high temperatures.

232 228 Ting Lei et al. 14. For the source of the reference genome and genomic annotation files of prokaryotes, you can search the NCBI database through the linkage ftp://ftp.ncbi.nlm.nih.gov/genomes/bacteria/. 15. You can also change the format through edit attributes/ Datatype/Change data type, entering fastqsanger under New Type. 16. The prokaryote genome is more compact than the eukaryote. There are few introns in the genome and the mrnas do not require splicing. Thus mapping genome with prokaryotes does not include TopHat, which is applied for eukaryotic genome mapping. 17. Cuffdiff only recognizes gtf format of the genomic annotation files. For the genomic annotation files in gff format, you have to convert the gff format into gtf format. This operation is beyond the Galaxy s capability; please contact the bioinformatics expertise to solve the problem. Acknowledgements We thank Dr. Ying Zhang at the Minnesota Supercomputing Institute for the assistance with data analysis and Jeffrey Hall for critical reading and suggestions. This work was supported by grant AI from the National Institute of Allergy and Infectious Diseases. References 1. Ramsay G (1998) DNA chips: state-of-the art. Nat Biotechnol 16: Chin KV, Kong A (2002) Application of DNA microarrays in pharmacogenomics and toxicogenomics. Pharm Res 19: Dunman P, Murphy E, Haney S et al (2001) Transcription profiling-based identification of Staphylococcus aureus genes regulated by the agr and/or sara loci. J Bacteriol 183: Liang X, Zheng L, Landwehr C et al (2005) Global regulation of gene expression by ArlRS, a two-component signal transduction regulatory system of Staphylococcus aureus. J Bacteriol 187: Liang X, Yu C, Sun J et al (2006) Inactivation of a two-component signal transduction system, SaeRS, eliminates adherence and attenuates virulence of Staphylococcus aureus. Infect Immun 74: Yan M, Hall JW, Yang J et al (2012) The essential yhcsr two-component signal transduction system directly regulates the lac and opu- CABCD operons of Staphylococcus aureus. PLoS One 7(11):e Sun F, Ji Q, Jones MB et al (2012) AirSR, a [2Fe-2S] cluster-containing two-component system, mediates global oxygen sensing and redox signaling in Staphylococcus aureus. J Am Chem Soc 134: Bischoff M, Dunman P, Kormanec J et al (2004) Microarray-based analysis of the Staphylococcus aureus σ regulon. J Bacteriol 186: Saïd-Salim B, Dunman P, McAleese F et al (2003) Global regulation of Staphylococcus aureus genes by rot. J Bacteriol 185: Luong T, Dunman P, Murphy E et al (2006) Transcription profiling of the mgra regulon in Staphylococcus aureus. J Bacteriol 188: Bammert G, Fostel J (2000) Genome-wide expression patterns in Saccharomyces cerevisiae : comparison of drug treatments and genetic

233 Transcriptomic Analysis 229 alternations affecting biosynthesis of ergosterol. Antimicrob Agents Chemother 44: Gmuender H, Kuratli K, Di Padova K et al (2001) Gene expression changes triggered by exposure of Haemophilus influenzae to novobiocin or ciprofloxacin: combined transcription and translation analysis. Genome Res 11: Khodursky A, Peter B, Schmid M et al (2000) Analysis of topoisomerase function in bacterial replication fork movement: use of DNA microarrays. Proc Natl Acad Sci USA 97: Wilson M, DeRisi J, Kristensen H et al (1999) Exploring drug-induced alternations in gene expression in Mycobacterium tuberculosis by microarray hybridization. Proc Natl Acad Sci USA 96: Metzker ML (2010) Sequencing technologies the next generation. Nat Rev Genet 11: Pinto AC, Melo-Barbosa HP, Miyoshi A et al (2011) Application of RNA-seq to reveal the transcript profile in bacteria. Genet Mol Res 10: Wang Z, Gerstein M, Snyder M (2009) RNA- Seq: a revolutionary tool for transcriptomics. Nat Rev Genet 10: Teng X, Xiao H (2009) Perspectives of DNA microarray and next-generation DNA sequencing technologies. Sci China C Life Sci 52: Croucher NJ, Thomson NR (2010) Studying bacterial transcriptomes using RNA-seq. Curr Opin Microbiol 13: Beaume M, Hernandez D, Docquier M et al (2011) Orientation and expression of methicillin- resistant Staphylococcus aureus small RNAs by direct multiplexed measurements using the ncounter of NanoString technology. J Microbiol Methods 84: Wilhelm J, Pingoud A (2003) Real-time polymerase chain reaction. Chembiochem 4: Arya M, Shergill IS, Williamson M et al (2005) Basic principles of real-time quantitative PCR. Expert Rev Mol Diagn 5: Roberts A, Trapnell C, Donaghey J et al (2011) Improving RNA-Seq expression estimates by correcting for fragment bias. Genome Biol 12:R22

234 Chapter 14 Proteomic Approach to Investigate Pathogenicity and Metabolism of Methicillin-Resistant Staphylococcus aureus Patrice François, Alexander Scherl, Denis Hochstrasser, and Jacques Schrenzel Abstract Over the last two decades, numerous genomes of pathogenic bacteria have been fully sequenced and annotated, while others are continuously being sequenced. To date, the sequences of more than 8,500 whole bacterial genomes are publicly available for research purposes. These efforts in high-throughput sequencing simultaneously to progresses in methods allowing to study whole transcriptome and proteome of bacteria provide the basis of comprehensive understanding of metabolism, adaptability to environment, regulation, resistance pathways, or pathogenicity mechanisms of bacterial pathogens. Staphylococcus aureus is a Gram-positive human pathogen causing a wide variety of infections ranging from benign skin infection to life-threatening diseases. Furthermore, the spreading of multidrug-resistant isolates requiring the use of last barrier drugs has resulted in a particular attention of the medical and scientific community to this pathogen. We describe here proteomic methods to prepare, identify, and analyze protein fractions, which allow studying Staphylococcus aureus on the organism level. Besides evaluation of the whole bacterial transcriptome, this approach might contribute to the development of rapid diagnostic tests and to the identification of new drug targets to improve public health. Key words Staphylococcus aureus, MRSA, Proteomics, Protein fractionation, Separation, Identification, Quantification, Expression 1 Introduction Staphylococcus aureus is a Gram-positive bacterium member of the Micrococcaceae family. This organism is able to grow under aerobic and anaerobic conditions and causes various infections, ranging from mild skin infections and food poisoning to life-threatening diseases, such as pneumonia, sepsis, osteomyelitis, and infectious endocarditis [ 1 ]. S. aureus has showed a peculiar ability to rapidly develop multiple resistances to antimicrobial agents currently used in human medicine. Yinduo Ji (ed.), Methicillin-Resistant Staphylococcus aureus (MRSA) Protocols, Methods in Molecular Biology, vol. 1085, DOI / _14, Springer Science+Business Media, LLC

