RECOMMENDED CULTURE CONDITIONS Recommended culture conditions and standard operating procedure are provided with the product.

Size: px
Start display at page:

Download "RECOMMENDED CULTURE CONDITIONS Recommended culture conditions and standard operating procedure are provided with the product."

Transcription

1 PRODUCT DATASHEET PrecisION hnav1.5-hek Recombinant Cell Line Catalog Number: CYL3004 PRODUCT DESCRIPTION Recombinant HEK293 cell line expressing the human Nav1.5 (type V voltage-gated sodium channel alpha subunit, accession number NM_000335). ASSOCIATED PRODUCTS The PrecisION hnav1.5-hek293 Recombinant Cell Line is provided to customers on the purchase of an appropriate license. The available licenses are: CYL3004SS PrecisION hnav1.5-hek Single Site License CYL3004TS PrecisION hnav1.5-hek Two Site License CYL3004MS PrecisION hnav1.5-hek Multiple Site License CONTENTS 2 x 1 ml aliquots containing 1.32 x 10 6 cells/ml in 10% DMSO at passage 10. STORAGE Vials are to be stored in liquid N 2. WARNINGS For Research Use Only; Not for Use in Diagnostic Procedures Not for Animal or Human Consumption GMO This product contains genetically modified organisms. Este producto contiene organismos genéticamente modificados. Questo prodotto contiene degli organismi geneticamente modificati. Dieses Produkt enthält genetisch modifizierte Organismen. Ce produit contient organismes génétiquement des modifiés. Dit product bevat genetisch gewijzigde organismen. Tämä tuote sisältää geneettisesti muutettuja organismeja. Denna produkt innehåller genetiskt ändrade organismer. MYCOPLASMA TESTING The cell line has been screened using the ELISA based Mycoplasma Detection kit (Roche) and by a PCR VenorGem kit (Minerva Biolabs) to confirm the absence of Mycoplasma species. FUNCTIONAL VALIDATION The PrecisION hnav1.5-hek recombinant cell line was analyzed by patch-clamp techniques giving typical peak currents between na. With IonWorks, typically greater than 80% of cells expressed peak currents of an average amplitude of na. RECOMMENDED CULTURE CONDITIONS Recommended culture conditions and standard operating procedure are provided with the product. Eurofins Pharma Bioanalytics 15 Research Park Drive T Services US Inc. St Charles MO F USA Template version: 6. Modified Date: 21JUL14. Modified by: SGJ

2 FUNCTIONAL VALIDATION Electrophysiological properties of the hnav1.5 current. Whole-cell Patch Clamp Electrophysiology. Figure 1. Representative currents produced by the PrecisION hnav1.5-hek cell line. A. Representative current traces elicited by a series of test pulses given in 10 mv increments from the holding potential of -90 mv. Typically peak currents range between na (no currents are recorded in untransfected cells). B. The current-voltage relationship shows currents begin to activate at approximately 50 mv, reach a peak at 20 mv and have a reversal potential (E rev ) of ± 4.6, n=3 (calculated E rev +37 mv). 2

3 Figure 2. Whole cell patch clamp recordings of the PrecisION hnav1.5-hek cell line. A. Shows a series of currents evoked by 20 ms depolarizing steps from a holding potential of 110 mv. B. The peak current-voltage relationship. The observed reversal potential of +60 mv is close to the theoretical Na + equilibrium potential of +58 mv under the ionic conditions. C. Shows the steady state inactivation curve for hnav1.5, constructed from 4 s conditioning pulses to the voltages shown on the abscissa, followed by test pulses to 20 mv. The V ½ for inactivation was 90.1 mv and the slope value (k) was A B mv pA -600 C ms -800 pa V h -110mV I/I Max 0.4 V mV Slope V h -120mV 4s conditioning Conditioning potential 3

4 Figure 3. Use of the PrecisION hnav1.5-hek cell line in FLIPR screening assays. In hnav1.5-hek cells incubated with DiBAC and scorpion venom (ScTx), KCl induces reproducible membrane potential depolarizations (increased fluorescence) that are dependent in size upon the concentration of ScTx used. No responses are seen in untransfected HEK293 cells. Figure 4. Use of the PrecisION hnav1.5-hek cell line in VIPR screening assays. In hnav1.5-hek expressing cells incubated with VSP fluorescent dyes (voltage sensitive probes) and scorpion venom, a rapid Na + ion-dependent membrane potential depolarizations (increase in the relative ratio of fluorescence from the 2 VSP dyes) are observed. These are significantly greater than in untransfected controls and can be blocked with the standard inhibitor tetracaine. 4

5 Figure 5. Use of the PrecisION hnav1.5-hek cell line in IonWorks HT screening assays. A. Simultaneous recording of currents from 48 wells of an IonWorks HT patch plate, each trace represents currents recorded from an individual hnav1.5-hek cell. B. Typically greater than 80% of cells express peak currents with an average amplitude of 2.4 na. C. Concentration response curves for 2 standard inhibitors tested by IonWorks HT. Stability of PrecisION hnav1.5-hek Cell Line: The PrecisION hnav1.5-hek cell line has stable expression for >25 passages. 5

