Cannabis microbiome sequencing reveals mycotoxic fungi. Kevin McKernan Courtagen Life Science Medicinal Genomics

Size: px
Start display at page:

Download "Cannabis microbiome sequencing reveals mycotoxic fungi. Kevin McKernan Courtagen Life Science Medicinal Genomics"

Transcription

1

2 Cannabis microbiome sequencing reveals mycotoxic fungi Kevin McKernan Courtagen Life Science Medicinal Genomics

3 Mold and Bacterial qpcr Testing qpcr provides very specific microbial risks in under 24 hours Most Culture bases systems are failing too much material and failing to grow important risks. $8/test Confidential 3

4 Cannabis Microbiomes w/ ITS Sequencing PathogINDICAtor

5 PathoSEEK Reveals Microbiomes qpcr PathogINDICAtor Sequencing Microbiome ID OUT Count

6 R Square In PathoSEEK

7 Majority of microbes don t culture

8 Penicillium Citrinum & Paxilli Confirmation Paxilline Confirm the Paxilline and Citrinin Genes are also present Citrinin

9 Diverse Microbiomes Discovered

10 DNA sequence Doesn t = Expression x ESI Product Ion (3.860 min) Frag=85.0V CID@20.0 ( > **) Paxilline_PIS_LongColumn-01.d Design an LC-MS/MS method to detect this in a flower matrix. Uhlig et al Counts vs. Mass-to-Charge (m/z) Orser, Marquez replicate Uhlig et al at DigiPath

11 Microbiological Contamination* * SC Labs, CannMed 2016

12 Positive Feed Back Loop High False Positive microbe tests = More pesticide use Less beneficial microbe use Cyanide inhalation

13 Pesticides* * SC Labs, CannMed

14 Experimental Design 3M & Biomeriuex vs. qpcr & Sequencing Step 1. Capture DNA Before Culture Purified DNA 4. Perform both 16S and 18S ITS qpcr (3 Hours) Step 2. Culture Sample on 3M or Biomerieux Platforms 3M Film (3/5 days to Grow) Biomerieux Cartridge (3 days) Step 3. Extract Positive Cultures in Step 2 5. Sequence both 16S and 18S PCR product (before and after Tempo DNA)

15 Perform both 16S and 18S ITS qpcr Capture DNA After Culture NextGen Sequence

16 Questions 1. Do original microbials match post culture microbials? 2. What % of the CFU/g are actually Yeast and Mold?

17 qpcr, BMX, 3M TAC Cq BMX-TAC 3M Before N/A After TYM Cq BMX-TYM 3M Before N/A 37K/140K Fail After BMX evidence for low levels of bacteria 2. BMX and 3M show high levels of TYM. qpcr demonstrates TYM after growth. 3. We have seen 3M TYM grow Staph. Will it grow Acne?

18 16S qpcr and Sequencing demonstrate bacteria grow very well in TYM cartridges PathoSEEK TAC OUT Counts Before vs. After DNA TYM Biomerieux Culture Before TYM Culture OTU Counts w/ Sequencing Bacillus_coagulans Ralstonia_syzygii_subsp._indonesiensis bacterium_oxscc-14 Tilletiopsis_pallescens After TYM OTU Counts w/ Sequencing

19 Some Are Harmless Acne, Some Not PathoSEEK TAC OTU Counts Before vs. After DNA TYM Biomerieux Culture Before TYM Culture OTU Counts w/ Sequencing Plant Background DNA Uncultured bacterium Klebsiella_sp. Raoultella_ornithinolytica Propionibacterium (Acne) Kluyvera_ascorbata Enterobacter_sp._10-17 Kluyvera_sp After TYM Culture OTU Counts w/ Sequencing

20 18S Shows P.citrinum Growth PathoSEEK TAC OTU Counts Before vs. After DNA TYM Biomerieux Culture Before TYM Culture OTU Counts w/ 18S Sequencing Penicillium_sp._568_FbG fungal_endophyte Delftia_sp._JC257 Penicillium_citrinum Penicillium_citrinum Penicillium_sp._2433_FbLB fungal_endophyte fungal_endophyte Penicillium_citrinum Penicillium_sp._568_FbG After TYM Culture OTU Counts w/ 18S Sequencing

21 18S and Aspergillus Failure to Grow PathoSEEK TYM OTU Counts Before TYM Culture OTU Counts w/ 18S Sequencing Fusarium Aspergillus_niger funga_endophyte Aspergillus_niger Aspergillus_niger After TYM Culture OTU Counts w/ 18S Sequencing

22 16S primers on 3M petri film vs Biomerieux bacterium_cicc_23843 Bacillus_coagulans uncultured_bacterium Aureimonas_sp._PP-WC-4G-234 uncultured_bacterium uncultured_bacterium Ralstonia_pickettii uncultured_bacterium

23 Discordant Before vs After data with culture Raises a Hiesenberg Uncertainty problem for regulators -The act of measuring microbial load, changes the microbial load. But do the differing culture systems agree with one another?