235 232 Patrice François et al. The pathogenicity of S. aureus is particularly complex involving numerous bacterial products as well as elaborated regulation pathways [ 2 ]. S. aureus expresses a wide range of toxins showing deleterious effect onto cell integrity or functions. Most of these factors (e.g., TSST-1, exfoliating toxins A and B, Panton Valentine leukocidin, enterotoxins, or hemolysins) contribute to the virulence of clinical isolates in the context of acute infections [ 1, 2 ]. Besides these excreted proteins, S. aureus produces several cell wall-associated proteins allowing interactions with host plasma or extracellular proteins, such as fibronectin, fibrinogen, collagen, vitronectin, laminin, or bone sialoprotein [ 3 ]. The impact of these bacterial products on the virulence of S. aureus and the regulation of their expression are partly known. For example, the involvement of fibrinogen- or fibronectin-binding proteins in infective endocarditis [ 4, 5 ], the role of the collagen-binding protein in septic arthritis [ 6 ], and the role of hemolysins in corneal infections [ 7, 8 ] and in intracellular persistent infection, which is a crucial aspect in the context of chronic infection [ 9 11 ], have been well documented [ 12 ]. However, many epidemiological or clinical behaviors of S. aureus are not fully understood, as these important studies relied on the utilization of genetically engineered single mutant strain of S. aureus, and showed the impact of loss of a single function, whereas lacked the comprehensive evaluation of pathogenic mechanisms. To date, around twenty S. aureus genomes are already publicly available, allowing the utilization of massively parallel techniques such as microarrays and proteomics to study this bacterium as a biological system. The post-genomic era of S. aureus began in 2001 with the release of the two first whole-genome sequences of hospital-acquired strains, published by the group of K. Hiramatsu [ 13 ]. Recently, the whole-genome sequence of MW2, a communityacquired S. aureus (CA-MRSA), has been released from the same group [ 14 ]. These sequenced S. aureus strains contain approximately 2,800,000 base pairs forming circular genomes and coding for approximately 2,600 proteins. Using appropriate bioinformatic tools, the availability of these genome sequences allows predicting the vast majority of open reading frames (ORFs) and then deducing the amino acid sequence of the whole proteome. An average 40 % of these putative ORFs showed high degree of homology with proteins having known functions in other organisms (orthologues). However, the majority of putative ORFs correspond to hypothetical proteins, never isolated or encoding function unknown proteins. Moreover, whole sequence of strains COL (a MRSA laboratory strain) [ 15 ], MRSA252, and MSSA476 [ 16 ] was published. These generated considerable amounts of information, which allows researchers to develop strategies to study in more details the genetic backgrounds of clinical isolates [ 17 ].

236 Proteomic Approach to Investigate Pathogenicity and Metabolism 233 Progresses in bacterial genomics and proteomics will benefit to the medical community by providing an opportunity to evaluate virulence on a more global view using techniques allowing the study of whole organism contents in RNA and protein levels in a single experiment. The proteomic approach provides new information on metabolism, regulation pathways, as well as regulation under stress conditions, including the presence of antimicrobial drugs. Proteomics also reveals instrumental for confirming gene annotations by identifying hypothetical or unpredicted molecules. Finally, the detection of specific proteomic signatures corresponding to peculiar resistance profiles or particular metabolic states has a major impact on the comprehension of global regulatory networks involved in the virulence or resistance of strains. Ultimately, they will allow the identification of new drug targets and/or the development of new diagnostic tools. These advances will likely contribute to improve our understanding of S. aureus pathogenicity. In this chapter, we describe proteomic procedures allowing (1) the preparation of total or membrane S. aureus protein extracts, (2) the separation of proteins using 1-D or 2-D electrophoresis, and (3) the identification of proteins using MALDI-TOF or mass spectrometry. Together, these methods were used to improve knowledge about global mechanisms involved in virulence or to characterize specific properties of the bacteria. 2 Materials 2.1 Staphylococcus aureus Culture and Lysis 2.2 Preparation of Membrane Protein Extracts 1. S. aureus isolates. 2. Mueller Hinton Broth. 3. Lysis medium: PBS containing 1 mm CaCl 2 and 1 mm MgCl 2 enriched with one tablet of protease inhibitors (Complete, Boehringer) for 50 ml of PBS. 4. Lysostaphin (Sigma). 5. DNase I ( see Note 1 ). 6. Protein concentration kit (Pierce). Generally, a total amount of mg proteins is obtained using this procedure from 100 ml suspensions. For large volume of suspension, see Note Isotonic buffer: 10 mm Tris HCl, ph 7.4, 1.5 mm MgCl 2, 10 mm KCl, 0.5 mm DTE, 1.1 M saccharose, and protease inhibitors. 2. Lysostaphin (Sigma): 100 μg/ml. 3. MilliQ water containing protease inhibitors and 100 U of DNase I ( see Note 1 ).

237 234 Patrice François et al. 2.3 Protein Separation Using 2-D Electrophoresis (See Note 3 ) 2.4 SDS- Polyacrylamide Gel Electrophoresis (SDS-PAGE) 2.5 Protein Detection 1. Nonlinear immobilized ph gradients ( length 180 mm) for the first dimension. 2. Immobilized ph gradient strips (IPG): Rehydrate overnight in the dedicated cassette with 25 ml of buffer containing 8 M urea, 2 % cholamidopropyldimethylammoniopropane sulfonate (CHAPS), 10 mm dithioerythritol (DTE), Resolyte ph , 2 % bromophenol blue. 3. Strips are removed from rehydration cassette and transferred to the strip tray. Electrodes and loading cups are covered with low- viscosity paraffin oil. This step is performed essentially as described by Laemmli [ 18 ] with some minor modifications. 1. Separating buffer (4 ): 1.5 M Tris HCl, ph 8.7, 0.4 % SDS. Store at room temperature. 2. Stacking buffer (4 ): 0.5 M Tris HCl, ph 6.8, 0.4 % SDS. Store at room temperature. 3. Thirty percent acrylamide/bisacrylamide solution ( see Note 4 ). 4. N, N, N, N' -Tetramethylethylenediamine (TEMED) ( see Notes 5 7 ) % agarose in 25 mm Tris (ph 8.3), 198 mm glycine, and 0.1 % SDS: This is required to cover the IPG strip which is then carefully dipped into the agarose until contact with the running gel. Migration is then initiated for 5 h in a cold room (8 12 C) at a constant current of 40 ma/gel. Generally a voltage of V is currently observed. The application of the 2-D PAGE technology to separate, analyze, and characterize proteins contained in biological samples would not have been possible without the development of complementary detection methods. Depending on the type of analysis (either analytic or quantitative), the most currently used protein coloration is the silver staining which reveals 100-fold more sensitive than Coomassie Brilliant Blue. Silver staining protocol is performed under constant rotary agitation. For silver staining, large volumes of bi-distilled water and several solvents are required: 1. Ethanol:acetic acid:water (40:10:50). 2. Ethanol:acetic acid:water (5:5:90) % glutaraldehyde M sodium acetate % 2,7- naphtalenedisulfonic acid solution ( see Note 8 ). 6. Ammoniacal silver nitrate solution: To prepare 750 ml of this solution, 6 g of silver nitrate is dissolved in 30 ml of deionized water, which is slowly mixed into a solution containing 160 ml