6 Vector: HpaI ClaI NdeI BssHII AscI XhoI NotI NsiI SspI NdeI MluI NaeI BamHI KpnI IVS CMV promoter EcoRI BclI Sse8387 XhoI MluI AgeI Amp BsaBI EcoRI 8000 polya XhoI Neo BclI XbaI NaeI BssHII TthI NarI KpnI IRES SfiI TthI pcin5-hnav bps hnav1.5 KpnI PshAI BamHI NaeI NarI NdeI NheI SmaI XmaI BamHI Polylinker: CMV-IVS-NotI-Nav1.5-NotI-EcoRI-IRES-neo hnav1.5 Sequence: The sequence of the cdna used to make this cell line contains a coding two base pair mutation with respect to the accession number NM_ GGC to GCT - at positions conferring the amino acid change Gly180Ala. 6

7 REFERENCES 1. Clare, J.J., Tate, SN., Nobbs M. and Romanos, M.A. (2000) Voltage-gated sodium channels as therapeutic targets. Drug Disc. Today 5: Gellens, M.E., George, Jr. A.L., Chen, L., Chahine, M., Horn, R., Barchi, R.L. and Kallen, R.G. (1992) Primary Structure and Functional Expression of the Human Cardiac Tetrodotoxin-Insensitive Voltage-Dependent Sodium Channel. Proc. Natl. Acad. Sci. USA 89 (2): Schroeder, K., Neagle, B., Trezise D.J. and Worley, J. (2003) Ionworks HT: a new high-throughput electrophysiology measurement platform. J. Biomol Screen 8 (1): FOR RESEARCH USE ONLY; NOT FOR USE IN DIAGNOSTIC PROCEDURES. NOT FOR HUMAN OR ANIMAL CONSUMPTION Unless otherwise stated in our catalog or other company documentation accompanying the product(s), our products are intended for research use only and are not to be used for any other purpose, which includes but is not limited to, unauthorized commercial uses, in vitro diagnostic uses, ex vivo or in vivo therapeutic uses or any type of consumption or application to humans or animals. No part of these works may be reproduced in any form without permission in writing. Eurofins Pharma Bioanalytics Services US Inc. is an independent member of Eurofins Discovery Services 7

PRODUCT DESCRIPTION Recombinant HEK293 cell line expressing the four subunits α1, β1, δ and ε of the human nicotinic acetylcholine receptor type I.

PRODUCT DESCRIPTION Recombinant HEK293 cell line expressing the four subunits α1, β1, δ and ε of the human nicotinic acetylcholine receptor type I. PRODUCT DATASHEET PrecisION hnachr α1/β1/δ/ε-hek Recombinant Cell Line Catalog Number: CYL3052 PRODUCT DESCRIPTION Recombinant HEK293 cell line expressing the four subunits α1, β1, δ and ε of the human

More information

ChemiScreen CRF 1 Corticotropin Releasing Factor Receptor Stable Cell Line

ChemiScreen CRF 1 Corticotropin Releasing Factor Receptor Stable Cell Line PRODUCT DATASHEET ChemiScreen CRF 1 Corticotropin Releasing Factor Receptor Stable Cell Line CATALOG NUMBER: HTS023C CONTENTS: 2 vials of mycoplasma-free cells, 1 ml per vial. STORAGE: Vials are to be

More information

ChemiScreen CRF 2 Corticotropin Releasing Factor Receptor Stable Cell Line

ChemiScreen CRF 2 Corticotropin Releasing Factor Receptor Stable Cell Line PRODUCT DATASHEET ChemiScreen CRF 2 Corticotropin Releasing Factor Receptor Stable Cell Line CATALOG NUMBER: HTS024C CONTENTS: 2 vials of mycoplasma-free cells, 1 ml per vial. STORAGE: Vials are to be

More information

PRODUCT DATASHEET. Ready-to-Assay 5-HT 2A Serotonin Family Receptor Frozen Cells

PRODUCT DATASHEET. Ready-to-Assay 5-HT 2A Serotonin Family Receptor Frozen Cells PRODUCT DATASHEET Ready-to-Assay 5-HT 2A Serotonin Family Receptor Frozen Cells CATALOG NUMBER: HTS082RTA CONTENTS: Pack contains 2 vials of mycoplasma-free cells, 1 ml per vial. Fifty (50) ml of Media

More information

CHO herg-duo Cell Line

CHO herg-duo Cell Line B SYS GmbH CHO herg-duo Cell Line Specification Sheet B SYS GmbH B SYS GmbH CHO herg DUO Cells Page 2 TABLE OF CONTENTS 1. BACKGROUND...3 1.1. DRUG-INDUCED QT PROLONGATION...3 1.2. REGULATORY ISSUES...3

More information

CHO Na V 1.4 Cell Line

CHO Na V 1.4 Cell Line B SYS GmbH CHO Na V 1.4 Cell Line Specification Sheet B SYS GmbH B SYS GmbH CHO Na V 1.4 Cells Page 2 TABLE OF CONTENTS 1. B'SYS Na V 1.4 CELL LINE...2 1.1 THE VOLTAGE GATED SODIUM CHANNELS NA V 1.4...2

More information

CHO-Tet herg Cell Line

CHO-Tet herg Cell Line F B SYS GmbH CHO-Tet herg Cell Line Specification Sheet B SYS GmbH B SYS GmbH CHO-Tet herg Cells Page 2 TABLE OF CONTENTS 1 BACKGROUND...3 1.1 Drug-induced QT Prolongation...3 1.2 Regulatory Issues...3

More information

CHO K V 4.3 Cell Line

CHO K V 4.3 Cell Line B SYS GmbH CHO K V 4.3 Cell Line Specification Sheet B SYS GmbH B SYS GmbH CHO K V 4.3 Cells Page 2 TABLE OF CONTENTS 1. PRODUCT SHIPMENT...3 1.1. Product Format...3 1.2. Mycoplasma Certificate...3 1.3.

