Habib Zeighami, Fakhri Haghi, Fahimeh Hajiahmadi

Transcription

1 Antimicrobial Original Research Paper Molecular characterization of integrons in clinical isolates of betalactamase-producing Escherichia coli and Klebsiella pneumoniae in Iran Habib Zeighami, Fakhri Haghi, Fahimeh Hajiahmadi Department of Microbiology, Zanjan University of Medical Sciences, Iran Integrons are considered to play a significant role in the evolution and spread of antibiotic resistance genes. A total of 349 clinical isolates of Escherichia coli and Klebsiella pneumoniae were investigated for molecular characterization of integrons and betalactamases. Antimicrobial susceptibility testing was also performed as the Clinical and Laboratory Standards Institute (CLSI) guidelines. The frequency of extended spectrum betalactamases (ESBL) or metallo-betalactamases (MBL)-producing isolates, patient demographics, and the susceptibility to various antimicrobial agents were described. Bla CTX-M was the most frequently detected betalactamase in all isolates. Moreover, MBL producing K. pneumoniae carried bla IMP and bla VIM at 100 and 41.6%, respectively but no MBL-positive E. coli was detected. Class 1 integrons were more frequent among E. coli and K. pneumoniae isolates in comparison with class 2 integrons and the frequency of inti2 in K. pneumoniae was significantly higher than E. coli isolates. Five different resistance gene arrays were identified among class 1 integrons. Dihydrofolate reductase (dfra) and aminoglycoside adenyltransferase (aad) gene cassettes were found to be predominant in the class 1 integrons. These results indicate that class 1 integrons are widespread among ESBL-producing isolates of K. pneumoniae and E. coli and appropriate surveillance and control measures are essential to prevent further dissemination of these elements among Enterobacteriaceae in our country. Keywords: Betalactamase, Escherichia coli, Integron, Klebsiella pneumoniae, Resistance Introduction The emergence of acquired betalactamases among Enterobacteriaceae has become a serious problem in the management of infectious diseases in developing countries. 1,2 Extended spectrum betalactamases (ESBLs) have rapidly spread worldwide and presently comprise over 400 variants. 3,4 The most ESBLs are generally derived from broad spectrum betalactamases by one or more base pair substitutions. 5,6 These enzymes are generally plasmid mediated and confer resistance to oxyiminocephalosporins and aztreonam. Resistance to aminoglycosides and trimethoprim sulfamethoxazole is often co-transferred on the same plasmid. The presence of ESBL genes on plasmids can be responsible for outbreaks by means of horizontal gene transfer. 7,8 In the last two decades, many large epidemic outbreaks of ESBL-producing bacteria have been reported worldwide. Extended spectrum betalactamases-producing strains are observed usually in Klebsiella pneumoniae and Escherichia coli and to a Correspondence to: Fakhri Haghi, Department of Microbiology, Zanjan University of Medical Sciences, Zanjan, Iran. haghi@zums.ac.ir lesser extent in other Enterobacteriaceae. 5,9 The CTX- M family is known to be the most dominant ESBL among Enterobacteriaceae and is recognized as a rapidly growing family of ESBLs that selectively prefer to hydrolyze cefotaxime rather than ceftazidime. 10 Acquired metallo-betalactamases (MBLs) have emerged as a threatening mechanism of broad-spectrum betalactam resistance in Pseudomonas aeruginosa and other Gram-negative nosocomial pathogens. These enzymes efficiently hydrolyze all betalactams (except aztreonam) and are not susceptible to betalactamase inhibitors. The most common and widespread acquired MBLs are the IMP and VIM types, which show a worldwide distribution. 