238 Proteomic Approach to Investigate Pathogenicity and Metabolism 235 of water, 10 ml of 25 % ammonia, and 1.5 ml of 10 N sodium hydroxide. A transient brown precipitate might form, after spontaneous removal; water is added to give the final volume. 7. Development solution: 0.01 % citric acid and 0.1 % formaldehyde for image development for 5 10 min ( see Note 9 ) % Tris and 2 % acetic acid solution are required to stop the staining development. 2.6 Protein In-Gel Digestion and Mass Spectrometry For moderately complex protein extracts, SDS gel allows a first separation of proteins according to their molecular weight; further analysis of protein composition by tandem mass spectrometry (LC- MS/MS) is performed after protein digestion. For such analysis, 1-D gel electrophoresis is typically stained using Coomassie blue staining. 1. Staining solution: 0.1 % Coomassie Blue R-250 in 50 % methanol. 2. Destaining solution: 10 % acetic acid, 40 % methanol in MilliQ water mm DTE protein reduction solution (1.54 mg in 1 ml of 50 mm bicarbonate). 4. Fresh 55 mm iodoacetamide solution (10.2 mg in 1 ml of 50 mm bicarbonate) for protein alkylation, in presence of 2 M urea and 0.05 % SDS mm ammonium bicarbonate, ph 8 to dehydrate. 6. Concentration of peptides, which requires Oasis HLB 1 cc 10 mg solid-phase extraction cartridge (Waters, Milford, MA). 7. After desalting, the sample is dried by vacuum centrifugation, and peptides are dissolved in 5 % AcN 0.1 % formic acid. 8. C18 reversed-phase microcapillary columns (0.75 μm ID). 9. A tandem mass spectrometer, typically a quadrupole time-offlight (Q-TOF), ion trapping device (3D-IT or LTQ), or ion trap Fourier transform hybrid instrument (LTQ-FTICR or LTQ-Orbitrap). 3 Methods 3.1 Preparation of Total Protein from MRSA 1. Performed S. aureus culture with agitation at 37 C in Mueller Hinton Broth (50 ml in 500-mL flask). At post-exponential phase (OD 540 nm = 5 6 absorbance units (AU) corresponding to cells/ml), chill on ice and harvest by centrifugation at 8,000 g for 5 min at 4 C. 2. Resuspend the pellet in 5 ml lysis buffer and add 100 μg/ml lysostaphin for 10 min at 37 C with constant shaking.

239 236 Patrice François et al. Fig. 1 Schematic representation of different categories of membrane proteins. Associated membrane proteins can either be bound to the membrane via interactions to another membrane protein ( 1 ), embedded into the membrane ( 2 ), or attached to it through a posttranslationally added group such as a GPI ( 4 ) or a lipid anchor ( 5 ). Integral membrane proteins have one ( 6 ) or multiple ( 7 ) transmembrane domains (kindly from J. Deshusses) 3. After initiation of lysis add 10 μg/ml DNase I. 4. Recover total protein extract after centrifugation at 8,000 g for 15 min. 5. Assay protein concentration. 3.2 Analysis of MRSA Proteome: The Challenge of Membrane Protein Characterization in the Study of S. aureus Membrane proteins play an important role in signal transduction, transport, endocytosis, cell adhesions, drug resistance, and many other cellular functions. The majority of all drug targets are membrane- associated proteins [ 19 ]. These proteins belong to two main classes: (1) proteins that span the lipid bilayer, with a cytoplasmic and an extracellular domain, and (2) proteins only partially embedded in the membrane or attached to the membrane by a linker. The first category is called integral membrane proteins or intrinsic membrane proteins. The transmembrane (TM) domain (or segment) spans the lipid bilayer. Integral membrane proteins show one or numerous TM domains composed of hydrophobic amino acids yielding highly hydrophobic moiety in the protein sequence as schematized in Fig. 1. To create a catalogue of proteins from S. aureus containing membrane proteins, we used the following strategy: 1. Performed S. aureus culture with agitation at 37 C in Mueller Hinton Broth (200 ml in 1,000 ml flask). At post-exponential phase (OD 540 nm = 5 6 AU corresponding to cells/ml), chill on ice and harvest by centrifugation at 8,000 g for 5 min at 4 C.

240 Proteomic Approach to Investigate Pathogenicity and Metabolism For preparation of membrane extracts, prepare 20 ml culture aliquots and washed in 1.1 M saccharose-containing buffer, then suspended in 2 ml aliquots of the same buffer containing 100 μg/ml lysostaphin for 10 min at 37 C. 3. Recovered protoplasts by centrifugation for 30 min at 8,000 g, and performed hypoosmotic shock in the presence of 10 μg/ml DNase I. 4. Membrane pellets are then obtained after ultracentrifugation at 50,000 g for 50 min in a Beckman Optima TLX. 5. Solubilize one of the fractions in 2 ml 0.1 % SDS solution for protein concentration determination. 6. For 300 1,000 μg membrane-enriched protein fractions, solubilize in 150 μl of 50 mm ammonium bicarbonate. 7. Add 1 ml of TFE/CHCl 3 (1:1 volume/volume) mixture and shake vigorously and maintain at 0 C for 1 h with periodical vortexing ( see Note 10 ). 8. Centrifuge at 10,000 g for 4 min allows the separation of the mixture into three phases [ 20 ]. The lower chloroformic and the upper aqueous phases are separated from the insoluble interphase. 9. Collect carefully each phase and concentrate in a vacuum evaporator Perform 1-D electrophoresis according to Laemmli [ 18 ] using 55 mm long gels to check the quality of the fractionation process. 11. Perform preparative 2-D electrophoresis and follow the analytic workflow. 3.3 In-Gel Digestion of MRSA Proteins and Identification Total protein and enriched membrane fractions subjected to electrophoresis separation, either 1-D or 2-D, are digested in-gel by trypsin. Perform 1-D gel analysis of moderate complexity protein mixtures and hydrophobic proteins (e.g., membrane proteins) or 2-D gels for more complex samples. For 2-D analysis: 1. Isoelectric focusing is performed at linearly increasing voltage (300 3,500 V) during the first 3 h, followed by 3 additional hours at 3,500 V, and finally to 5,000 V using a dedicated power supply (Pharmacia). 2. After the first dimension, the strips are equilibrated with the second dimension buffer ( see Note 11 ). 3. Stain the gel (or overnight) in Coomassie Blue R-250 solution. 4. Perform destaining. 5. Put dried gel pieces ( see Note 12 ) following spot excision ( see Note 13 ) on ice and prepare trypsin solution. Then perform trypsin digestion.