More information

CHO-hERG DUO optimized for QPatch

CHO-hERG DUO optimized for QPatch Application Report CHO-hERG DUO optimized for QPatch Functional validation and performance data for the CHO herg DUO cell line available from. This cell line is made in collaboration with B SYS GmbH (Switzerland).

More information

1.7 on Nanion's SyncroPatch 384PE. The electrophysiology team at Nanion Technologies GmbH, Munich, Germany. Cells were kindly provided by Anaxon.

1.7 on Nanion's SyncroPatch 384PE. The electrophysiology team at Nanion Technologies GmbH, Munich, Germany. Cells were kindly provided by Anaxon. Channel: h 1.7 Cells: CHO Tools: SyncroPatch 384PE Characterization of h 1.7 on Nanion's SyncroPatch 384PE The electrophysiology team at, Munich, Germany. Cells were kindly provided by Anaxon. Summary

More information

TECHNOLOGY PLATFORMS FOR THE STUDY OF ION CHANNEL BIOLOGY AVAILABLE AT REACTION BIOLOGY CORP

TECHNOLOGY PLATFORMS FOR THE STUDY OF ION CHANNEL BIOLOGY AVAILABLE AT REACTION BIOLOGY CORP TECHNOLOGY PLATFORMS FOR THE STUDY OF ION CHANNEL BIOLOGY AVAILABLE AT REACTION BIOLOGY CORP Introduction Ion channels are integral membrane proteins that mediate the regulated passage of charged particles

More information

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

TECHNICAL BULLETIN. pgem -9Zf( ) Vector. Instructions for Use of Product P2391. Revised 4/17 TB070

TECHNICAL BULLETIN. pgem -9Zf( ) Vector. Instructions for Use of Product P2391. Revised 4/17 TB070 TECHNICAL BULLETIN pgem -9Zf( ) Vector Instructions for Use of Product P2391 Revised 4/17 TB070 pgem -9Zf( ) Vector All technical literature is available at: www.promega.com/protocols/ Visit the web site

More information

Data Sheet. Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 60618

Data Sheet. Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 60618 Data Sheet Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 6618 Background The Hippo pathway regulates cell proliferation and cell death. It is activated by high cell density and cell stress to stop

More information

Data Sheet IDO2 - HEK293 Recombinant Cell Line Cat #: 60533

Data Sheet IDO2 - HEK293 Recombinant Cell Line Cat #: 60533 Data Sheet IDO2 - HEK293 Recombinant Cell Line Cat #: 60533 Description Recombinant HEK293 cell line expressing tetracycline-inducible human indoleamine 2,3- dioxygenase (IDO2), Genbank accession number

More information

15 June 2011 Supplementary material Bagriantsev et al.

15 June 2011 Supplementary material Bagriantsev et al. Supplementary Figure S1 Characterization of K 2P 2.1 (TREK-1) GOF mutants A, Distribution of the positions of mutated nucleotides, represented by a red x, from a pool of 18 unselected K 2P 2.1 (KCNK2)

More information

Data Sheet. MAPK/ERK Signaling Pathway SRE Reporter HEK293 Cell Line Catalog #: 60406

Data Sheet. MAPK/ERK Signaling Pathway SRE Reporter HEK293 Cell Line Catalog #: 60406 Data Sheet MAPK/ERK Signaling Pathway SRE Reporter HEK293 Cell Line Catalog #: 60406 Description The MAPK/ERK signaling pathway is a major participant in the regulation of cell growth and differentiation.

More information

Improved method for assembly of linear yeast expression cassettes using NEBuilder HiFi DNA Assembly Master Mix

Improved method for assembly of linear yeast expression cassettes using NEBuilder HiFi DNA Assembly Master Mix DNA CLONING DNA AMPLIFICATION & PCR Improved method for assembly of linear yeast expression cassettes using NEBuilder HiFi DNA Assembly Master Mix EPIGENETICS RNA ANALYSIS LIBRARY PREP FOR NEXT GEN SEQUENCING

More information

Membrane Potential Assays Using the ValiScreen Human Kv1.3 Voltage-Gated K + Channel Cell Line on the EnVision Multilabel Plate Reader

Membrane Potential Assays Using the ValiScreen Human Kv1.3 Voltage-Gated K + Channel Cell Line on the EnVision Multilabel Plate Reader TECHNICAL BRIEF ValiScreen Stable Recombinant Ion Channel Cell Line and the EnVision Multilabel Plate Reader Membrane Potential Assays Using the ValiScreen Human Kv1.3 Voltage-Gated K + Channel Cell Line

More information

Data Sheet. Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409

Data Sheet. Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409 Data Sheet Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409 Product Description The Gli Reporter NIH3T3 Cell Line is designed for monitoring the activity of the hedgehog signaling

More information

Ligase Independent Cloning (LIC) using petm-13/lic

Ligase Independent Cloning (LIC) using petm-13/lic Ligase Independent Cloning (LIC) using petm-13/lic Creating a construct with a C-terminal His 6 -tag Ligase independent cloning (LIC) is a simple, fast and relatively cheap method to produce expression

More information

Product Information GetClone PCR Cloning Vector II. Storage -20 C for 24 months

Product Information GetClone PCR Cloning Vector II. Storage -20 C for 24 months www.smobio.com Product Information GetClone PCR Cloning Vector II CV1100 20 RXN pget II Vector (25 ng/μl) pget-for Primer (10 μm) pget-rev Primer (10 μm) Storage -20 C for 24 months 23 μl 100 μl 100 μl

