SUPPLEMENTARY INFORMATION
|
|
|
- Allison Walsh
- 6 years ago
- Views:
Transcription
1 doi:.38/nture965 footprinting deep-sequencing Supplementry Figure. Schemtic of riosome profiling experiment for quntifiction of riosome occupncy long mrna. The protocol for cteril riosome profiling with flsh freezing ws descried in detil y Oh et l. 5. Polysome-contining cell lyste ws treted with micrococcl nuclese to generte riosome-protected mrna frgments. The mrna frgments were converted into sequencele DNA lirry. Regions of mrna tht hve higher riosome occupncy give rise to more sequenced frgments.
2 RESEARCH SUPPLEMENTARY INFORMATION 3S 5S 7S polysomes 4 Micrococcl nuclese concentrtion (U/A26) A26 (AU) Amount footprint (AU) Micrococcl nuclese concentrtion (U/A26) c Supplementry Figure 2. Polysome profiles t different stges of riosome footprinting for E. coli., Polysome profile of flsh frozen nd pulverized cell lyste. 77% of totl RNA ws in ssemled riosomes (shded re), of which 87% ws in the polysome frction., Polysome profile fter tretment with micrococcl nuclese t 25 o C for one hour. The mount of RNA in the ssemled riosome (shded re) ws the sme s tht of the undigested lyste, indicting tht ssemled riosomes styed intct during footprinting. Consistent with this oservtion, nuclese protection ssy (inset) showed constnt level of riosome-protected frgment over rnge of micrococcl nuclese concentrtions. The mount of footprint (etween dshed lines) s function of nuclese concentrtion ws plotted. In the riosome profiling experiments we used 6 U of nuclese per A 26 unit of RNA. Nuclese protection ssy ws previously descried y Ingoli et l. 3, using the mirvn mirna detection kit. [α 32 P] UTP leled nti sense proe (gpa gene of E. coli) ws generted using the MAXIscript kit with T7 RNA polymerse. c, Polysome profile fter incution t 25 o C for one hour without micrococcl nuclese. The frction of RNA in the ssemled riosome (shded re) ws gin the sme s tht of the undigested lyste. The rtio of 7S prticles to polysome frctions incresed during the 25 o C incution, which is likely due to rekge of mrna in etween riosomes. 2
3 RESEARCH 5 Numer of sequencing reds in replicte # r = Numer of sequencing reds in replicte # 5 Numer of sequencing reds in smple digested with 3 U MNse/A r = Numer of sequencing reds in smple digested with 6 U MNse/A26 Supplementry Figure 3. Reproduciility of cteril riosome profiling., Reproduciility mong iologicl replictes. Ech dot corresponds to the numer of sequencing reds mpped to prticulr position on mrna in riosome profiling experiments from two seprte cultures of E. coli. The Person correltion coefficient is.99., Effect of micrococcl nuclese (MNse) concentrtion. Lyste of B. sutilis ws treted with either 6 U or 3 U of MNse per A 26 unit of RNA, nd the numer of riosome protected frgments t ech position on mrna were compred. The Person correltion coefficient of.98, confirming tht nuclese digestion introduces negligile is t the working concentrtion of MNse. In ddition, the correltion etween Shine-Dlgrno-like sequences nd pusing ws unffected y the 2-fold chnge in the mount of MNse. 3
4 RESEARCH SUPPLEMENTARY INFORMATION 8 7 B. sutilis E. coli Averge occupncy Distnce from puse (nt) Supplementry Figure 4. Averge riosome density efore nd fter trnsltionl pusing sites. Puses with riosome occupncy t 5-fold greter thn the men were ligned t position. The riosome occupncy surrounding puse ws normlized y the men occupncy of the messge, nd verged over ll pusing sites. There is no loss of riosome density immeditely efore nd fter puses, indicting tht trnsltion within coding sequences is continuous process with negligile internl initition nd erly termintion t the pusing sites. Furthermore, this oservtion lso rgues tht there is negligile riosome movement fter cells were flsh frozen, which would led to depletion of riosome density fter pusing sites. rndomly frgmented mrna smple Occurrence (AU) riosome-protected mrna frgments log-2 fold enrichment reltive to the medin Supplementry Figure 5. Vrition of riosome occupncy nd rndomly frgmented mrna smple for E. coli. Riosome footprints (lue) nd rndomly frgmented mrna (green) were converted to sequencele DNA lirries using the sme protocol. The frequency of sequencing reds t ech codon on ech messge ws normlized to the medin frequency of the messge. Histogrms of log 2 enrichment reltive to the medin were plotted for codons in the genes tht hve t lest sequencing reds per codon on verge. Riosome occupncy exhiited greter vritions thn tht introduced during the conversion of RNA frgments into sequencele DNA lirry. 4
5 RESEARCH Riosome occupncy (AU).5 mifm Riosome occupncy (AU).5 tnc genome position Supplementry Figure 6. Riosome occupncy profile of genes with trnsltionl stlling sites., The mifm gene in B. sutilis., The tnc gene in E. coli. The rrows point t the position of known stlling sites. In tnc we oserved second riosome queuing ~3 nt upstrem the known stlling site. The presence of this second riosome immeditely efore the stlling site would e difficult to detect using conventionl ssys sed on primer extension. It is plusile tht triling riosome is queuing ehind the riosome tht is stlled downstrem. 5