24 18S qpcr, 3M petri film vs Biomerieux Penicillium_citrinum fungal_endophyte Penicillium_citrinum Penicillium_brevicompactum fungal_endophyte

25 Correlations with Bacteria are weak Correl =0.196 Correl =.992

26 18S qpcr specificity When 18S qpcr & Sequencing is performed how many times do we see 16S sequence hits?

27 Future Directions If we want to reduce Pesticide usage, we must have specific microbial testing Beneficial microbes are known to reduce the need for pesticides. Beneficial microbes should not be included in a CFU/g count.

28 Nevada On The Shoulder of Giants

29 Current Microbial Tests Lack Specificity Culture based CFU/g has no bearing on safety Bacteria Grow on/in Yeast and Mold culture (FP) Staphyloccus (Human introduced) Pseudomonas (ubiquitous, harmless except Aeruginosa) Propionibacteria (Human introduced- Acne) Bacillus Likely beneficial Many forms of visible mold don t grow at all (FN) Culture systems failed to detect some Penicillium species (FN) and some aspergillus species

30 FDA is Moving to Sequence Based Safety Testing Lets get cannabis on the same footing!

31 DNA Sequence Verification of Cannabis Strains Genetic Fingerprints of Cannabis Products in the market place. Kannapedia.net Links to METRC and Blockchain based proof of existence databases.

32 Blockchains Enable Encryption Proof Time Stamps Create Encryption Key of SNP file with SHA e20b9db09c2af093ef926a3ec77efaec1fc2df Spend BTC with Key. Key is placed into a block and the time stamp is distributed to millions of computers and can never be reversed. Customer can demonstrate in Court that a Key in a timestamped Block unlocks their genetic file and therefore the file had to exist at the time of the block

33 Acknowledgements Medicinal Genomics Yvonne Helbert Jessica Spangler Ryan Lynch Wendell Orphe Lei Zhang Jeremy Rualo Adrian Devitt-Lee Christine Sutera Lei Zhang Ted Foss Doug Smith DigiPath Cindy Orser Glen Marquez Proverde Chris Hudalla Matthew Silva SCLabs Josh Wurzer Alec Dixon

PathogINDICAtor Cq to CFU Equations

PathogINDICAtor Cq to CFU Equations PathogINDICAtor Cq to CFU Equations Overview: State regulations for microbial thresholds use nomenclature from culture- based methods to set acceptable thresholds. With this in mind, it was necessary for

More information

Optimized Cannabis Microbial Testing: Combined Use of Medicinal Genomics Extraction Methods With the AriaMx qpcr Instrument

Optimized Cannabis Microbial Testing: Combined Use of Medicinal Genomics Extraction Methods With the AriaMx qpcr Instrument Application Note Optimized Cannabis Microbial Testing: Combined Use of Medicinal Genomics Extraction Methods With the AriaMx qpcr Instrument Authors Scott D. Leppanen Sr. Field Applications Scientist Agilent

More information

PathoSEEK Analysis Quick Reference Tables:... 2 FLOWER... 2 NON FLOWER Matrices... 2 GUMMY... 3

PathoSEEK Analysis Quick Reference Tables:... 2 FLOWER... 2 NON FLOWER Matrices... 2 GUMMY... 3 Page 1 of 14 Please refer to http://www.medicinalgenomics.com/product-literature/ for updated protocols and Material Safety Data Sheets (MSDS). Consult MSDS before using any new product. PATHOSEEK is a

More information

PathoSEEK Analysis Quick Reference Tables:... 2 FLOWER... 2 NON FLOWER Matrices... 2 GUMMY... 3

PathoSEEK Analysis Quick Reference Tables:... 2 FLOWER... 2 NON FLOWER Matrices... 2 GUMMY... 3 Page 1 of 13 Please refer to http://www.medicinalgenomics.com/product-literature/ for updated protocols and Material Safety Data Sheets (MSDS). Consult MSDS before using any new product. PATHOSEEK is a

More information

PathoSEEK Microbial Safety Testing Platform on the AriaMX Real-Time PCR System No Decontamination Step Page 1 of 9

PathoSEEK Microbial Safety Testing Platform on the AriaMX Real-Time PCR System No Decontamination Step Page 1 of 9 Page 1 of 9 Please refer to http://www.medicinalgenomics.com/product-literature/ for updated protocols and Material Safety Data Sheets (MSDS). Consult MSDS before using any new product. PATHOSEEK is a

More information

Finding and optimizing soil microbes for enhancing agricultural productivity and sustainability

Finding and optimizing soil microbes for enhancing agricultural productivity and sustainability Finding and optimizing soil microbes for enhancing agricultural productivity and sustainability Daniel Schachtman University of Nebraska, Lincoln June 30, 2015 Nebraska is a Living Laboratory for agricultural

More information

Real-Time Quantitative PCR (qpcr) Protocol... 5 Glossary and Definitions DICSCLAIMER LIMITED USE LABEL LICENSE... 10

Real-Time Quantitative PCR (qpcr) Protocol... 5 Glossary and Definitions DICSCLAIMER LIMITED USE LABEL LICENSE... 10 Page 1 of 10 Please refer to http://www.medicinalgenomics.com/product-literature/ for updated protocols and Material Safety Data Sheets (MSDS). Consult MSDS before using any new product. PATHOSEEK is a

More information

PathoSEEK Microbial Safety Testing Platform on the AriaMX Real-Time PCR System Decontamination Step Included Page 1 of 11.