More information

CHO-Nav1.5. On QPatch. Application Report:

CHO-Nav1.5. On QPatch. Application Report: Application Report: CHO-Nav1.5 On QPatch The sodium ion channel Nav1.5 is expressed as in integral membrane protein and contains a tetrodotoxinresistant voltage-gated sodium channel subunit.the encoded

More information

HTS of Ca 2+ Transients in Human ips-derived Cardiomyocytes as a Predictive and Cost Effective Assay Early on in Drug Development

HTS of Ca 2+ Transients in Human ips-derived Cardiomyocytes as a Predictive and Cost Effective Assay Early on in Drug Development Use our discoveries to advance yours HTS of Ca 2+ Transients in Human ips-derived Cardiomyocytes as a Predictive and Cost Effective Assay Early on in Drug Development Dr. Ralf Kettenhofen! Axiogenesis

More information

Notch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652

Notch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652 Notch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652 Background The Notch signaling pathway controls cell fate decisions in vertebrate and invertebrate tissues. Notch signaling

More information

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000

More information

HTS automated patch clamp takes cardiac safety testing to the next level

HTS automated patch clamp takes cardiac safety testing to the next level Nanion Technologies HTS automated patch clamp takes cardiac safety testing to the next level Dr. Elena Dragicevic Senior Scientist / Sales Manager at Nanion Technologies Agenda Meet Nanion Technologies

More information

Data Sheet. Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409

Data Sheet. Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409 Data Sheet Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409 Product Description The Gli Reporter NIH3T3 Cell Line is designed for monitoring the activity of the hedgehog signaling

More information

pvitro2-neo-mcs An innovative multigenic plasmid for high levels of expression Catalog # pvitro2-nmcs For research use only Version # 05E18-MT

pvitro2-neo-mcs An innovative multigenic plasmid for high levels of expression Catalog # pvitro2-nmcs For research use only Version # 05E18-MT pvitro2-neo-mcs An innovative multigenic plasmid for high levels of expression Catalog # pvitro2-nmcs For research use only Version # 05E18-MT P R O D U C T I N F O R M AT I O N C o n t e n t s : - 20

More information

Data Sheet. Glucocorticoid Receptor Pathway GR-GAL4 Reporter (Luc)-HEK293 cell Line Catalog #: 60655

Data Sheet. Glucocorticoid Receptor Pathway GR-GAL4 Reporter (Luc)-HEK293 cell Line Catalog #: 60655 Data Sheet Glucocorticoid Receptor Pathway GR-GAL4 Reporter (Luc)-HEK293 cell Line Catalog #: 60655 Background The glucocorticoid signaling pathway plays an important role in development, fluid homeostasis,

More information

FluoVolt Membrane Potential Kit

FluoVolt Membrane Potential Kit FluoVolt Membrane Potential Kit Catalog no. F10488 Table 1 Contents and storage Material Amount Storage Stability FluoVolt, 1000X in DMSO (Component A) PowerLoad Concentrate, 100X (Component B) 50 μl 500

More information

Figure S1: Insert sequences for GR1, GR2, Qc3c_AgeI and GR3 vectors

Figure S1: Insert sequences for GR1, GR2, Qc3c_AgeI and GR3 vectors Figure S1: Insert sequences for GR1, GR2, Qc3c_AgeI and GR3 vectors A Vector GR1 SacI BamHI CTCTGGCTAACTAGGC Insert 5/7nt - G TCGAGAGACCGATTGATCCG Insert 5/7nt - CCTAG 1 G CAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAAC

More information

Supplementary Information

Supplementary Information 1 Supplementary Information Supplementary Figures Supplementary Figure 1: The new CiPA concept and a role for OptoDyCE in cardiotoxicity testing. The new CiPA 1 (Comprehensive In Vitro Pro-arrhythmia Assay)

More information

Supporting Information

Supporting Information Supporting Information Development of a 2,4-Dinitrotoluene-Responsive Synthetic Riboswitch in E. coli cells Molly E. Davidson, Svetlana V. Harbaugh, Yaroslav G. Chushak, Morley O. Stone, Nancy Kelley-

More information

Calcium Assay Kit. Technical Data Sheet. Product Information. Description. Storage. Materials not included

Calcium Assay Kit. Technical Data Sheet. Product Information. Description. Storage. Materials not included BD Technical Data Sheet Calcium Assay Kit Product Information Catalog Number: 640176 Size Reagents for 10 plates Components: Calcium Indicator, 1 vial, lyophilized 10X Signal Enhancer, 10 ml 1X Calcium

More information

Data Sheet PD-1 / NFAT - Reporter - Jurkat Recombinant Cell Line Catalog #: 60535

Data Sheet PD-1 / NFAT - Reporter - Jurkat Recombinant Cell Line Catalog #: 60535 Data Sheet PD-1 / NFAT - Reporter - Jurkat Recombinant Cell Line Catalog #: 60535 Product Description Recombinant Jurkat T cell expressing firefly luciferase gene under the control of NFAT response elements

More information

10X ACTOne Membrane Potential Dye Solution, 10 ml each bottle, 10 bottles 10X ACTOne Dye Dilution Buffer, 100 ml