6 RESEARCH SUPPLEMENTARY INFORMATION 2. Riosome occupncy (AU) trna undnce (AU) 2. Riosome occupncy (AU) Codon usge (AU) Supplementry Figure 7. Averge riosome occupncy of codons., Riosome occupncy reltive to the corresponding trna undnce in B. sutilis. Similr to Fig. c nd d, verge riosome occupncy of ech codon reltive to their respective trna undnce is plotted. Codons with undetermined trna undnce were not included. The codon-specific riosome occupncy ws uncorrelted with the trna undnce., Riosome occupncy reltive to codon usge in E. coli. The codon usge ws clculted from group of 32 highly expression genes tht hve t lest 5 sequencing reds per codon on verge in the dtset. The verge riosome occupncy ws clculted from 2,255 genes with t lest sequencing reds per codon. 6
7 RESEARCH.8 E. coli < -4 kcl/mol.8 E. coli < -5 kcl/mol - - Cumultive proility of SD-like sequences c B. sutilis < -4 kcl/mol d.8 B. sutilis < -5 kcl/mol Distnce from pusing sites (nt) Supplementry Figure 8. Frction of puses ssocited with SD-like sequences. Cumultive proility of hving SD-like sequences either upstrem (-) or downstrem (+) from pusing sites ws plotted ginst the distnce from the pusing sites in E. coli ( nd ) nd in B. sutilis (c nd d). The cumultive proility is the proility of hving t lest one SD-like sequence within certin distnce from the pusing site. SD-like sequences were defined s hexmer sequences with ffinity to SD < -4 kcl/mol ( nd c) or < -5 kcl/mol ( nd d). Pusing sites with riosome occupncy greter thn -fold of the men (~ 2 puses/gene) were included in this nlysis. ~7% of the puses were ssocited with SD-like sequences upstrem (shded). 7
8 RESEARCH SUPPLEMENTARY INFORMATION Occurrence in rrna nd trna (AU) Affinity to nti-sd (-kcl/mol) 8 Occurrence Enrichment Supplementry Figure 9. Occurrence of SD-like sequences., The occurrence of hexmer sequences in rrna nd trna reltive to the ffinity to nti-sd in E. coli. The ornge line shows the verge occurrence within in size of.5 kcl/mol. Unlike hexmers in protein coding sequences, strong SD-like hexmers were not voided., Histogrm of enrichment of internl SD-like sequences in the mrna of 533 cteril species in the AMPHORA 35 dtse. The enrichment level of ech species ws clculted sed on its GC content. SD-like hexmers (with predicted hyridiztion energy < -7 kcl/mol) were voided in the mjority of cteril species. The voidnce of SD-like sequences is one of mny forces, including GC is nd muttionl is, tht determine the genome composition. 8
9 RESEARCH over-represented under-represented GlyArg ArgArg TrpGly ArgTrp GlyGlu ArgGly TrpArg GlyTrp Occurrence ArgSer GluAsp GluVl GlyAsp GlySer GluGlu GlyVl GluGly Affinity to nti-sd (-kcl/mol) Supplementry Figure. Disenrichment of codon pirs tht resemle SD sequences in E. coli. We clculted the normlized occurrence of codon pirs (y-xes) nd the enrichment reltive to single codon usge (color coded) for 6 pirs of mino cids tht cn e coded with SD sites (< -6 kcl/mol). The occurrence ws normlized within ech group of codon pirs encoding the sme pirs of mino cids. Similr to Gly-Gly pirs, strong SD-like codon pirs pper less often thn wht is expected from the single codon usge. 9
10 RESEARCH SUPPLEMENTARY INFORMATION over-represented under-represented.5 GGCGGC Normlized occurrence..5. GGCGGA GGCGGU GGCGGG GGUGGU GGUGGC GGUGGA GGUGGG GGGGGC GGGGGA GGGGGU GGAGGC GGAGGA GGAGGU GGGGGG GGAGGG Affinity to nti-sd (-kcl/mol) Supplementry Figure. Occurrence of GGNGGN sequences tht re not ligned to Gly-Gly pirs in E. coli protein coding sequences. The occurrence of GGNGGN tht does not encode two glycine codons were plotted ginst the ffinity to the nti-sd site. The colour coding represents the enrichment in occurrence fter correcting for the usge of single trinucleotide sequence. The fct tht the sme trend exists regrdless of reding frme informtion supports the notion tht the preference of codon pirs stems from properties of the sequence, rther thn properties of the codon or the trna. Correltion. sheet helix turn Distnce to A site (nt). Correltion sheet helix turn Distnce to SD-like sequences (nt) Supplementry Figure 2. Correspondence of protein structure nd riosome pusing., Correltion etween protein secondry structures nd riosome occupncy profiles. Trnsltionl puses were over-represented in plces where the newly synthesized polypeptides correspond to turns in protein., Correltion etween protein secondry structures nd SD-like sequences. SD-like sequences re lso over-represented in regions encoding protein turns. The puse sites, including t most Gly-Gly residues, re over-represented in protein turns nd unstructured regions. Therefore pusing could potentilly fcilitte independent folding of djcent structurl motifs. An importnt cvet is tht pusing t SD sites occurs when the mino cid residues trnslted from SD sites, such s Gly-Gly, re still within the riosome exit tunnel. Whether the structured region would e outside the exit tunnel therefore needs to e determined on cse-y-cse level.
11 RESEARCH Riosome occupncy trpl Affinity to SD Riosome occupncy Affinity to SD thrl c Riosome occupncy Affinity to SD leul d Riosome occupncy ivl Affinity to SD Supplementry Figure 3. Riosome pusing ner the end of leder peptide sequences of mino cid iosynthesis operons. Riosome density is low t the eginning of leder sequences nd high ner the end. Slow trnsltion ner the stop codon my provide dditionl protection for the structurl mrna elements to promote trnscription termintion.
