RECOMMENDED CULTURE CONDITIONS Recommended culture conditions and standard operating procedure are provided with the product.
|
|
- Sandra Dean
- 6 years ago
- Views:
Transcription
1 PRODUCT DATASHEET PrecisION hnav1.5-hek Recombinant Cell Line Catalog Number: CYL3004 PRODUCT DESCRIPTION Recombinant HEK293 cell line expressing the human Nav1.5 (type V voltage-gated sodium channel alpha subunit, accession number NM_000335). ASSOCIATED PRODUCTS The PrecisION hnav1.5-hek293 Recombinant Cell Line is provided to customers on the purchase of an appropriate license. The available licenses are: CYL3004SS PrecisION hnav1.5-hek Single Site License CYL3004TS PrecisION hnav1.5-hek Two Site License CYL3004MS PrecisION hnav1.5-hek Multiple Site License CONTENTS 2 x 1 ml aliquots containing 1.32 x 10 6 cells/ml in 10% DMSO at passage 10. STORAGE Vials are to be stored in liquid N 2. WARNINGS For Research Use Only; Not for Use in Diagnostic Procedures Not for Animal or Human Consumption GMO This product contains genetically modified organisms. Este producto contiene organismos genéticamente modificados. Questo prodotto contiene degli organismi geneticamente modificati. Dieses Produkt enthält genetisch modifizierte Organismen. Ce produit contient organismes génétiquement des modifiés. Dit product bevat genetisch gewijzigde organismen. Tämä tuote sisältää geneettisesti muutettuja organismeja. Denna produkt innehåller genetiskt ändrade organismer. MYCOPLASMA TESTING The cell line has been screened using the ELISA based Mycoplasma Detection kit (Roche) and by a PCR VenorGem kit (Minerva Biolabs) to confirm the absence of Mycoplasma species. FUNCTIONAL VALIDATION The PrecisION hnav1.5-hek recombinant cell line was analyzed by patch-clamp techniques giving typical peak currents between na. With IonWorks, typically greater than 80% of cells expressed peak currents of an average amplitude of na. RECOMMENDED CULTURE CONDITIONS Recommended culture conditions and standard operating procedure are provided with the product. Eurofins Pharma Bioanalytics 15 Research Park Drive T Services US Inc. St Charles MO F USA Template version: 6. Modified Date: 21JUL14. Modified by: SGJ
2 FUNCTIONAL VALIDATION Electrophysiological properties of the hnav1.5 current. Whole-cell Patch Clamp Electrophysiology. Figure 1. Representative currents produced by the PrecisION hnav1.5-hek cell line. A. Representative current traces elicited by a series of test pulses given in 10 mv increments from the holding potential of -90 mv. Typically peak currents range between na (no currents are recorded in untransfected cells). B. The current-voltage relationship shows currents begin to activate at approximately 50 mv, reach a peak at 20 mv and have a reversal potential (E rev ) of ± 4.6, n=3 (calculated E rev +37 mv). 2
3 Figure 2. Whole cell patch clamp recordings of the PrecisION hnav1.5-hek cell line. A. Shows a series of currents evoked by 20 ms depolarizing steps from a holding potential of 110 mv. B. The peak current-voltage relationship. The observed reversal potential of +60 mv is close to the theoretical Na + equilibrium potential of +58 mv under the ionic conditions. C. Shows the steady state inactivation curve for hnav1.5, constructed from 4 s conditioning pulses to the voltages shown on the abscissa, followed by test pulses to 20 mv. The V ½ for inactivation was 90.1 mv and the slope value (k) was A B mv pA -600 C ms -800 pa V h -110mV I/I Max 0.4 V mV Slope V h -120mV 4s conditioning Conditioning potential 3
4 Figure 3. Use of the PrecisION hnav1.5-hek cell line in FLIPR screening assays. In hnav1.5-hek cells incubated with DiBAC and scorpion venom (ScTx), KCl induces reproducible membrane potential depolarizations (increased fluorescence) that are dependent in size upon the concentration of ScTx used. No responses are seen in untransfected HEK293 cells. Figure 4. Use of the PrecisION hnav1.5-hek cell line in VIPR screening assays. In hnav1.5-hek expressing cells incubated with VSP fluorescent dyes (voltage sensitive probes) and scorpion venom, a rapid Na + ion-dependent membrane potential depolarizations (increase in the relative ratio of fluorescence from the 2 VSP dyes) are observed. These are significantly greater than in untransfected controls and can be blocked with the standard inhibitor tetracaine. 4