10X ACTOne Membrane Potential Dye Solution, 10 ml each bottle, 10 bottles 10X ACTOne Dye Dilution Buffer, 100 ml Codex Technical Data Sheet Codex ACTOne TM Membrane Potential Dye Bulk Kit Product Information Catalog Number: Components: CB-80500-211 10X ACTOne Membrane Potential Dye Solution, 10 ml each bottle, 10

More information

Classic cloning with pask-iba and pexpr-iba vectors

Classic cloning with pask-iba and pexpr-iba vectors Classic cloning with pask-iba and pexpr-iba vectors General protocol Last date of revision March 2017 Version PR08-0008 For research use only Important licensing information Products featuring CMV promoter,

More information

Manual patch clamp evaluation of herg channel 37 C and next steps

Manual patch clamp evaluation of herg channel 37 C and next steps Manual patch clamp evaluation of herg channel pharmacology @ 37 C and next steps Wendy Wu, Ph.D. Division of Applied Regulatory Science Office of Clinical Pharmacology Office of Translational Sciences

More information

All-in-One qpcr Mix. User Manual. For universal quantitative real-time PCR

All-in-One qpcr Mix. User Manual. For universal quantitative real-time PCR All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000 qpcr reactions) Cat. No. AOPR-1200

More information

Data Sheet. Glucocorticoid Receptor Pathway GAL4 Reporter (Luc)-HEK293 cell Line Catalog #: w70666

Data Sheet. Glucocorticoid Receptor Pathway GAL4 Reporter (Luc)-HEK293 cell Line Catalog #: w70666 Data Sheet Glucocorticoid Receptor Pathway GAL4 Reporter (Luc)-HEK293 cell Line Catalog #: w70666 Background The glucocorticoid signaling pathway plays an important role in development, fluid homeostasis,

More information

Answer sheet. Student number:

Answer sheet. Student number: Page 1 of 9 MIDTERM EXAM OF BIO/BPS3151 2016 Answer sheet Name: Student number: Part II: Calculations 1 128g 2 58.5g 3 NaCl: 1L Water: 0.2L 4 2.5 g/l 5 0.4 6 1:4:2 7 900 ml 8 Plasmid A: 3.75 µl Plasmid

More information

GFP Quantitation Kit, Fluorometric

GFP Quantitation Kit, Fluorometric Product Manual GFP Quantitation Kit, Fluorometric Catalog Number AKR- 12 1 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Green Fluorescent Protein (GFP) is a spontaneously

More information

Methods to Determine the Binding of Bevacizumab to Fc receptors

Methods to Determine the Binding of Bevacizumab to Fc receptors DATASHEET Methods to Determine the Binding of Bevacizumab to Fc receptors BACKGROUND Bevacizumab (Avastin ) is a humanized recombinant monoclonal antibody that inhibits angiogenesis by binding to the vascular

More information

mirnaselect pmir-gfp Reporter System

mirnaselect pmir-gfp Reporter System Product Data Sheet mirnaselect pmir-gfp Reporter System CATALOG NUMBER: MIR-GFP STORAGE: -80ºC QUANTITY: 100 µl of bacterial glycerol stock Components 1. mirnaselect pmir-gfp Reporter Vector (Part No.

More information

ENDEXT Technology. Instruction manual for protein synthesis. with wheat germ cell-free system

ENDEXT Technology. Instruction manual for protein synthesis. with wheat germ cell-free system ENDEXT Technology Instruction manual for protein synthesis with wheat germ cell-free system 1 Protocol Overview Plasmid DNA construction (see Section 3.1) Preparation of plasmid DNA for transcription (see

More information

For focused group profiling of human neuroscience ion channels and transporters genes expression

For focused group profiling of human neuroscience ion channels and transporters genes expression ExProfile TM Human Neuroscience Ion Channels & Transporters Related Gene qpcr Array For focused group profiling of human neuroscience ion channels and transporters genes expression Cat. No. QG039-A (1

More information

Mammalian Optimized GFP Strand 11 Plasmid Product Number RESEARCH PRODUCT INSERT

Mammalian Optimized GFP Strand 11 Plasmid Product Number RESEARCH PRODUCT INSERT Mammalian Optimized GFP Strand 11 Plasmid Product Number 22004003 FOR RESEARCH USE ONLY. Not for Diagnostic Use RESEARCH PRODUCT INSERT INTENDED USE Description pcmv-mgfp Cterm S11 Neo Kan vector encodes

More information

Nanotechnology for point of care diagnostics. Shana O. Kelley University of Toronto

Nanotechnology for point of care diagnostics. Shana O. Kelley University of Toronto Nanotechnology for point of care diagnostics Shana O. Kelley University of Toronto Nanotechnology what is it and why is it relevant to medicine? Existing molecular diagnostic technologies strengths and

More information

Relative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M reactions

Relative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M reactions Relative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M8908 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines

Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping

More information

Datasheet for HEK293/EGFP- AAVS1- Puro Stable Cell Line

Datasheet for HEK293/EGFP- AAVS1- Puro Stable Cell Line Datasheet for HEK293/EGFP- AAVS1- Puro Stable Cell Line Catalog number: Product: Description: SL573 HEK293 cell line stably expressing EGFP from AAVS1 locus. This product is a cell line stably expressing

More information

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Instruction manual RNA-direct SYBR Green Realtime PCR Master Mix 0810 F0930K RNA-direct SYBR Green Realtime PCR Master Mix Contents QRT-201T QRT-201 0.5mLx2 0.5mLx5 Store at -20 C, protected from light