3,11,12 Coexistence of broadspectrum betalactamases with ESBLs, ESBLs with AmpC betalactamases, multiple ESBLs, or ESBLs with MBLs has become common in multi-resistant isolates of Enterobacteriaceae. The acquisition of resistance genes by horizontal transfer is currently thought to play a major role in the development of multidrug resistant (MDR) strains because a substantial proportion of the resistance genes are located on conjugative plasmids, transposons, insertion ß 2014 Edizioni Scientifiche per l Informazione su Farmaci e Terapia DOI / Y Journal of Chemotherapy 2014 VOL. 000 NO Journal of Chemotherapy joc408.3d 17/2/14 13:41:45

2 ; sequences, and integrons. The MBLs are usually encoded by genes on plasmids and associated with mobile genetic elements, mostly class 1 integrons. 13 Integrons have been identified as a primary source of resistance genes and play an important role in dissemination of antibiotic resistance within microbial populations. They are able to capture one or more gene cassettes from the environment and incorporate them using site-specific recombination. Gene cassettes confer resistance to a range of antimicrobial agents. There are more than nine classes of integrons of which class 1 integrons are the most commonly found in nosocomial and community environments, followed by class 2. 3,14,15 The aims of the present study were to investigate the pattern of antimicrobial resistance, the frequency of ESBLs (bla SHV, bla TEM, bla CTX-M ) and MBLs (bla IMP, bla VIM ) among clinical isolates of K. pneumoniae and E. coli, and finally analysis of integrons in ESBL-producing isolates in Zanjan, Iran. Materials and Methods Patient demographics and bacterial isolation This study included 700 clinical specimens submitted for bacterial culture at the microbiology laboratories of four major university hospitals in Zanjan, Iran from March 2012 to February All patients who had infections due to E. coli or K. pneumoniae were reviewed for their demographics, including age, sex, the hospital unit where they had received medical service, and the types of clinical specimens. Specimens were cultured on MacConkey agar (Merck, Germany) and isolates were identified by standard biochemical methods. Verified isolates of E. coli and K. pneumoniae were preserved at 270uC in Trypticase soy broth (Merck, Germany) containing 20% (v/v) glycerol for further analysis. Antimicrobial susceptibility testing and phenotypic characterization Susceptibility of isolates to the following antibiotics was examined using the disk diffusion method according to the Clinical and Laboratory Standards Institute (CLSI) guidelines: 16 Amoxicillin (25 mg), Aztreonam (30 mg), Amikacin (30 mg), Cefotaxime (30 mg), Cefoxitin (30 mg), Ceftazidime (30 mg), Ciprofloxacin (30 mg), Co-amoxiclav (30 mg), Co-trimoxazole (25 mg), Gentamicin (10 mg), Imipenem (10 mg), and Tetracycline (30 mg) (MAST, Merseyside, UK). Isolates shown to be resistant to at least three different classes of antimicrobial agents were determined to be MDR. Escherichia coli ATCC and K. pneumoniae ATCC were used as control for antibiotic resistance. The production of ESBL or MBL was tested for isolates showing resistance to cefotaxime and ceftazidime or imipenem by using the combination disk method based on the inhibitory effect of clavulanic acid or EDTA according to the CLSI criteria. 