PathoSEEK Microbial Safety Testing Platform on the AriaMX Real-Time PCR System Decontamination Step Included Page 1 of 11. Page 1 of 11 Please refer to http://www.medicinalgenomics.com/product-literature/ for updated protocols and Material Safety Data Sheets (MSDS). Consult MSDS before using any new product. PATHOSEEK is a

More information

PathogINDICAtor qpcr Microbial Detection Assay on the AriaMX Real-Time PCR System Optional Decontamination Step Page 1 of 12.

PathogINDICAtor qpcr Microbial Detection Assay on the AriaMX Real-Time PCR System Optional Decontamination Step Page 1 of 12. Page 1 of 12 Please refer to http://www.medicinalgenomics.com/product-literature/ for updated protocols and Material Safety Data Sheets (MSDS). Consult MSDS before using any new product. PATHOGINDICATOR

More information

Validation of the BacT/Alert as an Alternative Sterility Test for Dendreon s Autologous Cell Therapy Product Timothy Wood QC Scientist

Validation of the BacT/Alert as an Alternative Sterility Test for Dendreon s Autologous Cell Therapy Product Timothy Wood QC Scientist Validation of the BacT/Alert as an Alternative Sterility Test for Dendreon s Autologous Cell Therapy Product Timothy Wood QC Scientist Somatic Cell Therapy Symposium, Bethesda MD September 28, 2007 1 Overview

More information

Name: Ally Bonney. Date: January 29, 2015 February 24, Purpose

Name: Ally Bonney. Date: January 29, 2015 February 24, Purpose Name: Ally Bonney Title: Genome sequencing and annotation of Pseudomonas veronii isolated from Oregon State University soil and 16S rrna characterization of Corvallis, OR soil microbial populations Date:

More information

PathoSEEK Microbial Safety Testing Platform on the BIO-RAD CFX96 Touch Real-Time PCR Detection System Decontamination Step Included Page 1 of 13

PathoSEEK Microbial Safety Testing Platform on the BIO-RAD CFX96 Touch Real-Time PCR Detection System Decontamination Step Included Page 1 of 13 Page 1 of 13 Please refer to http://www.medicinalgenomics.com/product-literature/ for updated protocols and Material Safety Data Sheets (MSDS). Consult MSDS before using any new product. PATHOSEEK is a

More information

ngs metagenomics target variation amplicon bioinformatics diagnostics dna trio indel high-throughput gene structural variation ChIP-seq mendelian

ngs metagenomics target variation amplicon bioinformatics diagnostics dna trio indel high-throughput gene structural variation ChIP-seq mendelian Metagenomics T TM storage genetics assembly ncrna custom genotyping RNA-seq de novo mendelian ChIP-seq exome genomics indel ngs trio prediction metagenomics SNP resequencing bioinformatics diagnostics

More information

Assessing barley malt associated microbial diversity using next generation sequencing

Assessing barley malt associated microbial diversity using next generation sequencing Assessing barley malt associated microbial diversity using next generation sequencing Mandeep Kaur 1, Evan Evans 1, Doug Stewart 2, Agnieszka Janusz 2, Barbara Holland 1 and John Bowman 1 1 University

More information

dbcamplicons pipeline Amplicons

dbcamplicons pipeline Amplicons dbcamplicons pipeline Amplicons Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Microbial community analysis Goal:

More information

dbcamplicons pipeline Amplicons

dbcamplicons pipeline Amplicons dbcamplicons pipeline Amplicons Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Microbial community analysis Goal:

More information

IDENTIFIABILITY OF THE HUMAN MICROBIOME: INVESTIGATOR PERSPECTIVES

IDENTIFIABILITY OF THE HUMAN MICROBIOME: INVESTIGATOR PERSPECTIVES IDENTIFIABILITY OF THE HUMAN MICROBIOME: INVESTIGATOR PERSPECTIVES Data Sharing Policies in Genomic Research Developed in the context of large-scale sequencing studies (HGP, HapMap) Primary purpose: create

More information

Introducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight

Introducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight Introducing QIAseq Accelerate your NGS performance through Sample to Insight solutions Sample to Insight From Sample to Insight let QIAGEN enhance your NGS-based research High-throughput next-generation

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

Symbio Alliance. Laboratory Training - RTO Technical Services.