More information

Quantitative Telomerase Detection Kit (QTD Kit)

Quantitative Telomerase Detection Kit (QTD Kit) Quantitative Telomerase Detection Kit (QTD Kit) Catalog No. MT3010, MT3011, MT3012 For Research Use Only. Not for use in diagnostic procedures 1 Table of Contents 1. Introduction Background Product Overview

More information

SBI4U Culminating Activity Part 1: Genetic Engineering of a Recombinant Plasmid Name:

SBI4U Culminating Activity Part 1: Genetic Engineering of a Recombinant Plasmid Name: SBI4U Culminating Activity Part 1: Genetic Engineering of a Recombinant Plasmid Name: Background Read through The Major Steps of Cloning of DNA on page 290 and examine the figure on page 291. This is the

More information

Data Sheet CD137/NF-κB Reporter - HEK293 Recombinant Cell Line Catalog # 79289

Data Sheet CD137/NF-κB Reporter - HEK293 Recombinant Cell Line Catalog # 79289 Data Sheet CD137/NF-κB Reporter - HEK293 Recombinant Cell Line Catalog # 79289 Background Human CD137 (4-1BB; TNFRS9) is an inducible co-stimulatory molecule that activates T cells. CD137:CD137L-mediated

More information

RNA-direct Realtime PCR Master Mix

RNA-direct Realtime PCR Master Mix Instruction manual RNA-direct Realtime PCR Master Mix 0803 F0929K RNA-direct Realtime PCR Master Mix Contents [1] Introduction [2] Components [3] Primer/Probe design [4] Detection [5] Specimens [6] Protocol

More information

Maize CaMV promoter & NOS terminator (GMO)

Maize CaMV promoter & NOS terminator (GMO) PCRmax Ltd TM qpcr test Maize CaMV promoter & NOS terminator (GMO) Maize CaMV promoter & NOS terminator 150 tests For general laboratory and research use only 1 Introduction to Maize CaMV promoter & NOS

More information

Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis

Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis icell Cardiomyocytes Application Protocol Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis Introduction Cardiac hypertrophy is characterized by several different cellular changes,

More information

Genomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M)

Genomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M) Maj Gen (R) Suhaib Ahmed, HI (M) The process of determining the sequence of an unknown DNA is called sequencing. There are many approaches for DNA sequencing. In the last couple of decades automated Sanger

More information

Roche Molecular Biochemicals Technical Note No. LC 12/2000

Roche Molecular Biochemicals Technical Note No. LC 12/2000 Roche Molecular Biochemicals Technical Note No. LC 12/2000 LightCycler Absolute Quantification with External Standards and an Internal Control 1. General Introduction Purpose of this Note Overview of Method

More information

Love Bird (Agapornis) Sexing Sex chromosome specific spindlin gene. Advanced Kit. 150 tests. For general laboratory and research use only

Love Bird (Agapornis) Sexing Sex chromosome specific spindlin gene. Advanced Kit. 150 tests. For general laboratory and research use only Love Bird (Agapornis) Sexing Sex chromosome specific spindlin gene 150 tests Advanced Kit For general laboratory and research use only Introduction to Love Bird (Agapornis) Sexing Specificity MAX MIN The

More information

Human Recombinant CD80 Stable Cell Line Cat. No. M00614 Version

Human Recombinant CD80 Stable Cell Line Cat. No. M00614 Version Human Recombinant CD80 Stable Cell Line Cat. No. M00614 Version 04282015 I. INTRODUCTION Catalog Number: M00614 Cell Line Name: GS-C1/CD80 Gene Synonyms: B7; B7-1; B7.1; BB1; CD28LG; CD28LG1; LAB7 Expressed

More information

Data Sheet. TCR activator / PD-L1 - CHO Recombinant Cell line Cat. #: 60536

Data Sheet. TCR activator / PD-L1 - CHO Recombinant Cell line Cat. #: 60536 Data Sheet TCR activator / PD-L1 - CHO Recombinant Cell line Cat. #: 60536 Product Description Recombinant CHO-K1 cells constitutively expressing human PD-L1 (Programmed Cell Death 1 Ligand 1, CD274, B7

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from

More information

EPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of

More information

M. tuberculosis_mpb64/is61 10 genesig Standard Kit

M. tuberculosis_mpb64/is61 10 genesig Standard Kit TM Primerdesign Ltd M. tuberculosis_mpb64/is61 10 genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to M.tuberculosis_MPB64/IS6110 2 Specificity MAX MIN The Primerdesign

More information

Relative Rat Telomere Length Quantification qpcr Assay Kit (RRTLQ) Catalog #R reactions

Relative Rat Telomere Length Quantification qpcr Assay Kit (RRTLQ) Catalog #R reactions Relative Rat Telomere Length Quantification qpcr Assay Kit (RRTLQ) Catalog #R8908 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

EPIGENTEK. EpiQuik Tissue Chromatin Immunoprecipitation Kit. Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Tissue Chromatin Immunoprecipitation Kit. Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Tissue Chromatin Immunoprecipitation Kit Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Tissue Chromatin Immunoprecipitation Kit is suitable for combining the specificity

More information

ab JC-10 Mitochondrial Membrane Potential Assay Kit Flow Cytometry

ab JC-10 Mitochondrial Membrane Potential Assay Kit Flow Cytometry ab112133 JC-10 Mitochondrial Membrane Potential Assay Kit Flow Instructions for Use For detecting mitochondrial membrane potential changes in cells using our proprietary fluorescence probe. This product

More information

Uses: The Methylamp MS-qPCR Fast Kit is very suitable for quantitative methylation-specific PCR in a fast format using very minute amounts of DNA.