16 PCR amplification of betalactamase genes Extended spectrum betalactamases or metallo-betalactamases-producing isolates were tested for bla genes including bla TEM, bla SHV, bla CTX-M, bla IMP, and bla VIM using the primers listed in Table 1. The total DNA was extracted from whole organisms by DNA extraction kit (Bioneer/South Korea). The PCR < mixtures with a final volume of 25 ml consisted of 2 ml template DNA; 0.2 mm of each deoxynucleoside triphosphate; 10 pmol of each primer; 10 mm Tris HCl; 1.5 mm MgCl 2 ; 50 mm KCl; and 1.5 U of Taq DNA polymerase. PCR was performed with the Gene Atlas 322 system (ASTEC, Japan). Amplification involved an initial denaturation at 94uC, 5 minutes followed by 35 cycles of denaturation (94uC, 50 seconds), annealing (50uC, 1 minute for bla TEM, bla CTX- M, bla VIM, and bla IMP,57uC, 50 seconds for bla SHV ), and extension (72uC, 1 minute), with a final extension step (72uC, 8 minutes). The amplified DNA was separated by submarine gel electrophoresis on 1% agarose, stained with ethidium bromide, and visualized under UV transillumination. The following reference strains were used as positive and negative controls: E. coli ATCC (bla TEM ), K. pneumoniae ATCC (bla SHV ), K. pneumoniae 7881 (bla CTX- M), Acinetobacter baumannii AC54/97 (bla IMP ), and E. coli ATCC (non-betalactamase producer). Table 1 Primers used in this study Target Primer sequence (5 3 ) Amplicon size (bp) Ref. bla TEM TCCGCTCATGAG ACA ATA ACC TTCGTCTGACAGTTACCAATGC bla SHV TGGTTATGCGTTATATTCGCC GGTTAGCGTTGCCAGTGCT bla CTX-M GGTTAAAAAATCACTGCGTC TTGGTGACGATTTTAGCCGC bla IMP GGAATAGAGTGGCTTAATTCTC CCAAACCACTACGTTATCT bla VIM GATGGTGTTTGGTCGCATA CGAATGCGCAGCACCAG inti1 CAGTGGACATAAGCCTGTTC CCCGAGGCATAGACTGTA inti2 CACGGATATGCGACAAAAAGGT GATGACAACGAGTGACGAAATG CS GGCATCCAAGCAGCAAGC Variable 18 3 CS AAGCAGACTTGACCTGAT 2 Journal of Chemotherapy 2014 VOL. 000 NO. 000 Journal of Chemotherapy joc408.3d 17/2/14 13:41:46

3 = Table 2 Demographics of and specimen types from patients with E.coli and K. pneumoniae infections Parameter Value % of patients E. coli K. pneumoniae Sex Male/female 26.5/ /57.7 Age group (years), Hospital unit Medicine Surgery Pediatrics ICU Outpatient Specimen type Other 4 9 Urine Blood Sputum Pus/exudates 7 4 Integron characterization and sequencing of resistance encoding gene cassettes Betalactamase-producing isolates were tested for characterization of class 1 and 2 integrons and resistance encoding gene cassettes associated with class 1. The primer sequences used in this study are shown in Table 1. The PCR was performed in a reaction mixture with total volume of 25 ml, containing 2 ml template DNA; 0.2 mm of each deoxynucleoside triphosphate; 10 pmol of each primers; 10 mm Tris HCl; 1.5 mm MgCl 2 ; 50 mm KCl; and 1.5 U of Taq DNA polymerase. Amplification was done as follows: initial denaturation step at 94uC for 5 minutes followed by 30 cycles consisting of denaturation (94uC for 1 minute), annealing (62uC, 1 minute for inti1 and inti2, 60uC, 1 minute for 5 CS and 3 CS), and extension (72uC for 2 minutes), followed by a final extension step at 72uC for 10 minutes. PCR products were purified using QIAquick gel extraction kit (Qiagen) and direct sequencing of internal variable regions (gene cassettes) of class1 integron was done using ABI 3730X capillary sequencer (Genfanavaran, Macrogen, Seoul, Korea). Statistical analysis The data were analyzed with SSPS version 17.0 software (SPSS, Inc., Chicago, IL, USA). The chisquare test was used to determine the statistical significance of the data. A P value of,0.05 was considered significant. Results Frequency of ESBL and MBL-producing isolates and patient demographics During the study period, a total of 349 clinical isolates including 200 isolates of E. coli and 149 K. pneumoniae isolates were identified from different specimens. Among these isolates, 124 (35.5%) were ESBL-positive