5 Figure 5. Use of the PrecisION hnav1.5-hek cell line in IonWorks HT screening assays. A. Simultaneous recording of currents from 48 wells of an IonWorks HT patch plate, each trace represents currents recorded from an individual hnav1.5-hek cell. B. Typically greater than 80% of cells express peak currents with an average amplitude of 2.4 na. C. Concentration response curves for 2 standard inhibitors tested by IonWorks HT. Stability of PrecisION hnav1.5-hek Cell Line: The PrecisION hnav1.5-hek cell line has stable expression for >25 passages. 5
6 Vector: HpaI ClaI NdeI BssHII AscI XhoI NotI NsiI SspI NdeI MluI NaeI BamHI KpnI IVS CMV promoter EcoRI BclI Sse8387 XhoI MluI AgeI Amp BsaBI EcoRI 8000 polya XhoI Neo BclI XbaI NaeI BssHII TthI NarI KpnI IRES SfiI TthI pcin5-hnav bps hnav1.5 KpnI PshAI BamHI NaeI NarI NdeI NheI SmaI XmaI BamHI Polylinker: CMV-IVS-NotI-Nav1.5-NotI-EcoRI-IRES-neo hnav1.5 Sequence: The sequence of the cdna used to make this cell line contains a coding two base pair mutation with respect to the accession number NM_ GGC to GCT - at positions conferring the amino acid change Gly180Ala. 6
7 REFERENCES 1. Clare, J.J., Tate, SN., Nobbs M. and Romanos, M.A. (2000) Voltage-gated sodium channels as therapeutic targets. Drug Disc. Today 5: Gellens, M.E., George, Jr. A.L., Chen, L., Chahine, M., Horn, R., Barchi, R.L. and Kallen, R.G. (1992) Primary Structure and Functional Expression of the Human Cardiac Tetrodotoxin-Insensitive Voltage-Dependent Sodium Channel. Proc. Natl. Acad. Sci. USA 89 (2): Schroeder, K., Neagle, B., Trezise D.J. and Worley, J. (2003) Ionworks HT: a new high-throughput electrophysiology measurement platform. J. Biomol Screen 8 (1): FOR RESEARCH USE ONLY; NOT FOR USE IN DIAGNOSTIC PROCEDURES. NOT FOR HUMAN OR ANIMAL CONSUMPTION Unless otherwise stated in our catalog or other company documentation accompanying the product(s), our products are intended for research use only and are not to be used for any other purpose, which includes but is not limited to, unauthorized commercial uses, in vitro diagnostic uses, ex vivo or in vivo therapeutic uses or any type of consumption or application to humans or animals. No part of these works may be reproduced in any form without permission in writing. Eurofins Pharma Bioanalytics Services US Inc. is an independent member of Eurofins Discovery Services 7
PRODUCT DESCRIPTION Recombinant HEK293 cell line expressing the four subunits α1, β1, δ and ε of the human nicotinic acetylcholine receptor type I.
PRODUCT DATASHEET PrecisION hnachr α1/β1/δ/ε-hek Recombinant Cell Line Catalog Number: CYL3052 PRODUCT DESCRIPTION Recombinant HEK293 cell line expressing the four subunits α1, β1, δ and ε of the human
More informationChemiScreen CRF 1 Corticotropin Releasing Factor Receptor Stable Cell Line
PRODUCT DATASHEET ChemiScreen CRF 1 Corticotropin Releasing Factor Receptor Stable Cell Line CATALOG NUMBER: HTS023C CONTENTS: 2 vials of mycoplasma-free cells, 1 ml per vial. STORAGE: Vials are to be
More informationChemiScreen CRF 2 Corticotropin Releasing Factor Receptor Stable Cell Line
PRODUCT DATASHEET ChemiScreen CRF 2 Corticotropin Releasing Factor Receptor Stable Cell Line CATALOG NUMBER: HTS024C CONTENTS: 2 vials of mycoplasma-free cells, 1 ml per vial. STORAGE: Vials are to be
More informationPRODUCT DATASHEET. Ready-to-Assay 5-HT 2A Serotonin Family Receptor Frozen Cells
PRODUCT DATASHEET Ready-to-Assay 5-HT 2A Serotonin Family Receptor Frozen Cells CATALOG NUMBER: HTS082RTA CONTENTS: Pack contains 2 vials of mycoplasma-free cells, 1 ml per vial. Fifty (50) ml of Media
More informationCHO herg-duo Cell Line
B SYS GmbH CHO herg-duo Cell Line Specification Sheet B SYS GmbH B SYS GmbH CHO herg DUO Cells Page 2 TABLE OF CONTENTS 1. BACKGROUND...3 1.1. DRUG-INDUCED QT PROLONGATION...3 1.2. REGULATORY ISSUES...3
More informationCHO Na V 1.4 Cell Line
B SYS GmbH CHO Na V 1.4 Cell Line Specification Sheet B SYS GmbH B SYS GmbH CHO Na V 1.4 Cells Page 2 TABLE OF CONTENTS 1. B'SYS Na V 1.4 CELL LINE...2 1.1 THE VOLTAGE GATED SODIUM CHANNELS NA V 1.4...2
More informationCHO-Tet herg Cell Line
F B SYS GmbH CHO-Tet herg Cell Line Specification Sheet B SYS GmbH B SYS GmbH CHO-Tet herg Cells Page 2 TABLE OF CONTENTS 1 BACKGROUND...3 1.1 Drug-induced QT Prolongation...3 1.2 Regulatory Issues...3
More informationCHO K V 4.3 Cell Line
B SYS GmbH CHO K V 4.3 Cell Line Specification Sheet B SYS GmbH B SYS GmbH CHO K V 4.3 Cells Page 2 TABLE OF CONTENTS 1. PRODUCT SHIPMENT...3 1.1. Product Format...3 1.2. Mycoplasma Certificate...3 1.3.