Uses: The Methylamp MS-qPCR Fast Kit is very suitable for quantitative methylation-specific PCR in a fast format using very minute amounts of DNA. Methylamp MS-qPCR Fast Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The Methylamp MS-qPCR Fast Kit is very suitable for quantitative methylation-specific PCR in a fast format

More information

Mycoplasma bovis. genesig Standard Kit. DNA gyrase subunit B (gyrb) gene. 150 tests. Primerdesign Ltd. For general laboratory and research use only

Mycoplasma bovis. genesig Standard Kit. DNA gyrase subunit B (gyrb) gene. 150 tests. Primerdesign Ltd. For general laboratory and research use only TM Primerdesign Ltd Mycoplasma bovis DNA gyrase subunit B (gyrb) gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Mycoplasma bovis Mycoplasmas are small,

More information

THUNDERBIRD SYBR qpcr Mix

THUNDERBIRD SYBR qpcr Mix Instruction manual THUNDERBIRD SYBR qpcr Mix 1304 A4251K THUNDERBIRD SYBR qpcr Mix QPS-201T 1 ml x 1 QPS-201 1.67 ml x 3 Contents [1] Introduction [2] Components [3] Primer design [4] Template DNA [5]

More information

CytoSelect 96-Well Cell Transformation Assay (Cell Recovery Compatible, Fluorometric)

CytoSelect 96-Well Cell Transformation Assay (Cell Recovery Compatible, Fluorometric) Product Manual CytoSelect 96-Well Cell Transformation Assay (Cell Recovery Compatible, Fluorometric) Catalog Number CBA-140 CBA-140-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic

More information

Data Sheet. TGFβ/SMAD Signaling Pathway SBE Reporter HEK293 Cell Line Catalog #: 60653

Data Sheet. TGFβ/SMAD Signaling Pathway SBE Reporter HEK293 Cell Line Catalog #: 60653 Data Sheet TGFβ/SMAD Signaling Pathway SBE Reporter HEK293 Cell Line Catalog #: 60653 Background The SBE Reporter HEK293 Cell Line is designed for monitoring the activity of the TGFβ/SMAD signaling pathway.

More information

Phospholipase D Assay Kit

Phospholipase D Assay Kit Phospholipase D Assay Kit Catalog Number KA1636 100 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the

More information

2X Q-PCR Master Mix 1 ml x 2 (SYBR, ROX) Storage Aliquot to avoid multiple freeze-thaw cycles Protect from light -20 C for 12 months

2X Q-PCR Master Mix 1 ml x 2 (SYBR, ROX) Storage Aliquot to avoid multiple freeze-thaw cycles Protect from light -20 C for 12 months www.smobio.com Product Information ExcelTaq series 2X Q-PCR Master Mix (SYBR, ROX) TQ1110 200 RXN 2X Q-PCR Master Mix 1 ml x 2 (SYBR, ROX) Storage Aliquot to avoid multiple freeze-thaw cycles Protect from

More information

Data Sheet. camp/pka Signaling Pathway CRE/CREB Reporter (Luc) HEK293 Cell Line Catalog #: 60515

Data Sheet. camp/pka Signaling Pathway CRE/CREB Reporter (Luc) HEK293 Cell Line Catalog #: 60515 Data Sheet camp/pka Signaling Pathway CRE/CREB Reporter (Luc) HEK293 Cell Line Catalog #: 60515 Background The camp/pka Signaling Pathway CRE/CREB Reporter (Luc) HEK293 Cell Line is designed for monitoring

More information

Maize Chlorotic Mottle Virus

Maize Chlorotic Mottle Virus TM Primerdesign Ltd Maize Chlorotic Mottle Virus Coat Protein Gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Maize Chlorotic Mottle Virus Maize chlorotic

More information

Miniaturized Quantitative PCR in a 1536-well Format Using the Echo Liquid Handler

Miniaturized Quantitative PCR in a 1536-well Format Using the Echo Liquid Handler TM Application Note G101 Echo Liquid Handler Miniaturized Quantitative PCR in a 1536-well Format Using the Echo Liquid Handler Celeste Glazer, Sammy Datwani Labcyte Inc. Abstract Miniaturizing quantitative

More information

Cell-Free Protein Expression Kit

Cell-Free Protein Expression Kit Cell-Free Protein Expression Kit Handbook Version v.01, January 2018 Cat# 507024 (Sigma 70 Master Mix Kit, 24 Rxns) Cat# 507096 (Sigma 70 Master Mix Kit, 96 Rxns) Please refer to this product in your publication

More information

Pistacia vera. Introduction to Pistacia vera. 100 tests. Techne qpcr test. For general laboratory and research use only

Pistacia vera. Introduction to Pistacia vera. 100 tests. Techne qpcr test. For general laboratory and research use only Techne qpcr test Pistacia vera 100 tests For general laboratory and research use only Introduction to Pistacia vera 1 2 Specificity The Techne Kit for Pistacia vera (P.vera) genomes is designed for the

More information

FLIPR Calcium 6 Assay Explorer Kit (R8190) FLIPR Calcium 6-QF Assay Explorer Kit (R8192)