Symbio Alliance. Laboratory Training - RTO Technical Services. Symbio Alliance Laboratory Training - RTO Technical Services Brisbane: 44-52 Brandl St, Eight Mile Plains, Qld, 4113 07-3340 5700 Melbourne: Unit 15, 640-680 Geelong Rd, Brooklyn, Vic, 3012 03-9318 0677

More information

Efficient Characterisation of Bacterial Contaminants in the Milk industry: A Case for Molecular Sequencing

Efficient Characterisation of Bacterial Contaminants in the Milk industry: A Case for Molecular Sequencing SA Society of Dairy Technology 2015 Dairy Symposium 14 16 April, 2015 Cape St. Francis Resort, Cape St. Francis, Eastern Cape Efficient Characterisation of Bacterial Contaminants in the Milk industry:

More information

Dr. Gary Mumaugh. DNA Technology

Dr. Gary Mumaugh. DNA Technology Dr. Gary Mumaugh DNA Technology Genetic Engineering Recombinant DNA Technology Times Recombinant DNA Production Recombinant DNA Applications Recombinant DNA Usages Recombinant DNA Social Considerations

More information

Culture Vs. qpcr. Daniel Grandio Gonzalez

Culture Vs. qpcr. Daniel Grandio Gonzalez Culture Vs. qpcr Daniel Grandio Gonzalez Introduction Legionelosis, Pontiac Fever, Mycobacteriosis Legionella: Hot water tanks, showers, cooling towers, swimming pools Environmental Mycobacteria: Purified

More information

DNA REPLICATION & BIOTECHNOLOGY Biology Study Review

DNA REPLICATION & BIOTECHNOLOGY Biology Study Review DNA REPLICATION & BIOTECHNOLOGY Biology Study Review DNA DNA is found in, in the nucleus. It controls cellular activity by regulating the production of, which includes It is a very long molecule made up

More information

Microbial Community Assembly and Dynamics:.from AMD biofilms to colonization of the premature infant gut

Microbial Community Assembly and Dynamics:.from AMD biofilms to colonization of the premature infant gut Microbial Community Assembly and Dynamics:.from AMD biofilms to colonization of the premature infant gut Jill Banfield Talk Overview i) AMD microbial biofilms: an example of reproducible community assembly

More information

B R I N G C O M P U T A T I O N T O L I F E

B R I N G C O M P U T A T I O N T O L I F E B R I N G C O M P U T A T I O N T O L I F E Founding team: Four biological engineers Alec Nielsen, PhD MIT Biological Engineering Genetic engineer, cell biophysicist, comp. biologist Published circuits

More information

Genetic Engineering 1 of 27 Boardworks Ltd 2012

Genetic Engineering 1 of 27 Boardworks Ltd 2012 Genetic Engineering 1 of 27 Boardworks Ltd 2012 2 of 27 Boardworks Ltd 2012 What is genetic engineering? 3 of 27 Boardworks Ltd 2012 DNA of living organisms can be modified by the insertion or removal

More information

Industry Case Study: A Microbial Investigation of Contamination by Burkholderia multivorans. Jim Klein and Geert Verdonk Merck & Co., Inc.

Industry Case Study: A Microbial Investigation of Contamination by Burkholderia multivorans. Jim Klein and Geert Verdonk Merck & Co., Inc. Industry Case Study: A Microbial Investigation of Contamination by Burkholderia multivorans Jim Klein and Geert Verdonk Merck & Co., Inc. Messages The role of microbiological analysis The role of subject

More information

A risk based approach to managing environmental excursions

A risk based approach to managing environmental excursions A risk based approach to managing environmental excursions RACI: Monitoring & protecting your GMP facility s Environment 20 th April Ngoc Anh-Thu Phan www.eurofins.com Content Introduction Risk Assessment

More information

11/1/2010. Key Points to Remember

11/1/2010. Key Points to Remember A Review of Microbial Limits and Objectionable Organisms Steven Schnittger, The Estee Lauder Companies, Inc. Key Points to Remember Cosmetic products are not required to be sterile It is the aim of all

More information

M1D2: Diagnostic Primer Design 2/10/15

M1D2: Diagnostic Primer Design 2/10/15 M1D2: Diagnostic Primer Design 2/10/15 Announcements 1. Expanded office hours for this week: Wednesday, 3-5pm in 16-319 Friday, 3-5pm in 16-319 Sunday, 3-5pm in 16-319 2. Weekly office hours (starting

More information

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology

2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

Superior accuracy and speed MicroSEQ Rapid Microbial Identification System

Superior accuracy and speed MicroSEQ Rapid Microbial Identification System Superior accuracy and speed MicroSEQ Rapid Microbial Identification System Featuring the 3500 Genetic Analyzer Achieve right-the-fi rst-time microbial identifi cation Next-generation, high-throughput comparative

More information

Amplicon size (bp) E ± SD

Amplicon size (bp) E ± SD Development of a probe-based qpcr assay for the detection of constitutional and somatic deletions in the NF1 gene. Application to genetic testing and tumor analysis. Terribas E, Garcia-Linares C, Lázaro

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Exploring of microrna markers for body fluid identification using NGS

Exploring of microrna markers for body fluid identification using NGS Exploring of microrna markers for body fluid identification using NGS Zheng Wang, Yiping Hou Institute of Forensic Medicine Sichuan University, China Barcelona May, 11, 2016 Outline Introduction of Institute

More information

Microbials. Impact on agriculture and the seed industry. Marcus Meadows-Smith. BioConsortia, Inc.