1. Supplementary Figures and Legends a b
doi:10.1038/nture09540 1. Supplementry Figures nd Legends Supplementry Figure 1. Scnning trnsmission electron microgrphs (STEM) of NCC., STEM prepred from fst evportion of dilute NCC suspension shows individul
SUPPLEMENTARY INFORMATION
SI Fig. PrpS is single copy gene k 3. 9... EcoRV EcoRV k 5 BmH Pst c well k HindIII HindIII HindIII.3.5 3.. Southern lots of Ppver genomic DNA from plnts with SS8 hplotypes, hyridized with PrpS proe..
Interplay between NS3 protease and human La protein---- by Ray and Das Supplementary fig 1. NS3 pro
Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig 1 1 2 3 4 UV crosslinking ssy: α[ 32 P]UTP leled HCV IRES RNA ws UV-crosslinked to incresing concentrtions (0.1, 0.2 nd 0.4µM) in
COS-1 cells transiently transfected with either HA hgr wt, HA hgr S211A or HA hgr S226A
1 SUPPLEMENTRY FIGURES Fig. 1 & Specificity of the nti-p-s211 nd nti-p-s226 ntibodies COS-1 cells trnsiently trnsfected with either H hgr wt, H hgr S211 or H hgr S226 were treted with 1nM Dex for 1 hour.
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture10177 MDYKDHDGDYKDHDIDYKDD DDKMAPKKKRKVGIHGVPAA MAERPFQCRICMRKFAQSGD LTRHTKIHTGEKPFQCRICM RNFSRSDVLSEHIRTHTGEK PFACDICGKKFADRSNRIKH TKIHTGSQKPFQCRICMRNF SRSDNLSEHIRTHTGEKPFA
Fluorescence Intensities of. GFP-PAC-1 Strains
DOI: 10.1038/ncb3168 Arbitrry Fluorescence Units 2500 2000 1500 1000 500 0 full length (1-4) Fluorescence Intensities of GFP-PAC-1 Strins ΔPH 392-838 575-4 GFP-PAC-1 Strins 2-610 1-574 b control c pc-1(3
SUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2885 kd M ΔNZipA 66.4 55.6 ZipA 42.7 34.6 6x His NiNTA 27.0 c 1.,, 2. evnescent field supported memrne Supplementry Figure 1 Experimentl ssy. () Illustrtion of protein interctions (dpted
An insight into itraq: where do we stand now?
Anlyticl nd Bionlyticl Chemistry Electronic Supplementry Mteril An insight into itraq: where do we stnd now? Croline Evns, Josselin Noirel, Sw Yen Ow, Mlind Slim, An G. Pereir-Medrno, Nrciso Couto, Jgroop
Evaluation of Winter Canola Grown in 30 inch Rows
Evlution of Winter Cnol Grown in 3 inch Rows Chd Godsey, Oilseed Cropping Systems Specilist Pst reserch in Oklhom hs indicted tht yield potentil my decrese from to 1% when cnol is grown in 3 inch rows,
Primer in Population Genetics
Primer in Popultion Genetics Hierrchicl Orgniztion of Genetics Diversity Primer in Popultion Genetics Defining Genetic Diversity within Popultions Polymorphism number of loci with > 1 llele Number of lleles
H. Randall Smith; Ph.D. Agronomy and Wayne Porter: Ph.D. Horticulture Mississippi State University Extension Service
Effect of SumGrow on growth, development nd yield of Irish pottoes (Solnum tuerosum) t the Beumont Reserch Sttion (Mississippi Stte University) during 217 H. Rndll Smith; Ph.D. Agronomy nd yne Porter:
nm nm nm nm nm nm. Seed surface. oi-ab. oi-ad. ii-ab. ii-ad/endothelium. endosperm.
B 360-370nm Seed surfce oi- 90-100nm A 630-640nm oi-d ii- ii-d/endothelium 230-240nm 220-230nm 240-280nm 1mm endosperm C oi-d D ii-d/endothelium ii- endosperm Supplementry Figure 1 Cell wll thickness mesurements
WesternBright TM MCF and MCF-IR
WesternBright TM MCF nd MCF-IR Quntittive, multi-color fluorescent Western lotting kits WesternBright MCF visile nd ner infrred (IR) fluorescent Western lotting kits llow the ssy of two proteins t once,
a ATP release 4h after induction
doi:1.138/nture9413 ATP relese 4h fter induction of poptosis (nm) 5 ATP 4 3 2 1 UV UV + zvad 1μM 3μM 5μM UV + 1μM 3μM 5μM UV + 18AGA 1μM 3μM 5μM UV + FFA HeL monolyer Scrpe Dye trnsfer HeL HeL-Cx43 HeL-Cx43
SUPPLEMENTARY INFORMATION
doi:10.1038/nture12040 + + + Glc Gln Supplementry Figure 1., Reltive prolifertion of PDAC cell lines (8988T, Tu8902, Pnc1, Mipc2, PL45 nd MPnc96) nd low pssge primry humn PDAC cell lines (#1 nd #2) under
SUPPLEMENTARY INFORMATION
1 1 μm c d EGF + TPA + e f Intensity 1.8 1.6 1.4 1.2 1.8.6.4.2 2 4 8 2 4 8 (Hours) 2 4 6 8 1 Time (Hours) Reltive luciferse ctivity 4 3 2 1 + CAMEK1 FRE reporter Figure S1 inhiitor incresed protein expression
Best Practices for PCR Assays in Seed Health Tests Version 3.0; June 2018
Best Prctices for PCR Assys in Seed Helth Tests Version 3.0; June 2018 Polymerse Chin Rection (PCR) is currently the most commonly utilized moleculr technique in seed helth testing. This document provides
SUPPLEMENTARY INFORMATION
Memristors with diffusive dynmics s synptic emultors for neuromorphic computing Zhongrui Wng 1, Sumil Joshi 1, Sergey E. Svel ev 2, Ho Jing 1, Rivu Midy 1, Peng Lin 1, Mio Hu 3, Ning Ge 3, John Pul Strchn
Figure S1 Yoo et al.