241 238 Patrice François et al. 6. Concentrate peptides and desalted using an Oasis HLB 1 cc 10 mg solid-phase extraction cartridge (Waters, Milford, MA). 7. Peptide extracts are analyzed by LC-MS/MS. LC-MS/MS is typically performed on C18 reversed-phase microcapillary columns (0.75 μm ID) at 300 μl/min flow rate, using a gradient from 5 to 40 % AcN in 0.1 % formic acid over 60 min, with a cleaning at 80 % AcN 0.1 % formic acid. The sample is directly electrosprayed into a tandem mass spectrometer, typically a quadrupole time-of-flight (Q-TOF), ion trapping device (3D- IT or LTQ), or ion trap Fourier transform hybrid instrument (LTQ-FTICR or LTQ-Orbitrap). 8. Database search and validation are performed with MASCOT software, using the same search parameters and validation criteria as already described [ 21 ]. 3.4 Peptide Analysis Using Mass Spectrometry Techniques Mass spectrometry is currently used for protein analysis and is useful in the identification of proteins separated by 1-D or 2-D gel electrophoresis or for direct analysis of digested proteins from complex mixtures. The most common tandem mass spectrometry protein identification techniques (peptide fragment fingerprinting) rely on the determination of peptide fragment masses by spectrometric techniques after protein digestion with residue-specific proteases. Peptide masses are then analyzed against theoretical peptide libraries generated from protein sequence databases, generated from nucleotide sequence information. Developments of soft ionization methods such as matrixassisted laser desorption/ionization (MALDI) and electrospray ionization (ESI) permitted the analysis of large biopolymers. Mass spectrometers measure the mass to charge ratio ( m/z ) of gas phase ions. The instrumentation consists of three basic components: (1) the ion source, (2) the mass analyzer (s) and collision cells, and (3) the detector. The sample is ionized in the ion source; the ions are separated and isolated according to their m/z ratio, fragmented in a collision cell, and fragments are again separated according to their m/z in the mass analyzer before striking the detector [ 22 ]. Alternatively, ion ion reaction techniques such as electron-capture dissociation (ECD) or electron-transfer dissociation (ETD) are also used to activate peptides and full-length proteins into fragments [ 23, 24 ]. These latter techniques are of particular interest because amino acid side chains are left intact during activation, thus allowing identifications of labile posttranslational modifications. Protein identification is performed by comparison between experimental ion masses and theoretical ion masses deduced from protein sequence databases. An excellent first-reading introduction is given in ref. [ 25 ]. Electrospray ionization (ESI) is performed in liquid solution [ 26, 27 ]. By increasing the potential applied to the liquid, a critical

242 Proteomic Approach to Investigate Pathogenicity and Metabolism 239 value is reached; the liquid is no longer able to hold charges and blows apart into a thin cloud of small charged droplets. The resulting ions have therefore relatively low m/z ratios. Typically, ESI spectra are recorded from 400 to 1,600 Thomson (Th), and most macromolecules appear as multi-charged species. Since ESI is performed in liquid, these ion sources are particularly adapted for direct (or on-line) coupling with HPLC systems. Quadrupoles, linear ion traps, 3-D ion traps, and time-of-flights are widely used for protein and peptide analysis. More recently, commercially available instruments with Fourier transform ion cyclotron resonance and Fourier transform Orbitrap mass analyzers have been introduced [ 28 ]. These instruments made high resolution and high mass accuracy routinely available for non-mass spectrometry laboratories. In parallel to high-throughput LC-MS/MS analysis, stable isotope labeling techniques were developed for quantitative peptide and protein analysis [ 29 ]. Among the various techniques, the so-called isobaric tags such as itraq and TMT are of particular interest [ 30 ]. These chemical tags react with amino group from peptides ( n -term and lysine) and are synthesized with a combination of light and heavy isotopes in a manner that the total mass is always identical. However, activation by tandem mass spectrometry gives rise to unique fragment ion masses, the so-called reporter ions. Ion abundance of these reporters is therefore proportional to the contribution of a particular label. The workflow consists in labeling a control sample with one tag and a sample to compare (e.g., treated with an antibiotic or a mutant strain) with another tag. Relative difference in reporter ion abundance corresponds therefore to differences in protein expression between the different samples to be compared. Today, up to eight different isotopic labels exist, allowing direct comparison of up to eight conditions. 3.5 Specific Issue with Hydrophobic Proteins The analysis of hydrophobic proteins, such as integral membrane proteins, is a major limiting factor in 2-DE. Continuous efforts were made to improve buffers for hydrophobic proteins compatible with isoelectric focusing. Despite efforts, abundance of membrane proteins is clearly underrepresented after 2-DE separation of proteins [ ]. Due to these limitations, alternative protein and peptide separation techniques, such as SDS-PAGE (1-DE), multidimensional liquid chromatography [ 34 ], isoelectric focusing of digested protein mixtures [ 35 ], and other electrophoretic-based methods were developed, providing powerful alternatives to 2-D electrophoresis-based (2-DE) analytical techniques. Differences in solubility are observed between peripheral membrane proteins and integral membrane proteins. A majority of peripheral membrane protein requires only mild treatments, such as increased ionic strength, to dissociate them from the membrane. In such conditions, these proteins dissociate free from lipids and are relatively soluble in neutral aqueous buffers [ 36, 37 ].

243 240 Patrice François et al. Fig. 2 Silver-stained 2-DE gels of membrane protein fractions from N315 using standard procedure ( left gel ) or in the presence of 50 % TFE during IEF ( right gel ) Many different detergents from different classes (ionic, nonionic, and zwitterionic) have been extensively studied for the solubilization of membrane proteins (for review, see ref. 38 ). Because of their hydrophobicity, it is possible to solubilize integral membrane proteins with hydrophobic, nonpolar solvents such as chloroform. This approach has been used successfully to extract proteins containing multiple transmembrane (TM) segments from crude membrane preparations [ ]. Other organic solvents or cosolvents can be used for the extraction of hydrophobic proteins. A buffered 60 % methanol solution was used with success for the solubilization of diverse membrane protein preparations [ 42 ]. The use of 50 % 2,2,2-trifluoroethanol (TFE) as cosolvent in aqueous solutions was applied with success in our laboratory to improve the solubility of membrane protein extracts [ 20 ] from membrane fraction of S. aureus ( see Note 10 and Fig. 2 ). However, despite constant improvements for the solubilization of hydrophobic proteins, membrane proteins are generally not recovered from 2-DE gels. This is illustrated in the following experiment: Water/Trifluoroethanol/Chloroform extractions were applied to crude S. aureus membrane preparation in our laboratory. Hydrophobic proteins recovered from the interphase (between the aqueous and the organic phase) are never retrieved on 2-DE gels (Fig. 3 ; unpublished data, A. Scherl and J. Deshusses). However, if the same protein fractions are separated by SDS-PAGE gel electrophoresis [ 18 ], the hydrophobic proteins are recovered (Fig. 4 ). According to the thickness of bacterial cytoplasmic membrane, the TM domains of proteins should be constituted of 10 25

244 Proteomic Approach to Investigate Pathogenicity and Metabolism 241 Fig. 3 Silver-stained 2-D gels of protein fractions after chloroform/water/trifl uoroethanol extractions of a crude S. aureus N315 membrane extract. Soluble proteins ( a ), total membrane extracts showing limited number of unfocused proteins ( b ), and absence of proteins from the hydrophobic fraction at the interface between the chloroformic and the aqueous phase ( c ) (a detailed procedure is described in ref. 20 ) Fig. 4 Silver-stained SDS-PAGE gel of protein fractions after chloroform/water/trifl uoroethanol extractions of a crude S. aureus membrane extract. No proteins were detected from the chloroformic phase. Mw molecular weight standards, Tot. Memb crude membrane extracts, Soluble protein from the aqueous phase, pellet proteins from the interphase, and CHCl 3 content of the chloroformic phase hydrophobic amino acids, forming generally alpha helixes. In addition, transmembrane pores formed by beta sheet structures are also observed, such as in the pore-forming toxins of Staphylococcus aureus [ ]. By analyzing amino acids sequences of proteins, bioinformatic tools permit the prediction of hydrophobic segments corresponding to TM sequence ( see ).