including 58 (16.6%) isolates of K. pneumoniae and 66 (18.9%) E. coli isolates. The proportion of ESBL-producing K. pneumoniae was 38.9% (58/149) while the proportion of E. coli was 33% (66/200). Twelve (8%) imipenem resistant isolates of K. pneumoniae were MBL positive and no imipenem resistant and MBL-producing E. coli was detected. The co-existence of ESBL and MBL betalactamases was detected in 10 (6.7%) isolates of K. pneumoniae. Patient demographics are shown in Table 2. Female patients predominated, particularly for E. coli infections. A majority of patients were over 60 years old. Most patients had been hospitalized in medical or outpatient units. For both E. coli and K. pneumoniae strains, a majority of isolates were recovered from urine specimens. Susceptibility of ESBL-producing E. coli and ESBL-producing K. pneumoniae to antimicrobial agents Antimicrobial susceptibilities of E. coli and K. pneumoniae isolates are presented in Tables 3 and 4. The highest rate of resistance among all ESBL and non-esbl-producing isolates showed against amoxicillin (.70%) followed by co-trimoxazole (48.5%) in E. coli and aztreonam (51%) in K. pneumoniae isolates. All ESBL and non-esbl-producing E. coli isolates were susceptible to imipenem (100%) but only 67.7% of isolates of K. pneumoniae were imipenem susceptible (P,0.05). A total of 145 (72.5%) isolates of E. coli and 93 (62.4%) of K. pneumoniae isolates were MDR (P.0.05). Moreover, All ESBL-producing isolates of K. pneumoniae and 96.9% (64/66) of ESBL-positive E. coli were MDR. The most prevalent MDR pattern was resistance to betalactams, co-trimoxazole, ciprofloxacin, and tetracycline. Molecular characterization of ESBL and MBL genes All ESBL or MBL-producing isolates were subjected to PCR experiments to detect betalactamase genes, including bla TEM, bla SHV, bla CTX-M, bla IMP, and bla VIM. Bla CTX-M was the most frequently isolated betalactamase. It was detected in 93.1% (54/58) of ESBL-producing K. pneumoniae and 75.7% (50/66) of ESBL-producing E. coli (P,0.05). The frequency of bla SHV and bla TEM among ESBL-producing E. coli was 56% (37/66) and 46.9% (31/66), respectively. Six (9%) isolates of ESBL-producing E. coli did not have any bla CTX-M, bla SHV, and bla TEM genes. All isolates of ESBL-producing K. pneumoniae were harboring at least one type of betalactamase encoding genes. About 86.2% (50/58) and 63.7% (37/ 58) of isolates of K. pneumoniae producing ESBL were harbored bla SHV and bla TEM, respectively. In total, 19 (28.7%) isolates of E. coli and 33 (56.9%) isolates of K. pneumoniae producing ESBL carried the 3 betalactamase encoding genes (P50.001). Journal of Chemotherapy joc408.3d 17/2/14 13:41:46 Journal of Chemotherapy 2014 VOL. 000 NO

4 Table 3 Antimicrobial susceptibility of extended spectrum betalactamases (ESBL) and non-esbl-producing Escherichia coli isolates ESBL producers (n566) Non-ESBL producers (n5134) Total (n5200) Antimicrobial agents R I S R I S R I S Amoxicillin 61 (30.5%) 0 5 (2.5%) 82 (41%) 0 52 (26%) 143 (71.5%) 0 57 (28.5%) Aztreonam 60 (30%) 0 6 (3%) 34 (17%) 24 (12%) 76 (38%) 94 (47%) 24 (12%) 82 (41%) Co-amoxiclav 16 (8%) 0 50 (25%) 23 (11.5%) (55.5%) 39 (19.5%) (80.5%) Cefotaxime 61 (30.5%) 0 5 (2.5%) 11 (5.5%) 3 (1.5%) 120 (60%) 72 (36%) 3 (1.5%) 125 (62.5%) Ceftazidime 51 (25.5%) 7 (3.5%) 8 (4%) 15 (7.5%) 12 (6%) 107 (53.5%) 66 (33%) 19 (9.5%) 115 (57.5%) Cefoxitin 8 (4%) 0 58 (29%) 17 (8.5%) (58.5%) 25 (12.5%) (87.5%) Co-trimoxazole 41 (20.5%) 2 (1%) 23 (11.5%) 56 (28%) 3 (1.5%) 75 (37.5%) 97 (48.5%) 5 (2.5%) 98 (49%) Ciprofloxacin 33 (16.5%) 1 (0.5%) 32 (16%) 20 (10%) 4 (2%) 110 (55%) 53 (26.5%) 5 (2.5%) 142 (71%) Tetracycline 36 (18%) 3 (1.5%) 27 (13.5%) 56 (28%) 3 (1.5%) 75 (37.5%) 92 (46%) 6 (3%) 102 (51%) Amikacin 9 (4.5%) 7 (3.5%) 50 (25%) 0 9 (4.5%) 125 (62.5%) 9 (4.5%) 16 (8%) 175 (87.5%) Gentamicin 37 (18.5%) 8 (4%) 21 (10.5%) 22 (11%) 17 (8.5%) 95 (47.5%) 59 (29.5%) 25 (12.5%) 116 (58%) Imipenem (33%) (67%) (100%) Table 4 Antimicrobial susceptibility of extended spectrum betalactamases (ESBL) and non-esbl-producing Klebsiella pneumoniae isolates ESBL producers (n558) Non-ESBL producers (n591) Total (n5149) Antimicrobial agents R I S R I S R I S Amoxicillin 58 (38.9%) (57.1%) 0 6 (4%) 143 (96%) 0 6 (4%) Aztreonam 56 (37.6%) 0 2 (1.3%) 20 (13.4%) 6 (4%) 65 (43.7%) 76 (51%) 6 (4%) 67 (45%) Co-amoxiclav 54 (36.2%) 0 4 (2.7%) 22 (14.8%) 0 69 (46.3%) 76 (51%) 0 73 (49%) Cefotaxime 56 (37.6%) 2 (1.3%) 0 6 (4%) 15 (10.1%) 70 (47%) 62 (41.6%) 17 (11.4%) 70 (47%) Ceftazidime 54 (36.2%) 2 (1.3%) 2 (1.3%) 5 (3.3%) 12 (8%) 74 (49.7%) 59 (39.6%) 14 (9.4%) 76 (51%) Cefoxitin 36 (24.1%) 0 22 (14.8%) 22 (14.8%) 0 69 (46.3%) 58 (38.9%) 0 91 (61.1%) Co-trimoxazole 43 (28.9%) 0 15 (10.1%) 12 (8%) 2 (1.3%) 77 (51.7%) 55 (36.9%) 2 (1.3%) 92 (61.8%) Ciprofloxacin 39 (26.1%) 4 (2.7%) 15 (10.1%) 11 (7.4%) 4 (2.7%) 76 (51%) 50 (33.5%) 8 (5.4%) 91 (61.1%) Tetracycline 32 (21.5%) 11 (7.4%) 15 (10.1%) 12 (8%) 7 (4.7%) 72 (48.3%) 44 (29.5%) 18 (12.1%) 87 (58.4%) Amikacin 23 (15.5%) 14 (9.4%) 21 (14.1%) 17 (11.4%) 9 (6%) 65 (43.6%) 40 (26.9%) 23 (15.4%) 86 (57.7%) Gentamicin 10 (6.7%) 4 (2.7%) 44 (29.5%) 14 (9.4%) 6 (4%) 71 (47.6%) 24 (16.1%) 10 (6.7%) 115 (77.2%) Imipenem 6 (4%) 23 (15.5%) 29 (19.5%) 6 (4%) 13 (8.7%) 72 (48.3%) 12 (8%) 36 (24.2%) 101 (67.8%) 4 Journal of Chemotherapy 2014 VOL. 000 NO. 000

5 All MBL-producing isolates of K. pneumoniae were positive by PCR for the presence of a bla IMP (12/12), whilst bla VIM was detected in 41.6% (5/12) of MBLpositive isolates. No MBL-producing E. coli was detected in our study. Analysis of integrons Among the total 66 isolates of ESBL-positive E. coli,52 (78.8%) and 3 (4.5%) carried class 1(intI1) or II(intI2) integrons, respectively. The frequency of integrons in ESBL-producing K. pneumoniae was 79.3% (46/58) and 43.1% (25/58), respectively. Moreover, 3 (4.5%) isolates of E. coli and 17 (29.3%) isolates of K. pneumoniae harbored both inti1 and inti2. Class 1 integrons were more frequent among E. coli and K. pneumoniae isolates in comparison with class 2 integrons (P,0.001) and the frequency of inti2 in K. pneumoniae was significantly higher than E. coli isolates (P,0.001). All ESBLpositive isolates harboring inti1 or inti2 were MDR. We amplified variable regions of class 1 integrons and detected amplicons with the following sizes in E. coli and K. pneumoniae isolates, respectively: 550 bp (1/4 strains), 750 bp (13/17 strains), 1500 bp (7/16 strains), 1600 bp (4/9 strains), and 1900 bp (19/0 strains). No product was obtained for six (11.5%) of the inti1- positive strains of E. coli and two strains (3.8%) had two amplicons: 750 and 1500 bp and 750 and 1600 bp. The sequence analysis of integron s variable region indicated the presence of dihydrofolate reductase (dfr2d), dihydrofolate reductase type I (dfra7), aminoglycoside adenyltransferase chloramphenicol acetyltransferase (aadb catb3), dihydrofolate reductase aminoglycoside adenyltransferase (dfra17 aada5), and dihydrofolate reductase orff aminoglycoside adenyltransferase (dfra12 orff aada2) resistance gene cassettes among the isolates, which correspond to 550, 750, 1500, 1600, and 1900 bp PCR products, respectively. Discussion Antimicrobial resistance and the spread of betalactamase among human pathogens has become a major public health problem in developing countries. 