doi:.38/nture6543 8 8 6 6 4 4 d Protoplsts Leves Reltive promoter ctivity (%) Reltive trnscript level 2 2 88 66 44 22 32 2 2 MKK-MYC MPK ctivity nti-mpk6 c ctr MKK - 4 5 4 5 MKK-MYC MPK3 ctivity MPK6 ctivity
concluded that, for the natural code, single-base substitution in the first position
THE GENETIC CODE AND ERROR TRANSMISSION BY C. ALFF-STEINBERGER LABORATOIRE DE BIOPHYSIQUE DE L' INSTITUT DE BIOLOGIE MOLECULAIRE, UNIVERSITA DE GENhVE, SWITZERLAND Communicted y V. Prelo, July 14, 1969
Report to the Southwest Florida Water Management District. Effects of Microsprinkler Irrigation Coverage on Citrus Performance
Report to the Southwest Florid Wter Mngement District Effects of Microsprinkler Irrigtion Coverge on Citrus Performnce L. R. Prsons University of Florid Institute of Food nd Agriculturl Sciences Citrus
Supplemental Figure S1
Supplementl Figure S1 TG nrt1.5- Li et l., 1 nrt1.5- Lin et l., 8 F L CTGCCT R T 5'UTR 3'UTR 1 3 81p (k) nrt1.5- C nrt1.5- Supplementl Figure S1. Phenotypes of the T-DN insertion mutnts (this pper), nrt1.5-
Food Arthropod Abundance Associated with Rest-Rotation Livestock Grazing. Hayes B. Goosey. Department of Animal and Range Sciences
Food Arthropod Aundnce Associted with Rest-Rottion Livestock Grzing Hyes B. Goosey Deprtment of Animl nd Rnge Sciences Montn Stte University We hve completed the second seson of investigtion into the response
Topic 7. Acids, Bases, Buffers, Titrations, Polyprotic acids
Topic 7 cids, Bses, Buffers, Titrtions, Polyprotic cids Conjugte cids & bses Strengths of cids & bses strong cid or strong bse is completely dissocited in queous solution. Wek cids nd Wek Bses Crboxylic
SUPPLEMENTARY INFORMATION
doi:10.1038/nture09470 prmt5-1 prmt5-2 Premture Stop Codon () GGA TGA PRMT5 Hypocotyl Length (Reltive to Drk) 0.5 0.3 0.1 ** 30 *** c prmt5-1 d ** *** 150 prmt5-2 ** *** 28 100 26 24 50 prmt5-1 prmt5-2
A Little More Advanced Biotechnology Tools. Engineered plasmids. Selection for plasmid uptake. Better Plasmids. Antibiotic becomes a selecting agent
A Little More Advnced Biotechnology Tools Better Plsmids Engineered plsmids Building custom plsmids restriction enzyme sites ntibiotic resistnce genes s selectble mrker EcoRI BmHI HindIII restriction sites
CORRELATION BETWEEN MELT POOL TEMPERATURE AND CLAD FORMATION IN PULSED AND CONTINUOUS WAVE ND:YAG LASER CLADDING OF STELLITE 6
Proceedings of the st Pcific Interntionl Conference on Appliction of sers nd Optics 4 CORREATION BETWEEN ET POO TEPERATURE AN CA FORATION IN PUSE AN CONTINUOUS WAVE N:YAG
SUPPLEMENTARY INFORMATION
doi:10.1038/nture10970 I. GN directly grown on the h-bn relese lyer Figure S1 shows X-ry diffrction with the 2θ/ω configurtion nd n opticl microscopy imge for the GN directly grown on the h-bn relese lyer.
Supplementary Figure 1. Zhang et al.
Supplementry Figure 1. Zhng et l. T30-SurA: GGCAGTTTCATCATGAATGTGCAGGAGCTTGCAACAATTAAGGTGGAGAATCTCCC T30-SurB: GGCAGTTTCATCATGAATGTGCAGGAGCTAGCAACTATTAAGGTGGAGAATCTCCC T41-SurA: ACTGAATAATCAACACTTGGGAATGGTGGTTCAATGGGAGGATCGGTTCTAT
SUPPLEMENTARY INFORMATION
NCS (ng/ml) Time (min) kd 500 500 0 30 0 30 IP: IP: 112 105 75 IB: ps407 IB: Mdm2 NCS + + IB: IB: tuulin IP input sup NCS (ng/ml) 50 100 500 Time (min) 0 15 30 60 120 15 30 60 120 15 30 60 120 IB: ps407
SUPPLEMENTARY INFORMATION
BRC repet RPA DSB RAD52 DSB Repir doi:1.138/nture9399 Gp Repir ssdna/dsdna junction ssdna/dsdna junction RPA Binding Resection RPA Binding Filment Formtion or or Filment Formtion DNA Piring DNA Piring
Expression profiling using a hexamer-based universal microarray
Expression profiling using hexmer-sed universl microrry Mtthew E Roth 1,Li Feng 1,,Kevin J McConnell 1,,Pul J Schffer 1,,Cesr E Guerr 1,, Json P Affourtit 1,,Kevin R Piper 1,Lorri Guccione 1,Jyshree Hrihrn
The Effect of Nitrogen Fertilizers (Urea, Sulfur Coated Urea) with Manure on the Saffron Yield
The Effect of Nitrogen Fertilizers (Ure, Sulfur Coted Ure) with Mnure on the Sffron Yield Seed Rezin nd Mjid Forouhr Soil nd Wter Deprtment griculturl Reserch Center of Khorsn Mshhd, Torough Sttion, 91735
Lineage-specific functions of Bcl6 in immunity and inflammation are mediated through distinct biochemical mechanisms
Supplementry informtion for: Linege-specific functions of Bcl6 in immunity nd inflmmtion re medited through distinct iochemicl mechnisms Chunxin Hung, Kterin Htzi & Ari Melnick Division of Hemtology nd
What do genes code for?