More informationCHO-hERG DUO optimized for QPatch
Application Report CHO-hERG DUO optimized for QPatch Functional validation and performance data for the CHO herg DUO cell line available from. This cell line is made in collaboration with B SYS GmbH (Switzerland).
More information1.7 on Nanion's SyncroPatch 384PE. The electrophysiology team at Nanion Technologies GmbH, Munich, Germany. Cells were kindly provided by Anaxon.
Channel: h 1.7 Cells: CHO Tools: SyncroPatch 384PE Characterization of h 1.7 on Nanion's SyncroPatch 384PE The electrophysiology team at, Munich, Germany. Cells were kindly provided by Anaxon. Summary
More informationTECHNOLOGY PLATFORMS FOR THE STUDY OF ION CHANNEL BIOLOGY AVAILABLE AT REACTION BIOLOGY CORP
TECHNOLOGY PLATFORMS FOR THE STUDY OF ION CHANNEL BIOLOGY AVAILABLE AT REACTION BIOLOGY CORP Introduction Ion channels are integral membrane proteins that mediate the regulated passage of charged particles
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationTECHNICAL BULLETIN. pgem -9Zf( ) Vector. Instructions for Use of Product P2391. Revised 4/17 TB070
TECHNICAL BULLETIN pgem -9Zf( ) Vector Instructions for Use of Product P2391 Revised 4/17 TB070 pgem -9Zf( ) Vector All technical literature is available at: www.promega.com/protocols/ Visit the web site
More informationData Sheet. Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 60618
Data Sheet Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 6618 Background The Hippo pathway regulates cell proliferation and cell death. It is activated by high cell density and cell stress to stop
More informationData Sheet IDO2 - HEK293 Recombinant Cell Line Cat #: 60533
Data Sheet IDO2 - HEK293 Recombinant Cell Line Cat #: 60533 Description Recombinant HEK293 cell line expressing tetracycline-inducible human indoleamine 2,3- dioxygenase (IDO2), Genbank accession number
More information15 June 2011 Supplementary material Bagriantsev et al.
Supplementary Figure S1 Characterization of K 2P 2.1 (TREK-1) GOF mutants A, Distribution of the positions of mutated nucleotides, represented by a red x, from a pool of 18 unselected K 2P 2.1 (KCNK2)
More informationData Sheet. MAPK/ERK Signaling Pathway SRE Reporter HEK293 Cell Line Catalog #: 60406
Data Sheet MAPK/ERK Signaling Pathway SRE Reporter HEK293 Cell Line Catalog #: 60406 Description The MAPK/ERK signaling pathway is a major participant in the regulation of cell growth and differentiation.