17,18 Although E. coli ranks higher in the number of infection occurrences than K. pneumoniae, the latter surpasses the number of multi-resistant and ESBL phenotypes. 5 In Asia, the frequency of ESBL-positive Enterobacteriaceae has been shown to vary in different countries. National survey data have indicated the prevalence of ESBLs in 5 8% of E. coli isolates from Korea, Japan, Malaysia, and Singapore but in 12 24% in Thailand, Taiwan, the Philippines, Indonesia, Hong Kong, and China. 19 In the present study, the frequency of ESBL-positive isolates of E. coli and K. pneumoniae was 33 and 38.9%, respectively. Metallo betalactamases have been reported from many countries, particularly in multidrug resistance pathogens like Pseudomonas aeruginosa and Acinetobacter species. No MBL-producing E. coli was detected in our study and only 8% of isolates of K. pneumoniae were MBL-positive. According to Bandekar et al. 20 and Oberoi et al., 21 the frequency of MBL-positive Enterobacteriaceae was 15.7 and 10.9%, respectively. Our results showed that a majority of patients were elderly and had urinary tract infections. It was not surprising that females had a higher prevalence of infection due to ESBL producers than males, since females are more vulnerable to urinary tract infections. All isolates of E. coli and 67.8% of K. pneumoniae isolates remained susceptible to imipenem but a majority of isolates were resistant to amoxicillin, co-trimoxazole, and tetracycline, resulting in a very high percentage of MDR isolates (72.5 and 62.4% of isolates of E. coli and K. pneumoniae, respectively). Moreover, resistance to ciprofloxacin and gentamicin in ESBL-positive E. coli isolates was significantly higher than in non-esbl producers (P,0.001). Extended spectrum betalactamases-producing K. pneumoniae isolates were associated with high level resistance to co-trimoxazole, ciprofloxacin, and tetracycline (P,0.001). The high incidence of antibiotic resistance found in this survey was most probably due to the widespread use of numerous antimicrobial agents in our country. Also, the transfer of resistance genes that may occur between species could lead to the construction of diverse resistance to the usual antibiotics. 22 Although CTX- M types of ESBLs have been known for their rapid spread in Europe and Asia, 4 it was remarkable that in this study, 75.7% of ESBL-producing E. coli and 93.1% of ESBL-producing K. pneumoniae isolates carried bla CTX-M (P,0.05). Similar to studies conducted in Thailand and Poland, bla CTX-M was the most commonly detected betalactamase in both K. pneumoniae and E. coli isolates. 4,23 The frequency of bla SHV in K. pneumoniae (86.2%) isolates was significantly higher than E. coli (56%) (P,0.001) but, bla TEM was identified with slightly higher in K. pneumoniae (P.0.05). Integrons have been identified as a primary source of resistance genes and were suspected to serve as reservoirs of antimicrobial resistance genes within microbial populations. 18,24 The present study characterized class 1 integrons in 78.8 and 79.3% of ESBL-producing E. coli and K. pneumoniae isolates, respectively. Furthermore, the frequency of class 2 integrons in K. pneumoniae was significantly higher than E. coli isolates ( %) (P,0.001). Previous studies have shown the association of betalactamases with integrons and plasmids from bacteria responsible for nosocomial outbreaks. 25 We found a relatively high occurrence of class 1 integrons within ESBL-producing isolates. Several other reports have indicated the Journal of Chemotherapy 2014 VOL. 000 NO