Microbials. Impact on agriculture and the seed industry. Marcus Meadows-Smith. BioConsortia, Inc. Microbials Impact on agriculture and the seed industry Marcus Meadows-Smith BioConsortia, Inc. Seed Central, UC Davis, 9 February 2017 Agenda 1) Introduction to Microbials - Marcus Meadows-Smith, CEO,

More information

3. How can you test a food to find out if it contains materials derived from a GMO?

3. How can you test a food to find out if it contains materials derived from a GMO? GMO Investigator LAB Name Introduction With the world population exploding and farmable land disappearing, agricultural specialists are concerned about the world's ability to produce enough food to feed

More information

Meet the iseq 100 System.

Meet the iseq 100 System. Meet your new lab partner our smallest, most accessible, and affordable next-generation sequencing (NGS) solution ever. Want deeper biological insights, better experimental efficiency, and greater discovery

More information

SenSATIVAx (Maryland) Plant/Microbial DNA Purification Kit Page 1 of 9

SenSATIVAx (Maryland) Plant/Microbial DNA Purification Kit Page 1 of 9 Page 1 of 9 Please refer to http://www.medicinalgenomics.com/product-literature/ for updated protocols and Material Safety Data Sheets (MSDS). Consult MSDS before using any new product. SENSATIVAX is a

More information

Microbiomics I August 24th, Introduction. Robert Kraaij, PhD Erasmus MC, Internal Medicine

Microbiomics I August 24th, Introduction. Robert Kraaij, PhD Erasmus MC, Internal Medicine Microbiomics I August 24th, 2017 Introduction Robert Kraaij, PhD Erasmus MC, Internal Medicine r.kraaij@erasmusmc.nl Welcome to Microbiomics I Infection & Immunity MSc students Only first day no practicals

More information

Next Generation Sequencing Applications in Food Safety and Quality

Next Generation Sequencing Applications in Food Safety and Quality Next Generation Sequencing Applications in Food Safety and Quality Our science National and international centre of excellence for interdisciplinary investigation and problem solving across plant and bee

More information

CH 8: Recombinant DNA Technology

CH 8: Recombinant DNA Technology CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes

More information

Applications of Next Generation Sequencing in Metagenomics Studies

Applications of Next Generation Sequencing in Metagenomics Studies Applications of Next Generation Sequencing in Metagenomics Studies Francesca Rizzo, PhD Genomix4life Laboratory of Molecular Medicine and Genomics Department of Medicine and Surgery University of Salerno

More information

John Kough, Ph.D. Office Of of Pesticide P rograms Programs

John Kough, Ph.D. Office Of of Pesticide P rograms Programs John Kough, Ph.D. Office of Pesticide Programs Microbial Pesticides 78 registered Bacteria (39) 17 Bacillus thuringiensis subspecies 10 other Bacillus species 10 Pseudomonas species 2 Agrobacterium isolates

More information

Bacterial Transformation Lab - pglo

Bacterial Transformation Lab - pglo Bacterial Transformation Lab - pglo Name: Date: Pre-Lab Score: Lab Overview: In this investigation, you will gain an understanding of the techniques of culturing E. coli bacteria and transforming using

More information

Microbiomes and metabolomes

Microbiomes and metabolomes Microbiomes and metabolomes Michael Inouye Baker Heart and Diabetes Institute Univ of Melbourne / Monash Univ Summer Institute in Statistical Genetics 2017 Integrative Genomics Module Seattle @minouye271

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

Analytical Service Code

Analytical Service Code Mycometrics, LLC. 9 Deer Park Dr. Suite K-18 Monmouth Junction, NJ 08852 Tel: 732-355-9018 Fax: 732-658-5185 Email: quest@mycometrics.com URL: www.mycometrics.com Analytical Service Code Microbial Identification

More information

Metagenomic 3C, full length 16S amplicon sequencing on Illumina, and the diabetic skin microbiome

Metagenomic 3C, full length 16S amplicon sequencing on Illumina, and the diabetic skin microbiome Also: Sunaina Melissa Gardiner UTS Catherine Burke UTS Michael Liu UTS Chris Beitel UTS, UC Davis Matt DeMaere UTS Metagenomic 3C, full length 16S amplicon sequencing on Illumina, and the diabetic skin

More information

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death

More information

Chapter 9 Genetic Engineering

Chapter 9 Genetic Engineering Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation

More information

Environmental Monitoring Solutions

Environmental Monitoring Solutions Sanitation Verification Allergen Control General Microbiological Monitoring Pathogen Screening Environmental Monitoring Solutions The Four Pillars of a Robust Environmental Monitoring Program Sanitation

More information

The Microbiology of Food

The Microbiology of Food The Microbiology of Food Bio 8 - Fall 2018 Tu 6:30PM - 9:00PM Anderson, Room 309 Instructor: Benjamin Wolfe (Assistant Professor, Department of Biology) e-mail: benjamin.wolfe@tufts.edu Office Hours: 3:30-:30pm