More informationImproved method for assembly of linear yeast expression cassettes using NEBuilder HiFi DNA Assembly Master Mix
DNA CLONING DNA AMPLIFICATION & PCR Improved method for assembly of linear yeast expression cassettes using NEBuilder HiFi DNA Assembly Master Mix EPIGENETICS RNA ANALYSIS LIBRARY PREP FOR NEXT GEN SEQUENCING
More informationMembrane Potential Assays Using the ValiScreen Human Kv1.3 Voltage-Gated K + Channel Cell Line on the EnVision Multilabel Plate Reader
TECHNICAL BRIEF ValiScreen Stable Recombinant Ion Channel Cell Line and the EnVision Multilabel Plate Reader Membrane Potential Assays Using the ValiScreen Human Kv1.3 Voltage-Gated K + Channel Cell Line
More informationData Sheet. Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409
Data Sheet Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409 Product Description The Gli Reporter NIH3T3 Cell Line is designed for monitoring the activity of the hedgehog signaling
More informationLigase Independent Cloning (LIC) using petm-13/lic
Ligase Independent Cloning (LIC) using petm-13/lic Creating a construct with a C-terminal His 6 -tag Ligase independent cloning (LIC) is a simple, fast and relatively cheap method to produce expression
More informationProduct Information GetClone PCR Cloning Vector II. Storage -20 C for 24 months
www.smobio.com Product Information GetClone PCR Cloning Vector II CV1100 20 RXN pget II Vector (25 ng/μl) pget-for Primer (10 μm) pget-rev Primer (10 μm) Storage -20 C for 24 months 23 μl 100 μl 100 μl
More informationCHO-Nav1.5. On QPatch. Application Report:
Application Report: CHO-Nav1.5 On QPatch The sodium ion channel Nav1.5 is expressed as in integral membrane protein and contains a tetrodotoxinresistant voltage-gated sodium channel subunit.the encoded
More informationHTS of Ca 2+ Transients in Human ips-derived Cardiomyocytes as a Predictive and Cost Effective Assay Early on in Drug Development
Use our discoveries to advance yours HTS of Ca 2+ Transients in Human ips-derived Cardiomyocytes as a Predictive and Cost Effective Assay Early on in Drug Development Dr. Ralf Kettenhofen! Axiogenesis
More informationNotch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652
Notch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652 Background The Notch signaling pathway controls cell fate decisions in vertebrate and invertebrate tissues. Notch signaling
More informationGeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual
GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000
More informationHTS automated patch clamp takes cardiac safety testing to the next level
Nanion Technologies HTS automated patch clamp takes cardiac safety testing to the next level Dr. Elena Dragicevic Senior Scientist / Sales Manager at Nanion Technologies Agenda Meet Nanion Technologies
More informationData Sheet. Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409
Data Sheet Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409 Product Description The Gli Reporter NIH3T3 Cell Line is designed for monitoring the activity of the hedgehog signaling
More informationpvitro2-neo-mcs An innovative multigenic plasmid for high levels of expression Catalog # pvitro2-nmcs For research use only Version # 05E18-MT
pvitro2-neo-mcs An innovative multigenic plasmid for high levels of expression Catalog # pvitro2-nmcs For research use only Version # 05E18-MT P R O D U C T I N F O R M AT I O N C o n t e n t s : - 20
More informationData Sheet. Glucocorticoid Receptor Pathway GR-GAL4 Reporter (Luc)-HEK293 cell Line Catalog #: 60655
Data Sheet Glucocorticoid Receptor Pathway GR-GAL4 Reporter (Luc)-HEK293 cell Line Catalog #: 60655 Background The glucocorticoid signaling pathway plays an important role in development, fluid homeostasis,
More informationFluoVolt Membrane Potential Kit
FluoVolt Membrane Potential Kit Catalog no. F10488 Table 1 Contents and storage Material Amount Storage Stability FluoVolt, 1000X in DMSO (Component A) PowerLoad Concentrate, 100X (Component B) 50 μl 500
More informationFigure S1: Insert sequences for GR1, GR2, Qc3c_AgeI and GR3 vectors
Figure S1: Insert sequences for GR1, GR2, Qc3c_AgeI and GR3 vectors A Vector GR1 SacI BamHI CTCTGGCTAACTAGGC Insert 5/7nt - G TCGAGAGACCGATTGATCCG Insert 5/7nt - CCTAG 1 G CAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAAC
More informationSupplementary Information
1 Supplementary Information Supplementary Figures Supplementary Figure 1: The new CiPA concept and a role for OptoDyCE in cardiotoxicity testing. The new CiPA 1 (Comprehensive In Vitro Pro-arrhythmia Assay)
More informationSupporting Information
Supporting Information Development of a 2,4-Dinitrotoluene-Responsive Synthetic Riboswitch in E. coli cells Molly E. Davidson, Svetlana V. Harbaugh, Yaroslav G. Chushak, Morley O. Stone, Nancy Kelley-