6 > elevated occurrence of class 1 integrons among Enterobacteriaceae in comparison to class 2. 15,18,26 Similar to results of Mokracka et al., 23 the presence of integrons was also associated with MDR and resistance to co-trimoxazole, gentamicin, and ciprofloxacin was significantly higher in isolates harboring inti1. According to results, class 1 integrons with identical cassette array were detected in most isolates, suggesting that these isolates may have the same mechanisms for acquisition of resistance. Gene cassettes encoding resistance to trimethoprim (dfr) were found to be predominant in the class 1 integrons (75 and 65.2% in E. coli or K. pneumoniae isolates harboring inti1, respectively). The results suggest the stability of this gene cassette in class 1 integrons, which may reflect the selective pressure, exerted over a long period, by the use of trimethoprim in clinics. The aad cassettes that confer resistance to aminoglycosides were also detected frequently in 61.5 and 54.3% of E. coli or K. pneumoniae isolates harboring inti1, respectively. The gene cassette arrays of dfra aada detected in 7.7 and 19.5% of class 1 integrons among E. coli or K. pneumoniae may reflect cotransfer of resistance genes due to the genetic linkage of dfra and aada cassettes. Our data are also consistent with the previous reports worldwide on the predominance of dfra and aada gene cassettes among Enterobacteriaceae. 17,18 In conclusion, integrons will continue to threaten the usefulness of antibiotics as therapeutic agents and appropriate surveillance and control measures are essential to prevent the further spread of these elements among betalactamase producing organisms in developing countries. Disclaimer Statements Contributors All authors have the same contribution in the paper. Funding Conflicts of interest The authors declare that they have no conflicts of interest. Ethics approval Ethical approval was not required. Acknowledgements We are grateful to Department of Microbiology, Zanjan University of Medical Sciences for kindly providing bacterial strains. References 1 Montealegre MC, Correa A, Briceno DF, Rosas NC, Cadena E, Ruiz SJ, et al. Novel VIM metallo-b-lactamase variant, VIM-24, from a Klebsiella pneumoniae isolate from Colombia. Antimicrob Agents Chemother. 2011;55: Walter de Walthoffen S, Mlynarczyk A, Sawicka-Grzelak A, Durlik M, Paczek L, Chmura A, et al. Strains of Klebsiella pneumoniae producing extended spectrum beta-lactamases, isolated from organ recipients. Transplant Proc. 2011;43: Koratzanis E, Souli M, Galani I, Chryssouli Z, Armaganidis A, Giamarellou H. Epidemiology and molecular characterisation of metallo-b-lactamase-producing Enterobacteriaceae in a university hospital intensive care unit in Greece. Int J Antimicrob Agents. 2011;38: Kiratisin P, Apisarnthanarak A, Laesripa CH, Saifon P. Molecular characterization and epidemiology of extendedspectrum-b-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolates causing health care-associated infection in Thailand, where the CTX-M family is endemic. Antimicrob Agents Chemother. 2008;52: Dipersio JR, Deshpande LM, Biedenbach DJ, Toleman MA, Walsh TR, Jones RN. Evolution and dissemination of extended spectrum b-lactamase-producing Klebsiella pneumoniae epidemiology and molecular report from the SENTRY Antimicrobial Surveillance Program ( ). Diagn Microbiol Infect Dis. 2005;51: Shahcheraghi F, Nasiri S, Noveiri H. Detection of extendedspectrum b-lactamases (ESBLs) in Escherichia coli. IJCID. 2009;4: Ghafourian S, bin Sekawi Z, Sadeghifard N, Mohebi R, Neela VK, Maleki A, et al. The prevalence of ESBLs producing Klebsiella pneumoniae isolates in some major hospitals, Iran. Open Microbiol J. 2011;5: Paterson DL, Bonomo RA. Extended-spectrum b-lactamases: a clinical update. Clin Microbiol Rev. 2005;18: Shah AA, Hasan F, Ahmed S, Hameed A. Characteristics: epidemiology and clinical importance of emerging strains of Gram-negative bacilli producing extended-spectrum b-lactamases. Res Microbiol. 