More information

Biotechnology. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc., unless otherwise noted

Biotechnology. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc., unless otherwise noted Biotechnology Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc., unless otherwise noted Biotechnology Any technical procedure used to isolate, analyze or manipulate genes

More information

RiboPrinter microbial characterization system

RiboPrinter microbial characterization system DuPont Qualicon RiboPrinter microbial characterization system Staphylococcus epidermidis RiboGroup 102-45-3 DEDICATED TO MICROBIOLOGY OK. You found it. Now what? RiboPrinter microbial characterization

More information

Computing with large data sets

Computing with large data sets Computing with large data sets Richard Bonneau, spring 2009 Lecture 14 (week 8): genomics 1 Central dogma Gene expression DNA RNA Protein v22.0480: computing with data, Richard Bonneau Lecture 14 places

More information

ONAMER M. PRESERVATIVE and ANTIMICROBIAL ONAMER

ONAMER M. PRESERVATIVE and ANTIMICROBIAL ONAMER ONAMER M PRESERVATIVE and ANTIMICROBIAL ONAMER M Stepan Lipid Nutrition is a division of Stepan Company which manufactures lipid and polymer based ingredients. HO OH SUMMARY Our quaternary ammonium polymer

More information

Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales

Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales Targeted Sequencing Using Droplet-Based Microfluidics Keith Brown Director, Sales brownk@raindancetech.com Who we are: is a Provider of Microdroplet-based Solutions The Company s RainStorm TM Technology

More information

Supplementary Information for

Supplementary Information for Supplementary Information for Microbial community dynamics and stability during an ammonia- induced shift to syntrophic acetate oxidation Jeffrey J. Werner 1,2, Marcelo L. Garcia 3, Sarah D. Perkins 3,

More information

Ribotyping Easily Fills in for Whole Genome Sequencing to Characterize Food-borne Pathogens David Sistanich

Ribotyping Easily Fills in for Whole Genome Sequencing to Characterize Food-borne Pathogens David Sistanich Ribotyping Easily Fills in for Whole Genome Sequencing to Characterize Food-borne Pathogens David Sistanich Technical Support Specialist Hygiena, LLC Whole genome sequencing (WGS) has become the ultimate

More information

Need for Standardization in Drinking Water Analyses

Need for Standardization in Drinking Water Analyses 30/01-2017 Need for Standardization in Drinking Water Analyses Identification of bacteria using 16S rrna Amplicon Sequencing Jakob Brandt PhD student Per Halkjær Nielsen & Mads Albertsen CENTER FOR MICROBIAL

More information

Exploring Chromodomain Genes in the Fungus Fusarium graminearum Through Targeted Genetic Manipulation

Exploring Chromodomain Genes in the Fungus Fusarium graminearum Through Targeted Genetic Manipulation Exploring Chromodomain Genes in the Fungus Fusarium graminearum Through Targeted Genetic Manipulation Alec Peters Dr. Michael Freitag Laboratory Dept of Biochemistry/Biophysics Oregon State University

More information

Rapid Bacterial Identification Using a Mass Spectrometry Based Molecular Diagnostics Approach: Evaluation of the Iridica Platform

Rapid Bacterial Identification Using a Mass Spectrometry Based Molecular Diagnostics Approach: Evaluation of the Iridica Platform Rapid Bacterial Identification Using a Mass Spectrometry Based Molecular Diagnostics Approach: Evaluation of the Iridica Platform Alec Saitman, PhD, Jane Y. Yang PhD, Sharon Reed, David Pride, Michele

More information

Insight into microbial world molecular biology research in environmental microbiology

Insight into microbial world molecular biology research in environmental microbiology Insight into microbial world molecular biology research in environmental microbiology Aleksandra Ziembi ska The Silesian University of Technology, Environmental Biotechnology Department aleksandra.ziembinska@polsl.pl

More information

Researchers use genetic engineering to manipulate DNA.

Researchers use genetic engineering to manipulate DNA. Section 2: Researchers use genetic engineering to manipulate DNA. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the different tools and processes used in genetic

More information

Water Quality and Waller Creek Dr. Kinney & UTBIOME Collaborators. What is in Waller Creek? A Wide Variety of Biota!

Water Quality and Waller Creek Dr. Kinney & UTBIOME Collaborators. What is in Waller Creek? A Wide Variety of Biota! Water Quality and Waller Creek Dr. Kinney & UTBIOME Collaborators The Visible & The Invisible What is in Waller Creek? A Wide Variety of Biota! Yellow crowned Night Heron at 24th Street Bridge June 2003

More information

Mochamad Nurcholis. Food Technology Department Agricuktural Technology Faculty Brawijaya University 2013

Mochamad Nurcholis. Food Technology Department Agricuktural Technology Faculty Brawijaya University 2013 Mochamad Nurcholis Food Technology Department Agricuktural Technology Faculty Brawijaya University 2013 Microbial Identification Type Conventional Identification DNA Hybridization PCR Amplification DNA

More information

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks

More information

Antibiotic Resistance Genes: From The Farm To The Human Gut

Antibiotic Resistance Genes: From The Farm To The Human Gut Shanghai 2015 Antibiotic Resistance Genes: From The Farm To The Human Gut Baoli Zhu, PhD Institute of Microbiology, Chinese Academy Beijing Key Lab of Microbial Drug Resistance and Resistome zhubaoli@im.ac.cn

More information

CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.

CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved. CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? 35 INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment,

More information

Microbiome Analysis. Research Day 2012 Ranjit Kumar

Microbiome Analysis. Research Day 2012 Ranjit Kumar Microbiome Analysis Research Day 2012 Ranjit Kumar Human Microbiome Microorganisms Bad or good? Human colon contains up to 100 trillion bacteria. Human microbiome - The community of bacteria that live

More information

Providing clear solutions to microbiological challenges TM. cgmp/iso CLIA. Polyphasic Microbial Identification & DNA Fingerprinting

Providing clear solutions to microbiological challenges TM. cgmp/iso CLIA. Polyphasic Microbial Identification & DNA Fingerprinting Providing clear solutions to microbiological challenges TM Cert. No. 2254.01 Polyphasic Microbial Identification & DNA Fingerprinting Microbial Contamination Tracking & Trending cgmp/iso-17025-2005 CLIA

More information

ANALYTICAL REPORT: Comparison of the Microbial Recovery Efficacy of QI Medical EnviroTest Paddles versus a Conventional Contact Plate

ANALYTICAL REPORT: Comparison of the Microbial Recovery Efficacy of QI Medical EnviroTest Paddles versus a Conventional Contact Plate FOCUS Scientific Services LLC ANALYTICAL REPORT: Comparison of the Microbial Recovery Efficacy of QI Medical EnviroTest Paddles versus a Conventional Contact Plate REPORT: FS-QI-GM-003 Study Manager: Anthony

More information

Accugen Laboratories, Inc.

Accugen Laboratories, Inc. Lab# 97478-2 www.accugenlabs.com Page 1 of 7 Accugen Laboratories, Inc. FINAL REPORT ASTM G22 ASTM Designation: G22-76(1996) "Standard Practice for determining Resistance of Plastics to Bacteria (Withdrawn

More information

Summary Report. Training Course for Microbial Data Analysis

Summary Report. Training Course for Microbial Data Analysis Summary Report Training Course for Microbial Data Analysis Hosted by: WFCC-MIRCEN World Data Center for Microorganisms (WDCM) Organized by: World Federation for Culture Collections (WFCC) The Center for

More information

Metagenomics Computational Genomics

Metagenomics Computational Genomics Metagenomics 02-710 Computational Genomics Metagenomics Investigation of the microbes that inhabit oceans, soils, and the human body, etc. with sequencing technologies Cooperative interactions between

More information

Chapter 8 Recombinant DNA Technology. 10/1/ MDufilho

Chapter 8 Recombinant DNA Technology. 10/1/ MDufilho Chapter 8 Recombinant DNA Technology 10/1/2017 1 MDufilho The Role of Recombinant DNA Technology in Biotechnology Biotechnology? Recombinant deoxyribonucleic acid (DNA) technology Intentionally modifying

More information

Methods that do not require growth in laboratory PCR

Methods that do not require growth in laboratory PCR Methods that do not require growth in laboratory PCR Nucleotide sequencing MLST/MLVST Profiles Microarrays Polymerase Chain Reaction [PCR] Use to find a rare sequence in a pool of many different sequences

More information

Genetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping

Genetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping Genetics module Lectures DNA Structure, Replication The Genetic Code; Transcription and Translation Principles of Heredity; Gene Mapping Controlling Gene Expression Mutation and Cancer Textbook: Introduction

More information

Analysis of milk microbial profiles using 16s rrna gene sequencing in milk somatic cells and fat

Analysis of milk microbial profiles using 16s rrna gene sequencing in milk somatic cells and fat Analysis of milk microbial profiles using 16s rrna gene sequencing in milk somatic cells and fat Juan F. Medrano Anna Cuzco* Alma Islas-Trejo Armand Sanchez* Olga Francino* Dept. of Animal Science University

More information

Abstract... i. Committee Membership... iii. Foreword... vii. 1 Scope Introduction Standard Precautions References...

Abstract... i. Committee Membership... iii. Foreword... vii. 1 Scope Introduction Standard Precautions References... Vol. 28 No. 12 Replaces MM18-P Vol. 27 No. 22 Interpretive Criteria for Identification of Bacteria and Fungi by DNA Target Sequencing; Approved Guideline Sequencing DNA targets of cultured isolates provides

More information

Biosc10 schedule reminders

Biosc10 schedule reminders Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,

More information

Practical Bioinformatics for Life Scientists. Week 14, Lecture 27. István Albert Bioinformatics Consulting Center Penn State

Practical Bioinformatics for Life Scientists. Week 14, Lecture 27. István Albert Bioinformatics Consulting Center Penn State Practical Bioinformatics for Life Scientists Week 14, Lecture 27 István Albert Bioinformatics Consulting Center Penn State No homework this week Project to be given out next Thursday (Dec 1 st ) Due following

More information

What s Spoiling Your Beer?