More informationCalcium Assay Kit. Technical Data Sheet. Product Information. Description. Storage. Materials not included
BD Technical Data Sheet Calcium Assay Kit Product Information Catalog Number: 640176 Size Reagents for 10 plates Components: Calcium Indicator, 1 vial, lyophilized 10X Signal Enhancer, 10 ml 1X Calcium
More informationData Sheet PD-1 / NFAT - Reporter - Jurkat Recombinant Cell Line Catalog #: 60535
Data Sheet PD-1 / NFAT - Reporter - Jurkat Recombinant Cell Line Catalog #: 60535 Product Description Recombinant Jurkat T cell expressing firefly luciferase gene under the control of NFAT response elements
More information10X ACTOne Membrane Potential Dye Solution, 10 ml each bottle, 10 bottles 10X ACTOne Dye Dilution Buffer, 100 ml
Codex Technical Data Sheet Codex ACTOne TM Membrane Potential Dye Bulk Kit Product Information Catalog Number: Components: CB-80500-211 10X ACTOne Membrane Potential Dye Solution, 10 ml each bottle, 10
More informationClassic cloning with pask-iba and pexpr-iba vectors
Classic cloning with pask-iba and pexpr-iba vectors General protocol Last date of revision March 2017 Version PR08-0008 For research use only Important licensing information Products featuring CMV promoter,
More informationManual patch clamp evaluation of herg channel 37 C and next steps
Manual patch clamp evaluation of herg channel pharmacology @ 37 C and next steps Wendy Wu, Ph.D. Division of Applied Regulatory Science Office of Clinical Pharmacology Office of Translational Sciences
More informationAll-in-One qpcr Mix. User Manual. For universal quantitative real-time PCR
All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000 qpcr reactions) Cat. No. AOPR-1200
More informationData Sheet. Glucocorticoid Receptor Pathway GAL4 Reporter (Luc)-HEK293 cell Line Catalog #: w70666
Data Sheet Glucocorticoid Receptor Pathway GAL4 Reporter (Luc)-HEK293 cell Line Catalog #: w70666 Background The glucocorticoid signaling pathway plays an important role in development, fluid homeostasis,
More informationAnswer sheet. Student number:
Page 1 of 9 MIDTERM EXAM OF BIO/BPS3151 2016 Answer sheet Name: Student number: Part II: Calculations 1 128g 2 58.5g 3 NaCl: 1L Water: 0.2L 4 2.5 g/l 5 0.4 6 1:4:2 7 900 ml 8 Plasmid A: 3.75 µl Plasmid
More informationGFP Quantitation Kit, Fluorometric
Product Manual GFP Quantitation Kit, Fluorometric Catalog Number AKR- 12 1 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Green Fluorescent Protein (GFP) is a spontaneously
More informationMethods to Determine the Binding of Bevacizumab to Fc receptors
DATASHEET Methods to Determine the Binding of Bevacizumab to Fc receptors BACKGROUND Bevacizumab (Avastin ) is a humanized recombinant monoclonal antibody that inhibits angiogenesis by binding to the vascular
More informationmirnaselect pmir-gfp Reporter System
Product Data Sheet mirnaselect pmir-gfp Reporter System CATALOG NUMBER: MIR-GFP STORAGE: -80ºC QUANTITY: 100 µl of bacterial glycerol stock Components 1. mirnaselect pmir-gfp Reporter Vector (Part No.
More informationENDEXT Technology. Instruction manual for protein synthesis. with wheat germ cell-free system
ENDEXT Technology Instruction manual for protein synthesis with wheat germ cell-free system 1 Protocol Overview Plasmid DNA construction (see Section 3.1) Preparation of plasmid DNA for transcription (see
More informationFor focused group profiling of human neuroscience ion channels and transporters genes expression
ExProfile TM Human Neuroscience Ion Channels & Transporters Related Gene qpcr Array For focused group profiling of human neuroscience ion channels and transporters genes expression Cat. No. QG039-A (1
More informationMammalian Optimized GFP Strand 11 Plasmid Product Number RESEARCH PRODUCT INSERT
Mammalian Optimized GFP Strand 11 Plasmid Product Number 22004003 FOR RESEARCH USE ONLY. Not for Diagnostic Use RESEARCH PRODUCT INSERT INTENDED USE Description pcmv-mgfp Cterm S11 Neo Kan vector encodes
More informationNanotechnology for point of care diagnostics. Shana O. Kelley University of Toronto
Nanotechnology for point of care diagnostics Shana O. Kelley University of Toronto Nanotechnology what is it and why is it relevant to medicine? Existing molecular diagnostic technologies strengths and
More informationRelative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M reactions
Relative Mouse Telomere Length Quantification qpcr Assay Kit (RMTLQ) Catalog #M8908 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationApplied Biosystems Real-Time PCR Rapid Assay Development Guidelines
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping
More informationDatasheet for HEK293/EGFP- AAVS1- Puro Stable Cell Line
Datasheet for HEK293/EGFP- AAVS1- Puro Stable Cell Line Catalog number: Product: Description: SL573 HEK293 cell line stably expressing EGFP from AAVS1 locus. This product is a cell line stably expressing
More informationFOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual RNA-direct SYBR Green Realtime PCR Master Mix 0810 F0930K RNA-direct SYBR Green Realtime PCR Master Mix Contents QRT-201T QRT-201 0.5mLx2 0.5mLx5 Store at -20 C, protected from light
More informationQuantitative Telomerase Detection Kit (QTD Kit)
Quantitative Telomerase Detection Kit (QTD Kit) Catalog No. MT3010, MT3011, MT3012 For Research Use Only. Not for use in diagnostic procedures 1 Table of Contents 1. Introduction Background Product Overview
More informationSBI4U Culminating Activity Part 1: Genetic Engineering of a Recombinant Plasmid Name:
SBI4U Culminating Activity Part 1: Genetic Engineering of a Recombinant Plasmid Name: Background Read through The Major Steps of Cloning of DNA on page 290 and examine the figure on page 291. This is the
More informationData Sheet CD137/NF-κB Reporter - HEK293 Recombinant Cell Line Catalog # 79289
Data Sheet CD137/NF-κB Reporter - HEK293 Recombinant Cell Line Catalog # 79289 Background Human CD137 (4-1BB; TNFRS9) is an inducible co-stimulatory molecule that activates T cells. CD137:CD137L-mediated
More informationRNA-direct Realtime PCR Master Mix
Instruction manual RNA-direct Realtime PCR Master Mix 0803 F0929K RNA-direct Realtime PCR Master Mix Contents [1] Introduction [2] Components [3] Primer/Probe design [4] Detection [5] Specimens [6] Protocol
More informationMaize CaMV promoter & NOS terminator (GMO)
PCRmax Ltd TM qpcr test Maize CaMV promoter & NOS terminator (GMO) Maize CaMV promoter & NOS terminator 150 tests For general laboratory and research use only 1 Introduction to Maize CaMV promoter & NOS
More informationModeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis
icell Cardiomyocytes Application Protocol Modeling Cardiac Hypertrophy: Endothelin-1 Induction with qrt-pcr Analysis Introduction Cardiac hypertrophy is characterized by several different cellular changes,
More informationGenomic Sequencing. Genomic Sequencing. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, HI (M) The process of determining the sequence of an unknown DNA is called sequencing. There are many approaches for DNA sequencing. In the last couple of decades automated Sanger
More informationRoche Molecular Biochemicals Technical Note No. LC 12/2000
Roche Molecular Biochemicals Technical Note No. LC 12/2000 LightCycler Absolute Quantification with External Standards and an Internal Control 1. General Introduction Purpose of this Note Overview of Method
More informationLove Bird (Agapornis) Sexing Sex chromosome specific spindlin gene. Advanced Kit. 150 tests. For general laboratory and research use only
Love Bird (Agapornis) Sexing Sex chromosome specific spindlin gene 150 tests Advanced Kit For general laboratory and research use only Introduction to Love Bird (Agapornis) Sexing Specificity MAX MIN The
More informationHuman Recombinant CD80 Stable Cell Line Cat. No. M00614 Version
Human Recombinant CD80 Stable Cell Line Cat. No. M00614 Version 04282015 I. INTRODUCTION Catalog Number: M00614 Cell Line Name: GS-C1/CD80 Gene Synonyms: B7; B7-1; B7.1; BB1; CD28LG; CD28LG1; LAB7 Expressed
More informationData Sheet. TCR activator / PD-L1 - CHO Recombinant Cell line Cat. #: 60536
Data Sheet TCR activator / PD-L1 - CHO Recombinant Cell line Cat. #: 60536 Product Description Recombinant CHO-K1 cells constitutively expressing human PD-L1 (Programmed Cell Death 1 Ligand 1, CD274, B7
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template
Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from
More informationEPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of
More informationM. tuberculosis_mpb64/is61 10 genesig Standard Kit
TM Primerdesign Ltd M. tuberculosis_mpb64/is61 10 genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to M.tuberculosis_MPB64/IS6110 2 Specificity MAX MIN The Primerdesign
More informationRelative Rat Telomere Length Quantification qpcr Assay Kit (RRTLQ) Catalog #R reactions
Relative Rat Telomere Length Quantification qpcr Assay Kit (RRTLQ) Catalog #R8908 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationEPIGENTEK. EpiQuik Tissue Chromatin Immunoprecipitation Kit. Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Tissue Chromatin Immunoprecipitation Kit Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Tissue Chromatin Immunoprecipitation Kit is suitable for combining the specificity
More informationab JC-10 Mitochondrial Membrane Potential Assay Kit Flow Cytometry
ab112133 JC-10 Mitochondrial Membrane Potential Assay Kit Flow Instructions for Use For detecting mitochondrial membrane potential changes in cells using our proprietary fluorescence probe. This product
More informationUses: The Methylamp MS-qPCR Fast Kit is very suitable for quantitative methylation-specific PCR in a fast format using very minute amounts of DNA.