245 242 Patrice François et al n=154 number of proteins n=76 n=47 n=67 n=44 n=64 n=25 n=23 n=30 n=44 n=22 n=39 n=11 n = 18 n = 2 n = nb. of TM domains Fig. 5 Number of the predicted ORFs from S. aureus strain N315 displaying one or more transmembrane (TM) segment. In total, 668 (26 %) of the ORFs are integral membrane proteins >15 Within the deduced proteome of S. aureus, the proportion of predicted integral membrane proteins is estimated to % of all proteins, a value in accordance with what is generally found in all living organisms [ 46 ]. This evaluation was performed on S. aureus stain N315 ( 47 ). Based on the sequence-deduced ORFs, a total of 668 proteins are predicted to contain one or more TM domains after cleavage of the signal peptide, representing 26 % of all ORFs. The number of proteins as function of the number of predicted TM domains is shown in Fig Application of Proteomic Methods to the Study of MRSA Virulence and Metabolism S. aureus is one of the leading causes of infections in immunocompromised patients and is the major cause of nosocomial infections in developed countries. Simultaneously, its fantastic adaptability to environmental changes and its particular ability to rapidly develop resistances against antimicrobials justify important measures to control its spreading. The recent emergence of multiresistant strains even against last barrier drugs is also a major concern. The potential spreading of such dangerous clones urgently demand new antimicrobial molecules. Massively parallel techniques such as whole organism proteomic and/or genomic might be instrumental in the development of such compounds. Despite the fact that approximately one-half of the bacterial genome still consists in genes with unknown function, their utilization as possible drug target is not restricted as part of these genes are required for bacterium viability. However and despite the huge promise of the genomics era, new classes of antibiotics targeting novel enzymes resulting exclusively on genomic studies are still not commercialized. Of course, the processes before commercialization are time- consuming, and the steps required upstream such as identification of new target, screening of inhibitors, synthesis, evaluation of the spectrum of activity,

246 Proteomic Approach to Investigate Pathogenicity and Metabolism 243 membrane permeability, determination of optimal concentration, and pharmacokinetics are costly and difficult to ensure ( see reviews [ ]). In such a context the contribution of proteomics will permit to restrict the number of potential targets of interest, thus restricted the risk of developing new drugs for non-translated genes or rapidly identify genes whose product is really required for bacterial survival. Consequently quantitative proteomics will be instrumental for the development of rapid diagnostic tests or in the development of antibacterial vaccines. For example, by rapid screening of infected patient sera, Vytvytska and coworkers identified a list of Staphylococcus aureus antigens of potential interest for vaccine development [ 51 ]. Similar strategy has been used for another bacteria of interest Helicobacter pylori [ 52 ]. Recently, several studies that used proteomic techniques explored various fields related to the capacity of S. aureus to adapt or resist to environmental changes, thus closely related to the pathogenicity of the bacterium. Most of these studies used trypsin digestion followed by various MS methods and described important issues related to the basis of bacterial virulence of specific clones of community-acquired MRSA [ 53 ], such as the famous USA300. More recently, the contribution of global regulators on the expression of proteins was studied during the growth of the organism using a quantitative approach coupling 1D-PAGE nanolc-ms-ms [ 54 ]. In addition to the role of agr on the abundance of delta-hemolysin, and other hemolysins, as well as the protein A allowing interaction with Fc domain of immunoglobulins, the authors were able to identify >1,250 proteins produced by S. aureus UAMS-1 strain, which corresponds approximately to 40 % of the putative proteome of the organism. Another important issue considering S. aureus as a mammalian pathogen exposed to a variety of tissues and cells is the response to oxygen content and the exposition to oxygen radicals. Different oxidizing reagents have been tested on S. aureus cultures, and various proteomic approaches were used to decipher the bacterial response due to the presence of H 2 O 2 or paraquat [ 55 ]. The authors showed that a limited number of proteins are commonly induced and involved more or less specific response of proteins involved in detoxification, DNA or protein repair systems, and secondary metabolism. In a previous study, we used a combined proteomic and transcriptomic analysis of S. aureus strain N315 to analyze a sequenced strain at the system level [ 47 ]. Total protein and membrane protein extracts were prepared and analyzed using various proteomic workflows including 2-DE, SDS-PAGE combined with LC-MS/ MS, and multidimensional liquid chromatography. The presence of a protein was then correlated with its respective transcript levels from S. aureus cells grown under the same conditions (Fig. 6 ). This study showed that the correlation between levels of expression of transcripts and protein abundance was only partial [ 47 ].

247 244 Patrice François et al. Fig. 6 Protein and RNA sample preparation with analysis steps. Bacteria were grown until post-exponential phase (OD 540 nm = 5 6 AU corresponding to cells/ml). Total bacterial RNA was labeled, hybridized, and analyzed on a custom genome-wide oligoarray. Total protein extracts were analyzed with 2-DE LC-MS/MS or multidimensional LC-MS/MS. Total membrane extracts were either analyzed by 2-DE/LC-MS/MS or subjected to a phase partitioning procedure. Soluble membrane extracts were analyzed with 2-DE/LC-MS/MS or 1-DE/LC-MS/MS. Insoluble membrane extracts were analyzed by 1-DE/LC-MS/MS. Numbers in parenthesis refer to the number of unique proteins identifi ed by each specifi c workfl ow The adaptation of S. aureus to antibiotics was also studied at the transcriptome and proteome level. Our group compared methicillin- resistant but glycopeptide-sensitive strains with glycopeptide- intermediate strains obtained from an animal model.

248 Proteomic Approach to Investigate Pathogenicity and Metabolism 245 % total proteins n=154 n=35 n=76 n=7 n=47 n=1 n=67 n=1 n=44 n=2 n=64 n=1 n=25 n=2 TM Proteins n=23 n=0 n=30 n=1 n=44 n=1 n=22 n=0 n=39 n=2 n=11 N315 Genome SDS-PAGE n=18 n=1 n=0 n=2 n=1 n=2 n= nb. TM domains Fig. 7 Proteins with TM domain (s) identifi ed from the membrane fractions isolated as shown in Fig. 6 and comparison to the N315 genome >1 5 These experiments allowed identifying protein markers for glycopeptide resistance as well as potential drug targets [ 56 ]. This study was performed using glycopeptide-intermediate S. aureus (GISA) strains recovered in the absence of antibiotic pressure. Finally, we identified different markers potentially involved in the resistance mechanisms, potentially amenable to be used as diagnostic markers. Another interesting proteomics approach related to antibiotic response has been published more recently where simple HPLC-MS method using fluorescent ligands that allows detecting functional antibiotic protein binding involved in the resistance mechanism [ 57 ]. On a more technical side, progress was also made to analyze the S. aureus membrane proteins. For this, Hecker et al. [ 58 ] used a so-called membrane-shaving technique with the endopeptidase proteinase K. Thus, the aqueous domains of membrane proteins are released, and the so obtained peptides can be analyzed using traditional shotgun proteomic techniques. This experiment permitted the recovery of a high number of significant part of all S. aureus proteins containing transmembrane domains (Fig. 7 ). Absolute protein quantification was also used for precise analysis of staphylococcal enterotoxins responsible for food poisoning. The method was preceded by immunoaffinity enrichment of the endogenous and labeled synthetic toxins. This quantification method, although more time-consuming and expensive compared