2004;155: Bonnet R. Growing group of extended-spectrum beta-lactamases: the CTX-M enzymes. Antimicrob Agents Chemother. 2004;48: Walsh TR. Clinically significant carbapenemases: an update. Curr Opin Infect Dis. 2008;21: Vatopoulos A. High rates of metallo-b-lactamase-producing Klebsiella pneumoniae in Greece a review of the current evidence. Euro Surveill. 2008;13: Gundogdu A, Beverley Long Y, Vollmerhausen TL, Katouli M. Antimicrobial resistance and distribution of sul genes and integron-associated inti genes among uropathogenic Escherichia coli in Queensland, Australia. J Med Microbiol. 2011;60: Xu Z, Li L, Shirtliff ME, Alam MJ, Yamasaki S, Shi L. Occurrence and characteristics of class 1 and 2 integrons in Pseudomonas aeruginosa isolates from patients in southern China. J Clin Microbiol. 2009;47: Khosravi Y, Tay ST, Vadivelu J. Analysis of integrons and associated gene cassettes of metallo-b-lactamase-positive Pseudomonas aeruginosa in Malaysia. J Med Microbiol. 2011;60: Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; 21st informational supplement. CLSI Document M100-S ;31:1. 17 Yan H, Li L, Zong M, Alam MJ, Shinoda S. Occurrence and characteristics of class 1 and 2 integrons in clinical bacterial isolates from patients in south China. J Health Sci. 2010;56: Su J, Shi L, Yang L, Xiao Z, Li X, Yamasaki Sh. Analysis of integrons in clinical isolates of Escherichia coli in China during the last six years. FEMS Microbiol Lett. 2006;254: Phongpaichit S, Tunyapanit W, Pruekprasert P. Antimicrobial resistance, class 1 integrons and extended spectrum betalactamases in E. coli clinical isolates from patients in south Thailand. J Health Sci. 2011;57: Bandekar N, Vinodkumar CS, Basavarajappa KG, Prabhakar PJ, Nagaraj P. Betalactamases mediated resistance amongst Gram negative bacilli in burn infection. Int J Biol Med Res. 2011;2: Oberoi L, Singh N, Sharma P, Aggarwal A. ESBL, MBL and AmpC b-lactamases producing superbugs havoc in the intensive care units of Punjab India. J Clin Diagn Res. 2013;7: Chen B, Zheng W, Yu Y, Huang W, Zheng S, Zhang Y, et al. Class 1 integrons, selected virulence genes, and antibiotic resistance in Escherichia coli isolates from the Minjiang river, Fujian province, China. Appl Environ Microbiol. 2011;77: Mokracka J, Oszynska A, Kaznowski A. Increased frequency of integrons and b-lactamase-coding genes among extraintestinal Escherichia coli isolated with a 7-year interval. Antonie van Leeuwenhoek. 2013;103: Dıaz-Mejıa JJ, Amabile-Cuevas CF, Rosas I, Souza V. An analysis of the evolutionary relationships of integron integrases, with emphasis on the prevalence of class 1 integrons in 6 Journal of Chemotherapy 2014 VOL. 000 NO. 000

7 Escherichia coli isolates from clinical and environmental origins. Microbiology. 2008;154: Machado E, Canton R, Baquero F, Galan JC, Rollan A, Peixe L, et al. Integron content of extended-spectrum-b-lactamaseproducing Escherichia coli strains over 12 years in a single hospital in Madrid, Spain. Antimicrob Agents Chemother. 2005;49: Sekiguchi JI, Asagi T, Miyoshi-Akiyama T, Kasai A, Mizuguchi Y, Araake M, et al. Outbreaks of multidrugresistant Pseudomonas aeruginosa in community hospitals in Japan. J Clin Microbiol. 2007;45: Ellington MJ, Kistler J, Livermore DM, Woodford N. Multiplex PCR for rapid detection of genes encoding acquired metallo-b-lactamases. J Antimicrob Chemother. 2007;59: Journal of Chemotherapy 2014 VOL. 000 NO