From ene to Protein How enes Work 2007-2008 Wht do genes code for? How does code for cells & bodies? how re cells nd bodies mde from the instructions in proteins cells bodies he entrl Dogm Flow of genetic
The Effect of SFAS No. 131 on the Diversification Discount
The Effect of SFAS No. 131 on the Diversifiction Discount Seoungpil Ahn Sogng Business School, Sogng University PA706, 35 Bekbeom-ro, Mpo-gu, Seoul 121-742, Kore E-mil: sphn@sogng.c.kr Received: July 2,
a b c Nature Neuroscience: doi: /nn.3632
c Supplementry Figure 1. The reltion etween stndrd devition (STD) nd men of inter-press intervls (IPIs) under different schedules. -c, Disproportionlly fster decrese of the stndrd devition compred to the
SUPPLEMENTARY INFORMATION
DOI: 1.138/nc2274 EpH4 Prentl -/MDCK EpH4 Prentl -/MDCK - FERM- Figure S1 (kd) delferm- (1-438)- c Prentl MDCK -/MDCK deljfr- Input Control IP IP Input Control IP IP d Control Control Figure S1 () Specificity
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11303 c Supplementry Figure 1: Genertion of INCB18424 persistent B/F3 Epor- V617F (EporVF) cells, which re cross resistnt to other inhiitors. : () Nïve EporVF
[ HOCl] Chapter 16. Problem. Equilibria in Solutions of Weak Acids. Equilibria in Solutions of Weak Acids
![[ HOCl] Chapter 16. Problem. Equilibria in Solutions of Weak Acids. Equilibria in Solutions of Weak Acids](/thumbs/72/67425582.jpg "[ HOCl] Chapter 16. Problem. Equilibria in Solutions of Weak Acids. Equilibria in Solutions of Weak Acids")
Equilibri in Solutions of Wek Acids Chpter 16 Acid-Bse Equilibri Dr. Peter Wrburton peterw@mun.c http://www.chem.mun.c/zcourses/1011.php The dissocition of wek cid is n equilibrium sitution with n equilibrium
Organic Cover Crop Research at WSU Puyallup
Orgnic Cover Crop Reserch t WSU Puyllup Ferury 8 Crig Cogger, Andy Bry, nd Liz Myhre Wshington Stte University Puyllup Reserch nd Extension Center Astrct: Cover crops re loclly grown source of orgnic mtter
recessive lozenge-shaped-fly-eye "alleles" in trans: recessive lozenge-shaped-fly-eye "alleles" in trans:
Wht do we men (wht hve we ment) y " gene": Reding for lectures 15-17 (We F27, Fr F29, We M5) Chp 8: from 258 (Nonoverlpping...) to 261 ( Crcking) & from 285 (8.6) to 293 (end of "essentil concepts) Chp
Tetrad analysis. Life cycle and meiosis in yeast. Fig.1. Life cycle of yeast
Tetrd nysis Tetrd nysis in genetics refers to nysis of four products formed from meiosis. In orgnisms like yest the tetrd contins four spores while in cse of Neurospor the scus in which products of meiosis
The Role of Ambrosia and Bark Beetles in Sudden Oak Death
The Role of Amrosi nd Brk Beetles in Sudden Ok Deth Brice A McPherson 1 Dvid L. Wood 1 Ndir Erilgin 1 Pvel Svihr 2 Andrew J. Storer 3 Richrd B. Stndiford 1 1 University of Cliforni Berkeley 2 University
SUPPLEMENTARY INFORMATION
% chnge in ody mss. -.. Smll intestinl mss (g) -1. -. -. Villi length in proximl jejunum (µm) 1 # of crypts/ mm of jejunum g Proximl jejunum # of enterocytes in jejunl villi 1 1 e. -. d Smll intestinl
Nonlinear Mixed Effects Model for Swine Growth
Nonliner Mixed Effects Model for Swine Growth A. P. Schinckel nd B. A. Crig Deprtment of Animl Sciences nd Deprtment of Sttistics, Purdue University Introduction Severl nonliner growth functions model
Mob Grazing Research - University of Nebraska-Lincoln. Jerry Volesky, Walt Schacht, Miles Redden, Jordan Johnson, and Ben Beckman
Mo Grzing Reserch - University of Nersk-Lincoln Jerry Volesky, Wlt Schcht, Miles Redden, Jordn Johnson, nd Ben Beckmn An ongoing reserch project ws initited in 2010 to evlute vrious plnt, soil, nd niml
Chapter 9: Phase Diagrams
hpter 9: Phse Digrms ISSUES TO ADDRESS... oncepts of Phse, omponent, Equilibrium Phse digrm In prticulr, if we specify... -- composition (e.g., wt% u - wt% Ni), nd -- temperture (T) then... How mny phses
What do genes code for? The Central Dogma. From gene to protein DNA. protein. trait RNA. Transcription 1/9/2015. From Gene to Protein.
Wht do genes code for? From ene to rotein How does code for cells & bodies? how re cells nd bodies mde from the instructions in How enes Work s cells bodies he entrl Dogm Flow of genetic informtion in
Supplementary Fig
Supplementry Fig. 1 * 180-115- 82-64- 49-37- * 180-115- 85-64- 49-37- 26-26- Mem Cyt Mem Cyt Supplementry Fig.1 Specificity of nti-tie2 ntiodies. HUVECs were homogenized nd centrifuged t 400 000g to otin
CHAPTER 5 SEISMIC RESERVOIR CHARACTERIZATION.