Methylamp MS-qPCR Fast Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The Methylamp MS-qPCR Fast Kit is very suitable for quantitative methylation-specific PCR in a fast format
More informationMycoplasma bovis. genesig Standard Kit. DNA gyrase subunit B (gyrb) gene. 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Mycoplasma bovis DNA gyrase subunit B (gyrb) gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Mycoplasma bovis Mycoplasmas are small,
More informationTHUNDERBIRD SYBR qpcr Mix
Instruction manual THUNDERBIRD SYBR qpcr Mix 1304 A4251K THUNDERBIRD SYBR qpcr Mix QPS-201T 1 ml x 1 QPS-201 1.67 ml x 3 Contents [1] Introduction [2] Components [3] Primer design [4] Template DNA [5]
More informationCytoSelect 96-Well Cell Transformation Assay (Cell Recovery Compatible, Fluorometric)
Product Manual CytoSelect 96-Well Cell Transformation Assay (Cell Recovery Compatible, Fluorometric) Catalog Number CBA-140 CBA-140-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic
More informationData Sheet. TGFβ/SMAD Signaling Pathway SBE Reporter HEK293 Cell Line Catalog #: 60653
Data Sheet TGFβ/SMAD Signaling Pathway SBE Reporter HEK293 Cell Line Catalog #: 60653 Background The SBE Reporter HEK293 Cell Line is designed for monitoring the activity of the TGFβ/SMAD signaling pathway.
More informationPhospholipase D Assay Kit
Phospholipase D Assay Kit Catalog Number KA1636 100 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of the
More information2X Q-PCR Master Mix 1 ml x 2 (SYBR, ROX) Storage Aliquot to avoid multiple freeze-thaw cycles Protect from light -20 C for 12 months
www.smobio.com Product Information ExcelTaq series 2X Q-PCR Master Mix (SYBR, ROX) TQ1110 200 RXN 2X Q-PCR Master Mix 1 ml x 2 (SYBR, ROX) Storage Aliquot to avoid multiple freeze-thaw cycles Protect from
More informationData Sheet. camp/pka Signaling Pathway CRE/CREB Reporter (Luc) HEK293 Cell Line Catalog #: 60515
Data Sheet camp/pka Signaling Pathway CRE/CREB Reporter (Luc) HEK293 Cell Line Catalog #: 60515 Background The camp/pka Signaling Pathway CRE/CREB Reporter (Luc) HEK293 Cell Line is designed for monitoring
More informationMaize Chlorotic Mottle Virus
TM Primerdesign Ltd Maize Chlorotic Mottle Virus Coat Protein Gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Maize Chlorotic Mottle Virus Maize chlorotic
More informationMiniaturized Quantitative PCR in a 1536-well Format Using the Echo Liquid Handler
TM Application Note G101 Echo Liquid Handler Miniaturized Quantitative PCR in a 1536-well Format Using the Echo Liquid Handler Celeste Glazer, Sammy Datwani Labcyte Inc. Abstract Miniaturizing quantitative
More informationCell-Free Protein Expression Kit
Cell-Free Protein Expression Kit Handbook Version v.01, January 2018 Cat# 507024 (Sigma 70 Master Mix Kit, 24 Rxns) Cat# 507096 (Sigma 70 Master Mix Kit, 96 Rxns) Please refer to this product in your publication
More informationPistacia vera. Introduction to Pistacia vera. 100 tests. Techne qpcr test. For general laboratory and research use only
Techne qpcr test Pistacia vera 100 tests For general laboratory and research use only Introduction to Pistacia vera 1 2 Specificity The Techne Kit for Pistacia vera (P.vera) genomes is designed for the
More informationFLIPR Calcium 6 Assay Explorer Kit (R8190) FLIPR Calcium 6-QF Assay Explorer Kit (R8192)
FLIPR Calcium 6 Assay Explorer Kit (R8190) FLIPR Calcium 6-QF Assay Explorer Kit (R8192) About the FLIPR Calcium 6 and 6-QF Assay Kits The FLIPR Calcium 6 Assay Kits from Molecular Devices, LLC (hereafter
More informationAbsolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M reactions
Absolute Mouse Telomere Length Quantification qpcr Assay Kit (AMTLQ) Catalog #M8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationRapidFinder TM Goat ID Kit
RapidFinder TM Goat ID Kit IMG-175 For testing of Food and Environmental samples only. The information in this guide is subject to change without notice. DISCLAIMER LIFE TECHNOLOGIES CORPORATION A/OR ITS