249 246 Patrice François et al. to classical ELISA, represents a more sensitive and precise method to quantify these toxins [ 59 ]. Finally, recent advances have been done in the exploration of whole proteomes or secretomes [ ] of S. aureus strains showing specific clinical features. Note that this secretome contains potential vaccinal targets, justifying efforts initiated by important actors in the field. Quantitative methods are key elements to explore potential interaction between multiple players. A very recent study employing quantitative techniques described interactions between proteins in living cells [ 63 ]. The authors built a fascinating source for identifying proteins or protein networks involved in critical processes such as antimicrobial drug targets and key metabolic or regulatory genes. To date, this type of strategy has been successfully used to identify circulating cancer markers, allowing the rapid diagnosis of the diseases by testing patient sera [ 64, 65 ]. In the field of microbial diagnosis, future development of such tests targeting markers of bacterial identification, resistance, epidemiology, or virulence predictors would be greatly appreciated. The sequencing of multiple genomes of Staphylococcus aureus corresponds to a new era in the study of this important human pathogen. Simultaneously to this advance, proteomic tools evolved also considerably, and both information either genomic or proteomic are now assessable using adapted strategies. These highly parallel methods will contribute to elucidate complex molecular mechanisms involved in virulence, resistance to environmental stresses, or antimicrobials. In addition to molecular genetics, these technological advances will bring new information about the complex lifestyle of Staphylococcus aureus. 4 Notes 1. Depending on the density of bacterial suspensions, lysis medium will become very viscous. For digestion of dense suspension and preparation of membrane protein extracts which required a reduction of the lysis volume before ultracentrifugation, the addition of U of DNase reduced drastically the viscosity of the digestion mixture. 2. Most of Staphylococcus aureus strains are digested by the high concentration of the murolytic enzyme lysostaphin, as indicated in Subheading 2.1. However, some clinical isolates appear particularly resistant when suspensions are very dense. We used to fractionate the original suspension into 10 ml aliquots for the digestion step. Fractions are then pooled for following steps. 3. If very high concentrations of cytosolic or cell wall-associated proteins are required for preparative analysis, precipitation

250 Proteomic Approach to Investigate Pathogenicity and Metabolism 247 could be performed using trichloroacetic acid. By adjusting to 10 % TCA using concentrated stock solution, soluble proteins precipitate efficiently after a few hours at 4 C (overnight incubation allows an excellent recovery). After centrifugation for 30 min at 8,000 g, pellet are washed with ethanol:acetone (1:1) to remove TCA traces. Pellets are then solubilized in the desired buffer. 4. Acrylamide/bisacrylamide monomer (before polymerization) is a recognized neurotoxin. Particular attention should be taken to avoid direct exposure. 5. TEMED in powder is stored at ambient condition in desiccators. Solutions are commercially available, but we observed that time for polymerization increased with the age of the solution. 6. SDS-acrylamide gels are not polymerized in the presence of SDS. This seems to prevent the formation of micelles which contain acrylamide monomer, thus increasing the homogeneity of pore size. The SDS used in the gel running buffer is sufficient to maintain the necessary negative charge on proteins. 7. Piperazinediacrylyl (PDA) can be used as a cross-linker of acrylamide gel. It results probably in the reduction of N-terminal protein blockage, gives better resolution, and reduces diamine silver staining background. 8. Solution of 2,7 naphtalenedisulfonic acid (0.05 % w/v) allows to obtain homogeneous dark brown staining of proteins. 9. For silver staining of acrylamide gel, we observed that the addition of sodium thiosulfate reduces drastically the background staining of the gels. 10. TFE acts as cosolvent, aggregating around the hydrophobic portions of the proteins. This excludes water and therefore makes impossible the formation of hydrogen bonds. In addition, the cosolvent provides a low dielectric environment favoring the formation of intra-protein hydrogen bonds, promoting the stability of the secondary structure. The stabilization of the secondary structure is performed at the expense of the tertiary structure. The unfolded protein in its cosolvent shell is therefore maintained in solution. 11. This step is required to reduce S S bonds and to solubilize proteins after IEF in a buffer compatible with SDS-PAGE. 12. If gel pieces are still blue after destaining and reducing steps, repeat steps 1 5 until destaining is complete. 13. Typically, 1-D electrophoresis gel well is typically sliced in pieces.

251 248 Patrice François et al. References 1. Lowy FD (1998) Staphylococcus aureus infections. N Engl J Med 339: Bronner S, Monteil H, Prevost G (2004) Regulation of virulence determinants in Staphylococcus aureus : complexity and applications. FEMS Microbiol Rev 28: Foster TJ, Hook M (1998) Surface protein adhesins of Staphylococcus aureus. Trends Microbiol 6: Que YA, Haefliger JA, Piroth L et al (2005) Fibrinogen and fibronectin binding cooperate for valve infection and invasion in Staphylococcus aureus experimental endocarditis. J Exp Med 201: Moreillon P, Entenza JM, Francioli P et al (1995) Role of Staphylococcus aureus coagulase and clumping factor in pathogenesis of experimental endocarditis. Infect Immun 63: Switalski LM, Patti JM, Butcher W et al (1993) A collagen receptor on Staphylococcus aureus strains isolated from patients with septic arthritis mediates adhesion to cartilage. Mol Microbiol 7: Supersac G, Piemont Y, Kubina M et al (1998) Assessment of the role of gamma-toxin in experimental endophthalmitis using a hlg - deficient mutant of Staphylococcus aureus. Microb Pathog 24: O Callaghan RJ, Callegan MC, Moreau JM et al (1997) Specific roles of alpha-toxin and beta-toxin during Staphylococcus aureus corneal infection. Infect Immun 65: Clement S, Vaudaux P, Francois P et al (2005) Evidence of an intracellular reservoir in the nasal mucosa of patients with recurrent Staphylococcus aureus rhinosinusitis. J Infect Dis 192: Proctor RA, van Langevelde P, Kristjansson M et al (1995) Persistent and relapsing infections associated with small-colony variants of Staphylococcus aureus. Clin Infect Dis 20: Vaudaux P, Francois P, Bisognano C et al (2002) Increased expression of clumping factor and fibronectin-binding proteins by hemb mutants of Staphylococcus aureus expressing small colony variant phenotypes. Infect Immun 70: Sinha B, Francois PP, Nusse O et al (1999) Fibronectin-binding protein acts as Staphylococcus aureus invasin via fibronectin bridging to integrin α5β1. Cell Microbiol 1: Kuroda M, Ohta T, Uchiyama I et al (2001) Whole genome sequencing of methicillinresistant Staphylococcus aureus. Lancet 357: Baba T, Takeuchi F, Kuroda M et al (2002) Genome and virulence determinants of high virulence community-acquired MRSA. Lancet 359: Gill SR, Fouts DE, Archer GL et al (2005) Insights on evolution of virulence and resistance from the complete genome analysis of an early methicillin-resistant Staphylococcus aureus strain and a biofilm-producing methicillinresistant Staphylococcus epidermidis strain. J Bacteriol 187: Holden MT, Feil EJ, Lindsay JA et al (2004) Complete genomes of two clinical Staphylococcus aureus strains: evidence for the rapid evolution of virulence and drug resistance. Proc Natl Acad Sci U S A 101: Fitzgerald JR, Sturdevant DE, Mackie SM, Gill SR, Musser JM (2001) Evolutionary genomics of Staphylococcus aureus : insights into the origin of methicillin-resistant strains and the toxic shock syndrome epidemic. Proc Natl Acad Sci U S A 98: Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: Russell RB, Eggleston DS (2000) New roles for structure in biology and drug discovery. Nat Struct Biol 7: Deshusses JM, Burgess JA, Scherl A et al (2003) Exploitation of specific properties of trifluoroethanol for extraction and separation of membrane proteins. Proteomics 3: Scherl A, Francois P, Converset V et al (2004) Nonredundant mass spectrometry: a strategy to integrate mass spectrometry acquisition and analysis. Proteomics 4: Angel TE, Aryal UK, Hengel SM et al (2012) Mass spectrometry-based proteomics: existing capabilities and future directions. Chem Soc Rev 41: Zubarev RA, Horn DM, Fridriksson EK et al (2000) Electron capture dissociation for structural characterization of multiply charged protein cations. Anal Chem 72: Syka JE, Coon JJ, Schroeder MJ et al (2004) Peptide and protein sequence analysis by electron transfer dissociation mass spectrometry. Proc Natl Acad Sci U S A 101: Steen H, Mann M (2004) The ABC s (and XYZ s) of peptide sequencing. Nat Rev Mol Cell Biol 5: Fenn JB, Mann M, Meng CK et al (1989) Electrospray ionization for mass spectrometry of large biomolecules. Science 246: Zeleny J (1914) The electrical discharge from liquid points, and a hydrostatic method of