FLIPR Calcium 6 Assay Explorer Kit (R8190) FLIPR Calcium 6-QF Assay Explorer Kit (R8192) FLIPR Calcium 6 Assay Explorer Kit (R8190) FLIPR Calcium 6-QF Assay Explorer Kit (R8192) About the FLIPR Calcium 6 and 6-QF Assay Kits The FLIPR Calcium 6 Assay Kits from Molecular Devices, LLC (hereafter

More information

Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M reactions

Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M reactions Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

RapidFinder TM Goat ID Kit

RapidFinder TM Goat ID Kit RapidFinder TM Goat ID Kit IMG-175 For testing of Food and Environmental samples only. The information in this guide is subject to change without notice. DISCLAIMER LIFE TECHNOLOGIES CORPORATION A/OR ITS

More information

Lacombe et al. Supplemental material ms INS-BR-TR-2

Lacombe et al. Supplemental material ms INS-BR-TR-2 Supplemental Figure 1: Rabbit α-gla antibodies specifically recognize carboxylated VKD proteins. (A) HEK293 cells were transfected with plasmids encoding GGCX-FLAG, PT- FLAG or tagged proline rich Gla

More information

Mouse Laminin ELISA Kit (mlaminin-elisa)

Mouse Laminin ELISA Kit (mlaminin-elisa) Mouse Laminin ELISA Kit (mlaminin-elisa) Cat. No. EK0436 96 Tests in 8 x 12 divisible strips Background Laminin is a large basement membrane glycoprotein composed of three subunits designated the A, B1,

More information

Fluo-4 NW Calcium Assay Kits (F36205, F36206)

Fluo-4 NW Calcium Assay Kits (F36205, F36206) Product Information Revised: 20 October 2006 Fluo-4 NW Calcium Assay Kits (F36205, F36206) F36205 Fluo-4 NW Calcium Assay Kit (high-throughput) *for 100 microplates* F36206 Fluo-4 NW Calcium Assay Kit

More information

Techne qpcr test. A graveolens. NADPH-dependent mannose 6- phosphate reductase (m6pr) 100 tests

Techne qpcr test. A graveolens. NADPH-dependent mannose 6- phosphate reductase (m6pr) 100 tests Techne qpcr test A graveolens NADPH-dependent mannose 6- phosphate reductase (m6pr) 100 tests For general laboratory and research use only Introduction to A graveolens 1 2 Specificity The Techne Kit for

More information

Color-Switch CRE recombinase stable cell line

Color-Switch CRE recombinase stable cell line Color-Switch CRE recombinase stable cell line Catalog Number Product Name / Description Amount SC018-Bsd CRE reporter cell line (Bsd): HEK293-loxP-GFP- RFP (Bsd). RFP" cassette with blasticidin antibiotic

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

CIPA - Replacing the TQT with Non-clinical Proarrhythmia Testing: A New Paradigm

CIPA - Replacing the TQT with Non-clinical Proarrhythmia Testing: A New Paradigm CIPA - Replacing the TQT with Non-clinical Proarrhythmia Testing: A New Paradigm Current status, opportunities, and challenges Hugo M. Vargas, PhD, DSP Scientific Director Safety & Exploratory Pharmacology

More information

For focused group profiling of human electron transport toxicology genes expression

For focused group profiling of human electron transport toxicology genes expression Product Data Sheet ExProfile TM Human Electron Transport Toxicology Related Gene qpcr Array For focused group profiling of human electron transport toxicology genes expression Cat. No. QG014-A (1 x 96-well

More information

For focused group profiling of human inflammatory response and autoimmunity related gene expression

For focused group profiling of human inflammatory response and autoimmunity related gene expression GeneCopoeia TM Expressway to Discovery Product Data Sheet ExProfile TM Human Inflammatory Response and Autoimmunity Related Gene qpcr Array For focused group profiling of human inflammatory response and

More information

Staphylococcus epidermidis

Staphylococcus epidermidis TM Primerdesign Ltd Staphylococcus epidermidis superoxide dismutase (soda) gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Staphylococcus epidermidis

More information

For focused group profiling of human cytokine receptor-related gene expression

For focused group profiling of human cytokine receptor-related gene expression GeneCopoeia TM Expressway to Discovery Product Data Sheet ExProfile TM Human Cytokine Receptor Related Gene qpcr Array For focused group profiling of human cytokine receptor-related gene expression Cat.

More information

Product Manual. RFP ELISA Kit. Catalog Number. FOR RESEARCH USE ONLY Not for use in diagnostic procedures

Product Manual. RFP ELISA Kit. Catalog Number. FOR RESEARCH USE ONLY Not for use in diagnostic procedures Product Manual RFP ELISA Kit Catalog Number AKR-122 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Red fluorescent protein (DsRed) is a spontaneously fluorescent protein

More information

Epstein Barr Virus (Human Herpes virus 4)

Epstein Barr Virus (Human Herpes virus 4) TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to

More information

EpiQuik Tissue Methyl-CpG Binding Domain Protein 2 ChIP Kit

EpiQuik Tissue Methyl-CpG Binding Domain Protein 2 ChIP Kit EpiQuik Tissue Methyl-CpG Binding Domain Protein 2 ChIP Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Tissue Methyl-CpG Binding Domain Protein 2 ChIP Kit is suitable for

More information

For research use only. Not for use in diagnostic procedures.

For research use only. Not for use in diagnostic procedures. INSTRUCTIONS Human vwf ELISA Kit EHVWF Number EHVWF Description Human vwf ELISA Kit, sufficient reagents for 96 determinations Kit Contents Size Anti-Human vwf Precoated 96-well Strip Plate 1 each Lyophilized

More information