More informationLacombe et al. Supplemental material ms INS-BR-TR-2
Supplemental Figure 1: Rabbit α-gla antibodies specifically recognize carboxylated VKD proteins. (A) HEK293 cells were transfected with plasmids encoding GGCX-FLAG, PT- FLAG or tagged proline rich Gla
More informationMouse Laminin ELISA Kit (mlaminin-elisa)
Mouse Laminin ELISA Kit (mlaminin-elisa) Cat. No. EK0436 96 Tests in 8 x 12 divisible strips Background Laminin is a large basement membrane glycoprotein composed of three subunits designated the A, B1,
More informationFluo-4 NW Calcium Assay Kits (F36205, F36206)
Product Information Revised: 20 October 2006 Fluo-4 NW Calcium Assay Kits (F36205, F36206) F36205 Fluo-4 NW Calcium Assay Kit (high-throughput) *for 100 microplates* F36206 Fluo-4 NW Calcium Assay Kit
More informationTechne qpcr test. A graveolens. NADPH-dependent mannose 6- phosphate reductase (m6pr) 100 tests
Techne qpcr test A graveolens NADPH-dependent mannose 6- phosphate reductase (m6pr) 100 tests For general laboratory and research use only Introduction to A graveolens 1 2 Specificity The Techne Kit for
More informationColor-Switch CRE recombinase stable cell line
Color-Switch CRE recombinase stable cell line Catalog Number Product Name / Description Amount SC018-Bsd CRE reporter cell line (Bsd): HEK293-loxP-GFP- RFP (Bsd). RFP" cassette with blasticidin antibiotic
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationCIPA - Replacing the TQT with Non-clinical Proarrhythmia Testing: A New Paradigm
CIPA - Replacing the TQT with Non-clinical Proarrhythmia Testing: A New Paradigm Current status, opportunities, and challenges Hugo M. Vargas, PhD, DSP Scientific Director Safety & Exploratory Pharmacology
More informationFor focused group profiling of human electron transport toxicology genes expression
Product Data Sheet ExProfile TM Human Electron Transport Toxicology Related Gene qpcr Array For focused group profiling of human electron transport toxicology genes expression Cat. No. QG014-A (1 x 96-well
More informationFor focused group profiling of human inflammatory response and autoimmunity related gene expression
GeneCopoeia TM Expressway to Discovery Product Data Sheet ExProfile TM Human Inflammatory Response and Autoimmunity Related Gene qpcr Array For focused group profiling of human inflammatory response and
More informationStaphylococcus epidermidis
TM Primerdesign Ltd Staphylococcus epidermidis superoxide dismutase (soda) gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Staphylococcus epidermidis
More informationFor focused group profiling of human cytokine receptor-related gene expression
GeneCopoeia TM Expressway to Discovery Product Data Sheet ExProfile TM Human Cytokine Receptor Related Gene qpcr Array For focused group profiling of human cytokine receptor-related gene expression Cat.
More informationProduct Manual. RFP ELISA Kit. Catalog Number. FOR RESEARCH USE ONLY Not for use in diagnostic procedures
Product Manual RFP ELISA Kit Catalog Number AKR-122 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Red fluorescent protein (DsRed) is a spontaneously fluorescent protein
More informationEpstein Barr Virus (Human Herpes virus 4)
TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to
More informationEpiQuik Tissue Methyl-CpG Binding Domain Protein 2 ChIP Kit
EpiQuik Tissue Methyl-CpG Binding Domain Protein 2 ChIP Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Tissue Methyl-CpG Binding Domain Protein 2 ChIP Kit is suitable for
More informationFor research use only. Not for use in diagnostic procedures.
INSTRUCTIONS Human vwf ELISA Kit EHVWF Number EHVWF Description Human vwf ELISA Kit, sufficient reagents for 96 determinations Kit Contents Size Anti-Human vwf Precoated 96-well Strip Plate 1 each Lyophilized
More information