What s Spoiling Your Beer? What s Spoiling Your Beer? the MiL, Inc. MICROBE INOTECH LABORATORIES, INC. The Microbiology of Beer Contamination Microorganisms that contribute to the spoilage of beer, such as bacteria, wild yeasts,

More information

TECHNICAL LEAFLET. MEDI-MEDIA-FILL KIT SUPPLY PACKAGE (Code: MR-25/S)

TECHNICAL LEAFLET. MEDI-MEDIA-FILL KIT SUPPLY PACKAGE (Code: MR-25/S) TECHNICAL LEAFLET MEDI-MEDIA-FILL KIT SUPPLY PACKAGE (Code: MR-25/S) TEST AGAR PLATES FOR PERSONNEL AND ENVIRONMENTAL MICROBIOLOGICAL MONITORING COMPONENTS: Test Agar Plates Data Log Sheet Technical Leaflet

More information

Challenges in Microbial Assays of Produced Waters L. Keith McLeroy

Challenges in Microbial Assays of Produced Waters L. Keith McLeroy Challenges in Microbial Assays of Produced Waters L. Keith McLeroy Technical Advisor, M-I SWACO/Schlumberger Introduction Abstract Most often oil and gas produced waters are allowed to either accumulate

More information

MB311 Molecular Microbiology Laboratory. Spring 2017: Tuesday/Thursday 9:00-11:50 am; Nash 304

MB311 Molecular Microbiology Laboratory. Spring 2017: Tuesday/Thursday 9:00-11:50 am; Nash 304 MB311 Molecular Microbiology Laboratory Spring 2017: Tuesday/Thursday 9:00-11:50 am; Nash 304 Instructor: Dr. Walt Ream reaml@science.oregonstate.edu ALS1081 737-1791 Office Hours: by appointment. Teaching

More information

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology

Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical

More information

The right answer, every time

The right answer, every time MICROSEQ MICROBIAL IDENTIFICATION SYSTEM The right answer, every time Definitive identification of bacterial and fungal isolates. Accuracy adds confidence. When microbial contamination poses problems,

More information

The effect of host genetics factors on

The effect of host genetics factors on The effect of host genetics factors on shaping Die Universität pig gut Hohenheim microbiota M. Maushammer 1, A. Camarinha-Silva 1, M. Vital 2, R. Wellmann 1, S. Preuss 1, J. Bennewitz 1 1 University of

More information

Genomic and Proteomic Analysis of Deep Underground Microbial Communities

Genomic and Proteomic Analysis of Deep Underground Microbial Communities Genomic and Proteomic Analysis of Deep Underground Microbial Communities Kenneth F. Reardon, Chemical & Biological Engineering, Colorado State University Amy Pruden, Civil & Environmental Engineering,

More information

CBC Data Therapy. Metagenomics Discussion

CBC Data Therapy. Metagenomics Discussion CBC Data Therapy Metagenomics Discussion General Workflow Microbial sample Generate Metaomic data Process data (QC, etc.) Analysis Marker Genes Extract DNA Amplify with targeted primers Filter errors,

More information

Current molecular diagnostic system

Current molecular diagnostic system LAMP-BART Name: Chris Wong Supervisor: Prof. Margaret Ip Joint Graduate Seminar Department of Microbiology The Chinese University of Hong Kong 18 th December 2012 Current molecular diagnostic system Detection

More information

GM (Genetically Modified) Plants. Background

GM (Genetically Modified) Plants. Background 1 GM (Genetically Modified) Plants Background Genetically modified crops (GM) have been used since 1996 in the U.S. GM crops contain foreign genetic material The DNA may be from another plant or from a

More information

RiboPrinter microbial characterization system

RiboPrinter microbial characterization system DuPont Qualicon RiboPrinter microbial characterization system Staphylococcus epidermidis RiboGroup 102-45-3 OK. You found it. Now what? DuPont Qualicon 1.800.863.6842 2 RiboPrinter microbial characterization

More information

Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms

Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Duncanrig Secondary JHM&MHC 2015 Page 1 of 18 On completion of this

More information

Validation of qpcr Rapid Bacterial Quantification through Viable E. coli cell count in the Saginaw Bay Watershed

Validation of qpcr Rapid Bacterial Quantification through Viable E. coli cell count in the Saginaw Bay Watershed Validation of qpcr Rapid Bacterial Quantification through Viable E. coli cell count in the Saginaw Bay Watershed TYLER LEFEVRE ADVISOR: DR. TAMI SIVY 1 Overview Introduction to fecal coliforms Current

More information

MicroSEQ TM ID Rapid Microbial Identification System:

MicroSEQ TM ID Rapid Microbial Identification System: MicroSEQ TM ID Rapid Microbial Identification System: the complete solution for reliable genotypic microbial identification 1 The world leader in serving science Rapid molecular methods for pharmaceutical

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information