CHAPTER 5 ISMIC RERVOIR CHARACTERIZATION. ISMIC RERVOIR CHARACTERIZATION Centrl Scotin Slope Study CANADA June 2016 Ojectives: Chrcterize the snd distriution, using the Mrthon nd Verits 3D post-stck seismic
Effect of Transplant Size on Yields and Returns of Bell Peppers. Nathan Howard, Brent Rowell, and John C. Snyder Department of Horticulture
Effect of Trnsplnt Size on Yields nd Returns of Bell Peppers Nthn Howrd, Brent Rowell, nd John C. Snyder Deprtment of Horticulture Introduction Bell peppers hve een mjor vegetle crop for frmers in western
Tree Shelters Fail to Enhance Height Growth of Northern Red Oak in the Upper Peninsula of Michigan. 1
Tree Shelters Fil to Enhnce Height Growth of Northern Red Ok in the Upper Peninsul of Michign. 1 Dougls O. Lntgne, Associte Professor, MSU Deprtment of Forestry nd Rymond Miller, Resident Forester, Upper
SUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2307 c No Jsplkinolide Jsplkinolide MDCK AP2-GFP Trnsferrin Merge BSC1 Trnsferrin fluorescence (.u.) MDCK - Jsplkinolide Jsplkinolide AP2-GFP fluorescence (.u.) Trnsferrin fluorescence (.u.)
SUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2473 AP-2 EEA1 APPL1 EEA1 APPL1 EEA1 APPL1 c d e AP-2 FCHO2 merge f g h i k FCHO1 EFC domin FCHO2 EFC domin 10X 1X 3X 10X 10X 1X 3X 10X FCHO1/FCHO2 _ + + + _ + + + PtdIns(4,5)P 2 S P S P
FAILURE OF PINUS RADIATA VENEER IN TENSION ACROSS THE GRAIN
120 NOTE FAILURE OF PINUS RADIATA VENEER IN TENSION ACROSS THE GRAIN A. MICHELLE CARRINGTON, ROGER B. KEEY, Deprtment of Chemicl nd Process Engineering, University of Cnterbury, Christchurch, New Zelnd
EVALUATION OF STRIP-TILLAGE AND FERTILIZER PLACEMENT IN SOUTHERN IDAHO CORN PRODUCTION. D.Tarkalson and D. Bjorneberg USDA-ARS, Kimberly, ID
EVALUATION OF STRIP-TILLAGE AND FERTILIZER PLACEMENT IN SOUTHERN IDAHO CORN PRODUCTION D.Trklson nd D. Bjorneberg USDA-ARS, Kimberly, ID ABSTRACT Strip tillge (ST) nd ssocited nutrient plcement cn potentilly
From Gene to Protein
From Gene to Protein Protein Synthesis: overview One gene-one enzyme hypothesis (Bedle nd Ttum) One gene-one polypeptide (protein) hypothesis Trnscription: synthesis of RNA under the direction of DNA (mrna)
Supporting Information
Supporting Informtion Time-Resolved Fluorescent Detection of Hg 2+ in Complex Environment y Conjugting Mgnetic Nnoprticles with Triplehelix Moleculr Switch Jing Zheng, Yuhong Nie, Yping Hu, Jishn Li, Yinhui
From Gene to Protein: How Genes Work. AP Biology
From ene to Protein: How enes Work How does single fulty gene result in the drmtic ppernce of n lbino deer nd rcoon? ene expression, the process by which DN directs protein synthesis, includes two stges:
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture10698 Rg1 µmt LPLs CD3 LPLs CD11c hi LPLs CD3 splenocytes CD19 LPLs CD19 splenocytes 2 Ocontrol J 4 CD11c Supplementry Figure 1 Chrcteriztion of intestinl lmin
Building better lithium-sulfur batteries: from LiNO 3 to solid oxide catalyst
Supplementry Informtion Building etter lithium-sulfur tteries: from LiN to solid oxide ctlyst Ning Ding, Ln Zhou, Chngwei Zhou, Dongsheng Geng, Jin Yng, Sheu Wei Chien, Zholin Liu, Mn-Fi Ng, Aishui Yu,
Chapter 9. Mapping and characterizing whole genomes. Structural Genomics Functional genomics
Chpter 9 Mpping nd chrcterizing whole genomes Structurl Genomics Functionl genomics How mny genes hs humn? 5,500 27,000 Interprettion of genomic informtion: high throughput technologies re used to get
1 Information, Persuasion, and Signalling
ECON 312: Advertising 1 We will now exmine nother strtegic vrible vilble to firms, tht of dvertising. Industril Orgniztion Advertising 1 Informtion, Persusion, nd Signlling 1.1 Persusion versus Informtion
Economic Profitability and Sustainability of Canola Production Systems in Western Canada
Economic Profitility nd Sustinility of Cnol Production Systems in Western Cnd Elwin Smith, R. Blckshw, Agriculture nd Agri-Food Cnd (AAFC), Lethridge, AB, N. Hrker, J. O'Donovn, AAFC Lcome AB, S. Brndt,
Conservation Tillage Strategies For Corn, Sorghum And Cotton
(93%) cotton nd percent lint ws similr in oth pickers. The 15-inch row system with 27 plnts/a gve higher lint yield (1491 l/a) compred to 4-inch row cotton with 5 plnts/a (136 l/a). Plnt cnopy closed 3
Supplementary Information
Supplementry Informtion Polypurine reverse-hoogsteen (PPRH) oligonucleotides cn form triplexes with their trget sequences even under conditions where they fold into G-qudruplexes. Ann Solé, Emmnuelle Delgoutte,
Observing Patterns in Inherited Traits. Chapter 10