252 Proteomic Approach to Investigate Pathogenicity and Metabolism 249 measuring the electric intensity at their surfaces. Phys Rev 3: Hu Q, Noll RJ, Li H et al (2005) The Orbitrap: a new mass spectrometer. J Mass Spectrom 40: Bantscheff M, Lemeer S, Savitski MM (2012) Quantitative mass spectrometry in proteomics: critical review update from 2007 to the present. Anal Bioanal Chem 404: Ross PL, Marchese J, Huang YN et al (2004) Multiplexed protein quantitation in Saccharomyces cerevisiae using amine-reactive isobaric tagging reagents. Mol Cell Proteomics 3(12): Wilkins MR, Gasteiger E, Sanchez JC et al (1998) Two-dimensional gel electrophoresis for proteome projects: the effects of protein hydrophobicity and copy number. Electrophoresis 19: Rabilloud T, Adessi C, Giraudel A et al (1997) Improvement of the solubilization of proteins in two-dimensional electrophoresis with immobilized ph gradients. Electrophoresis 18: Adessi C, Miege C, Albrieux C et al (1997) Two-dimensional electrophoresis of membrane proteins: a current challenge for immobilized ph gradients. Electrophoresis 18: Washburn MP, Wolters D, Yates JRIII (2001) Large-scale analysis of the yeast proteome by multidimensional protein identification technology. Nat Biotechnol 19: Cargile BJ, Talley DL, Stephenson JL Jr (2004) Immobilized ph gradients as a first dimension in shotgun proteomics and analysis of the accuracy of pi predictability of peptides. Electrophoresis 25: Singer SJ, Nicolson GL (1972) The fluid mosaic model of the structure of cell membranes. Science 175: Richardson SH, Hultin HO, Green DE (1963) Structural proteins of membrane systems. Proc Natl Acad Sci U S A 50: Helenius A, Simons K (1975) Solubilization of membranes by detergents. Biochim Biophys Acta 415: Brugiere S, Kowalski S, Ferro M et al (2004) The hydrophobic proteome of mitochondrial membranes from Arabidopsis cell suspensions. Phytochemistry 65: Ferro M, Salvi D, Riviere-Rolland H et al (2002) Integral membrane proteins of the chloroplast envelope: identification and subcellular localization of new transporters. Proc Natl Acad Sci U S A 99: Ferro M, Seigneurin-Berny D, Rolland N et al (2000) Organic solvent extraction as a versatile procedure to identify hydrophobic chloroplast membrane proteins. Electrophoresis 21: Blonder J, Conrads TP, Yu LR et al (2004) A detergent- and cyanogen bromide-free method for integral membrane proteomics: application to Halobacterium purple membranes and the human epidermal membrane proteome. Proteomics 4: Guillet V, Roblin P, Werner S et al (2004) Crystal structure of leucotoxin S component: new insight into the Staphylococcal beta- barrel pore-forming toxins. J Biol Chem 279: Guillet V, Keller D, Prevost G et al (2004) Crystallization and preliminary crystallographic data of a leucotoxin S component from Staphylococcus aureus. Acta Crystallogr D Biol Crystallogr 60: Menestrina G, Dalla SM, Comai M et al (2003) Ion channels and bacterial infection: the case of beta-barrel pore-forming protein toxins of Staphylococcus aureus. FEBS Lett 552: Wallin E, Von Heijne G (1998) Genome-wide analysis of integral membrane proteins from eubacterial, archaean, and eukaryotic organisms. Protein Sci 7: Scherl A, Francois P, Bento M et al (2005) Correlation of proteomic and transcriptomic profiles of Staphylococcus aureus during the post-exponential phase of growth. J Microbiol Methods 60: Stoughton RB, Friend SH (2005) How molecular profiling could revolutionize drug discovery. Nat Rev Drug Discov 4: Berger AB, Vitorino PM, Bogyo M (2004) Activity-based protein profiling: applications to biomarker discovery, in vivo imaging and drug discovery. Am J Pharmacogenomics 4: Lau AT, He QY, Chiu JF (2003) Proteomic technology and its biomedical applications. Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai) 35: Vytvytska O, Nagy E, Bluggel M et al (2002) Identification of vaccine candidate antigens of Staphylococcus aureus by serological proteome analysis. Proteomics 2: Haas G, Karaali G, Ebermayer K et al (2002) Immunoproteomics of Helicobacter pylori infection and relation to gastric disease. Proteomics 2: Ventura CL, Malachowa N, Hammer CH et al (2010) Identification of a novel Staphylococcus aureus two-component leukotoxin using cell surface proteomics. PLoS One 5:e Jones RC, Deck J, Edmondson RD et al (2008) Relative quantitative comparisons of the extracellular protein profiles of Staphylococcus aureus UAMS-1 and its sara, agr, and sara agr