Observing Ptterns in Inherited Trits Chpter 10 10.1 Mendel, Pe Plnts, nd Inheritnce Ptterns By experimenting with pe plnts, Mendel ws the first to gther evidence of ptterns by which prents trnsmit genes
Three-Phase Wound-Rotor Induction Machine with Rotor Resistance
Exercise 2 Three-Phse Wound-Rotor Induction Mchine with Rotor Resistnce EXERCISE OBJECTIVE When you hve completed this exercise, you will know the effects of vrying the rotor resistnce of three-phse wound-rotor
Profiling of engineering hotspots identifies an allosteric CRISPR-Cas9 switch
Supplementl Dt for: Profiling of engineering hotspots identifies n llosteric CRISPRCs9 switch Benjmin L. Okes 1, Dn C. Ndler 1, Avi Flmholz 1, Christof Fellmnn 1, Brett T. Sthl 1, Jennifer A. Doudn 15
STATUS OF LAND-BASED WIND ENERGY DEVELOPMENT IN GERMANY
First Hlf STATUS OF LAND-BASED WIND ENERGY On behlf of: Deutsche WindGurd GmbH - Oldenburger Strße 65-26316 Vrel - Germny +49 (4451)/95150 - info@windgurd.de - www.windgurd.com Cumultive Development First
Crystal Structure. Dragica Vasileska and Gerhard Klimeck
Crystl Structure Drgic Vsilesk nd Gerhrd Klimeck Crystl Structure Issues tht re ddressed in this lecture include:. Periodic rry of toms. Fundmentl types of lttices 3. Index system for crystl plnes 4. Simple
SUPPLEMENTARY INFORMATION
Supplementry Figures nd Legends S1 Figure S1. Trgeted FRET sensors of Auror B kinse ctvity., Imges of cells expressing the untrgeted (i), centromere trgeted (ii), or chromtin-trgeted sensors (iii) in mitosis.
Supplemental Data. Antosz et al. Plant Cell (2017) /tpc SPT6/SPT6L. genomic DNA ACT2 +RT -RT +RT -RT
A B C SPT6/SPT6L genomic DNA ACT2 +RT -RT Col- seedlings +RT -RT PSB-D cells Supplementl Figure 1. Expression of SPT6L nd SPT6. (Supports Figure 1.) Trnscript levels of of SPT6L (At1g6544) nd SPT6 (At1g6321)
Effect of Separation and Grinding of Corn Dry-Milled Streams on Physical Properties of Single-Screw Low-Speed Extruded Products 1
Effect of Seprtion nd Grinding of Corn Dry-Milled Strems on Physicl Properties of Single-Screw Low-Speed Extruded Products 1 Fen F. Jmin 2 nd Rolndo A. Flores 3 ABSTRACT Cerel Chem. 75(6):775 779 Three
NOTICE CONCERNING COPYRIGHT RESTRICTIONS
NOTICE CONCERNING COPYRIGHT RESTRICTIONS This document my contin copyrighted mterils. These mterils hve been mde vilble for use in reserch, teching, nd privte study, but my not be used for ny commercil
Name Period Date. Grade 7 Unit 1 Assessment. 1. The number line below shows the high temperature in Newark, in degrees Fahrenheit, on Monday.
Nme Period Dte Grde 7 Unit 1 Assessment For multiple choice questions, circle the est nswer. For ll other questions, respond in the spce provided. 1. The numer line elow shows the high temperture in Newrk,
Crop Performance and Plant Microbe-Interactions are Affected by the Sequence and Frequency of Pulse Crops in the Canadian Prairie
Crop Performnce nd Plnt Microbe-Interctions re Affected by the Sequence nd Frequency of Pulse Crops in the Cndin Pririe Nvrro-Borrell A 1,2 ; Di M 2 ; Hmel C 1,2 ; Fernndez MR 2 ; Gn Y 2 ; Germid J 1.
chromosome Ill: evolution of chromosome primary
QD-l 1993 Oxford University Press Nucleic Acids Reserch, 1993, Vol. 21, No. 2 179-183 Regionl se composition vrition long yest chromosome Ill: evolution of chromosome primry structure Pul M.Shrp nd Andrew
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture99 Supplementry Tle : Primers nd proes. Sequences re written in 5 - direction. Vector construction cirs-7 forwrd cirs-7 reverse cirs-7ir forwrd cirs-7ir reverse cirs-7fs
Western Illinois University- School of Agriculture Organic Research Program 2013 Dry Humate/Fertility Studies Dr. Joel Gruver and Andy Clayton
Western Illinois University- School of Agriculture Orgnic Reserch Progrm 0 Dry Humte/Fertility Studies Dr. Joel Gruver nd Andy Clyton Introduction Orgnic grin frmers generlly use less purchsed inputs thn
phenylalanine alanine
END F UNIT TET ENGINEERING PRTEIN TET 60 mrks (1 hour) A copy of the EP Informtion heet is required for this test, together with the spectroscopic dt (n.m.r.) from Tble 23 in the Dt heets. 1 nylketonuri
Chickpeas Respond Well To Inoculation With TagTeam
Chickpes Respond Well To Inocultion With TgTem S.M. Phelps, nd E. Hgele Philom Bios Inc., 318-111 Reserch Drive, Ssktoon, SK S7N 3R2 Abstrct Rhizobi strins were tested in TgTem pet nd grnule formultions
A genetic signature of interspecies variations in gene expression
6 Nture Pulishing Group http://www.nture.com/nturegenetics A genetic signture of interspecies vritions in gene expression Ity Tirosh 1,3, Adin Weinerger 1,3, Miri Crmi 1 & Nm Brki 1, Phenotypic diversity
Effect of Tantalum Additions to a Cobalt-Chromium-Nickel
Effect of Tntlum Additions to Coblt-Chromium-Nickel Bse Alloy A. P. ROWE, W. C. BIGELOW, nd K. ASGAR University of Michign, School of Dentistry, Ann Arbor, Michign 48104, USA An investigtion by electron
Microelectronic Engineering
Microelectronic ngineering 88 () 623 627 Contents lists ville t ScienceDirect Microelectronic ngineering journl homepge: www.elsevier.com/locte/mee Mechnicl properties nd frcture mechnism of porous SiOC
Rbfox3 controls the biogenesis of a subset of micrornas
controls the iogenesis of suset of micrornas Kee K Kim 1, Ynqin Yng 2, Jun Zhu 2, Roert S Adelstein 1 & Schiyo Kwmoto 1 RNA-inding proteins (RBPs) regulte numerous spects of gene expression; thus, identifiction
6.1 Damage Tolerance Analysis Procedure
6. Dmge Tolernce Anlysis Procedure For intct structure the nlysis procedures for Slow Crck Growth nd Fil Sfe structure re essentilly the sme. An initil flw is ssumed nd its growth is nlyzed until filure
SEEDING CLOVERS OR GRASSES INTO OLDER ALFALFA BENEFITS AND HAZARDS ABSTRACT INTRODUCTION
SEEDING CLOVERS OR GRASSES INTO OLDER ALFALFA BENEFITS AND HAZARDS STANDS- Mick Cnevri1, Dn Putnm2, Brbr Reed3, Rchel Long4, Steve Orlo~, Tom Lnini6, nd Lrry Godfrey7 ABSTRACT Deciding wht to do with n
Temperature-dependent changes in the soil bacterial community in limed and unlimed soil
FEMS Microiology Ecology 4 (23) 13^21 www.fems-microiology.org Temperture-dependent chnges in the soil cteril community in limed nd unlimed soil Astrct Mrie Pettersson, Erlnd Bfifith Deprtment of Microil
Chandoga M., Jaroševič A., Sedlák J., Sedlák E. 3rd fib International Congress
Chndog M., Jroševič A., Sedlák J., Sedlák E. 3rd fib Interntionl Congress - 2010 EXPERIMENTAL AND IN SITU STUDY OF BRIDGE BEAMS SUPPORTED BY BOTTOM EXTERNAL TENDONS Doc. Ing. Miln Chndog, PhD., Projstr
Identifying regulatory networks by combinatorial analysis of promoter elements
Identifying regultory networks y comintoril nlysis of promoter elements rticle Yitzhk Pilpel 1 *, Priy Sudrsnm 1 * & George M. Church 1 *These uthors contriuted eqully to this work. Pulished online: 10
Identifying regulatory networks by combinatorial analysis of promoter elements
Identifying regultory networks y comintoril nlysis of promoter elements rticle Yitzhk Pilpel 1 *, Priy Sudrsnm 1 * & George M. Church 1 *These uthors contriuted eqully to this work. Pulished online: 10
Nod2-mediated recognition of the microbiota is critical for mucosal adjuvant activity of cholera toxin
Supplementry informtion Nod2-medited recognition of the microiot is criticl for mucosl djuvnt ctivity of choler toxin Donghyun Kim 1,2, Yun-Gi Kim 1,2, Sng-Uk Seo 1,2, Dong-Je Kim 1,2, Nouhiko Kmd 3, Dve
Early life dynamics of the human gut virome and bacterial microbiome in infants
Supplementry Informtion Erly life dynmics of the humn gut virome nd cteril microiome in infnts Efrem S. Lim 1,2, Ynjio Zhou 3,4, Guoyn Zho 1, Irm K. Buer 3, Lindsy Droit 1,2, I. Mlick Ndo 3, Brr B. Wrner
A r t i c l e s. npg 2014 Nature America, Inc. All rights reserved.
Quntittive genome-wide enhncer ctivity mps for five Drosophil species show functionl enhncer conservtion nd turnover during cis-regultory evolution Cosms D Arnold 1,5, Dniel Gerlch 1,4,5, Dniel Spies 1,
COMBUSTION SYNTHESIS OF SILICON NITRIDE / SILICON CARBIDE COMPOSITE MATERIALS
Proceedings of the South Dkot Acdemy of Science, Vol. 82 (23) 89 COMBUSTION SYNTHESIS OF SILICON NITRIDE / SILICON CARBIDE COMPOSITE MATERIALS Bert Lieig, Griel Bosk, Dnielle Smith nd Jn A. Puszynski Deprtment
THERMODYNAMICS OF As, Sb AND Bi DISTRIBUTION DURING REVERB FURNACE SMELTING
Journl of Mining nd Metllurgy, 38 (1 2) B (2002) 93-102 THERMODYNAMICS OF As, Sb AND Bi DISTRIBUTION DURING REVERB FURNACE SMELTING N.Mitevsk* nd @.D.@ivkovi}** *RTB BOR, Copper Institute, 19210 Bor, Yugoslvi
Factors affecting the strength of block-shear specimens
Fctors ffecting the strength of lock-sher specimens E. Arnold Okkonen Bryn H. River Astrct The ASTM D 143 nd D 905 lock-sher tests re commonly used for mesuring the sher strength of solid wood nd dhesivelyonded
Developing Optimal Controlled Atmosphere Conditions for Thompson Seedless Table Grapes
Developing Optiml Controlled Atmosphere Conditions for Thompson Seedless Tle Grpes C.H. Crisosto, D. Grner, nd G. Crisosto Deprtment of Pomology University of Cliforni, Dvis, t Kerney Agriculturl Center