253 250 Patrice François et al. regulatory mutants using one-dimensional polyacrylamide gel electrophoresis and nanocapillary liquid chromatography coupled with tandem mass spectrometry. J Bacteriol 190: Wolf C, Hochgrafe F, Kusch H et al (2008) Proteomic analysis of antioxidant strategies of Staphylococcus aureus : diverse responses to different oxidants. Proteomics 8: Scherl A, Francois P, Charbonnier Y et al (2006) Exploring glycopeptide resistance in Staphylococcus aureus : a combined proteomics and transcriptomics approach for the identification of resistance related markers. BMC Genomics 7: Staub I, Sieber SA (2009) Beta-lactam probes as selective chemical-proteomic tools for the identification and functional characterization of resistance associated enzymes in MRSA. J Am Chem Soc 131: Hecker M, Antelmann H, Buttner K et al (2008) Gel-based proteomics of Gram-positive bacteria: a powerful tool to address physiological questions. Proteomics 8: Dupuis A, Hennekinne JA, Garin J et al (2008) Protein standard absolute quantification (PSAQ) for improved investigation of staphylococcal food poisoning outbreaks. Proteomics 8: Enany S, Yoshida Y, Magdeldin S et al (2012) Extensive proteomic profiling of the secretome of European community acquired methicillin resistant Staphylococcus aureus clone. Peptides 37: Monteiro R, Vitorino R, Domingues P et al (2012) Proteome of a methicillin-resistant Staphylococcus aureus clinical strain of sequence type ST398. J Proteomics 75: Le Marechal C, Jardin J, Jan G et al (2011) Staphylococcus aureus seroproteomes discriminate ruminant isolates causing mild or severe mastitis. Vet Res 42: Cherkasov A, Hsing M, Zoraghi R et al (2011) Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus. J Proteome Res 10: Shoshan SH, Admon A (2005) Proteomics in cancer vaccine development. Expert Rev Proteomics 2: Le Naour F (2001) Contribution of proteomics to tumor immunology. Proteomics 1:

254 Chapter 15 Metabolomic Investigation of Methicillin-Resistant Staphylococcus aureus Ting Lei, Lei Wang, Chi Chen, and Yinduo Ji Abstract Metabolomics is becoming increasingly important as it provides a comprehensive analytical platform to better understand the biological functioning of a cell or organism. In recent years, microbial metabolomics has received much attention in research areas from new drug discovery to metabolic engineering. An efficient and accurate method to measure the intracellular metabolites of a specific microbial species is a key prerequisite for metabolome analysis. In this study, we describe a workflow focusing on the extraction and quantification of intracellular metabolites of Staphylococcus aureus. A filter-based bacteria sampling system was utilized to separate the media and bacteria; fast quenching with nitrogen was applied to prevent any metabolite leakage; a glass beads beater was used for intracellular metabolite extraction; and the LC-QTOF was combined to quantify the intracellular amino acids of S. aureus. This protocol is demonstrated to be an efficient method for analyzing the intracellular metabolites of S. aureus. Key words Staphylococcus aureus, MRSA, Metabolome, Amino acids, LC-QTOF 1 Introduction Staphylococcus aureus is an opportunistic pathogen that causes a wide range of infections from minor skin infections to lifethreatening diseases. The emergence of S. aureus isolates resistant to multiple antibiotics from penicillin/methicillin to quinolones and vancomycin [ 1 ] has led to serious public health concerns. This highlights the urgent need for development of alternative antimicrobial agents against these superbugs. S. aureus expresses various molecules; some of them not only play important roles in basic bacterial cell physiology by regulating cellular metabolism and structure formation but also contribute to pathogenesis [ 2 ]. The connection between synthesis of virulence determinants and nutrient availability has been observed and studied previously. Currently, it has been revealed that many metabolic and nutrient-responsive regulators regulate virulence factors or are even directly involved in Yinduo Ji (ed.), Methicillin-Resistant Staphylococcus aureus (MRSA) Protocols, Methods in Molecular Biology, vol. 1085, DOI / _15, Springer Science+Business Media, LLC

255 252 Ting Lei et al. the bacterial pathogenicity [ 3 ]. Therefore, a detailed knowledge of S. aureus metabolism is required for understanding the pathogenesis of S. aureus and providing successful strategies in combating emerging MRSA strains and their associated diseases. Metabolomics is the holistic study of changes and regulation in the complete set of metabolites (small organic compounds, MW <1,000) [ 4 ]. Detailed and quantitative knowledge of metabolite concentrations and responses to perturbation are pivotal for understanding the metabolism. By comparing the differences between metabolomes, metabolites associated with a specific phenotype can be identified. In addition, together with transcriptomics and proteomics, metabolomics can provide new insights into gene function on a global view such as gene regulation, complex networks, protein synthesis, metabolic pathways, and cellular behavior. Numerous protocols have been created for microbial metabolite extraction. There is one rule that must be kept in mind: during the sampling procedure, changes in the metabolite levels should be avoided or if the metabolite change does occur, the changed metabolites should be quantifiable. Due to this, a rapid sample collection and an effective instant quenching of microbial metabolic activity are usually applied. For the quantification of extracted intracellular metabolites, the established methods include chromatographic techniques coupled to mass spectrometry (LC- MS, GC-MS, CE-MS) and nuclear magnetic resonance spectroscopy (NMR). Several protocols have been developed for analysis of S. aureus metabolomics pathways [ 5 7 ]. We have analyzed, compared these methods, and established our own protocol for S. aureus intracellular metabolite analysis. In this chapter, we describe a protocol for analyzing amino acids in the extracted intracellular metabolites from a clinical MRSA isolate, WCUH29 [ 8 ]. The simultaneous analysis of amino acids is difficult due to their structure diversity, high polarity, and the absence of specific chromophores [ 9 ]. Hence, pre- column derivatization combined with reversed-phase LC separation has been widely accepted in recent years. The reagent dansyl chloride, which can react with the N-terminal of amino acids, is considered to be a good derivatization reagent [ 10 ]. Here we demonstrate that nearly all the amino acids extracted from S. aureus were detected and quantified at the same time by LC-QTOF system. 2 Materials Prepare all solutions using ultrapure water and analytical grade reagents. All reagents are prepared and stored at room temperature (unless indicated otherwise). Follow waste disposal regulations when disposing waste materials.

256 Metabolomic Investigation of Methicillin-Resistant Staphylococcus aureus 253 Fig. 1 Filter-based system for Staphylococcus aureus cell sampling consisting of a glass fi lter holder assembly with funnel ( 1 ), clamp ( 2 ), fritted base ( 3 ), stopper ( 4 ), and a vacuum fi ltering fl ask ( 5 ). The EZ-Pak Membrane Filter ( 6 ) is placed between the fritted base and funnel 2.1 Bacteria Collection and Intracellular Metabolite Extraction 1. S. aureus strain. 2. Washing buffer: isotonic 0.6 % sodium chloride (w/v) ( see Note 1 ). Store the washing buffer at 4 C before sampling and on ice during sampling. 3. p -Chloro- L -phenylalanine. 4. Extraction solution: 60 % ethanol (w/v). Fill 5 ml extraction solution into a 50 ml Falcon tube before starting sampling. Further add the internal standard 100 μm p -chloro- L - phenylalanine to the extraction solution ( see Note 2 ). The extraction solution has to be precooled to 20 C before sampling and held on ice during sampling. 5. Liquid nitrogen mL flask ml Falcon tube ml Eppendorf tube. 9. A filter-based system for S. aureus cell sampling assembly with funnel, clamp, fritted base, stopper, and a vacuum filtering flask (Fig. 1 ). 10. Small tweezers. 11. Maxima D4A vacuum pump.