Cannabis microbiome sequencing reveals mycotoxic fungi. Kevin McKernan Courtagen Life Science Medicinal Genomics
|
|
- Prudence Ferguson
- 6 years ago
- Views:
Transcription
1
2 Cannabis microbiome sequencing reveals mycotoxic fungi Kevin McKernan Courtagen Life Science Medicinal Genomics
3 Mold and Bacterial qpcr Testing qpcr provides very specific microbial risks in under 24 hours Most Culture bases systems are failing too much material and failing to grow important risks. $8/test Confidential 3
4 Cannabis Microbiomes w/ ITS Sequencing PathogINDICAtor
5 PathoSEEK Reveals Microbiomes qpcr PathogINDICAtor Sequencing Microbiome ID OUT Count
6 R Square In PathoSEEK
7 Majority of microbes don t culture
8 Penicillium Citrinum & Paxilli Confirmation Paxilline Confirm the Paxilline and Citrinin Genes are also present Citrinin
9 Diverse Microbiomes Discovered
10 DNA sequence Doesn t = Expression x ESI Product Ion (3.860 min) Frag=85.0V CID@20.0 ( > **) Paxilline_PIS_LongColumn-01.d Design an LC-MS/MS method to detect this in a flower matrix. Uhlig et al Counts vs. Mass-to-Charge (m/z) Orser, Marquez replicate Uhlig et al at DigiPath
11 Microbiological Contamination* * SC Labs, CannMed 2016
12 Positive Feed Back Loop High False Positive microbe tests = More pesticide use Less beneficial microbe use Cyanide inhalation
13 Pesticides* * SC Labs, CannMed
14 Experimental Design 3M & Biomeriuex vs. qpcr & Sequencing Step 1. Capture DNA Before Culture Purified DNA 4. Perform both 16S and 18S ITS qpcr (3 Hours) Step 2. Culture Sample on 3M or Biomerieux Platforms 3M Film (3/5 days to Grow) Biomerieux Cartridge (3 days) Step 3. Extract Positive Cultures in Step 2 5. Sequence both 16S and 18S PCR product (before and after Tempo DNA)
15 Perform both 16S and 18S ITS qpcr Capture DNA After Culture NextGen Sequence
16 Questions 1. Do original microbials match post culture microbials? 2. What % of the CFU/g are actually Yeast and Mold?
17 qpcr, BMX, 3M TAC Cq BMX-TAC 3M Before N/A After TYM Cq BMX-TYM 3M Before N/A 37K/140K Fail After BMX evidence for low levels of bacteria 2. BMX and 3M show high levels of TYM. qpcr demonstrates TYM after growth. 3. We have seen 3M TYM grow Staph. Will it grow Acne?
18 16S qpcr and Sequencing demonstrate bacteria grow very well in TYM cartridges PathoSEEK TAC OUT Counts Before vs. After DNA TYM Biomerieux Culture Before TYM Culture OTU Counts w/ Sequencing Bacillus_coagulans Ralstonia_syzygii_subsp._indonesiensis bacterium_oxscc-14 Tilletiopsis_pallescens After TYM OTU Counts w/ Sequencing
19 Some Are Harmless Acne, Some Not PathoSEEK TAC OTU Counts Before vs. After DNA TYM Biomerieux Culture Before TYM Culture OTU Counts w/ Sequencing Plant Background DNA Uncultured bacterium Klebsiella_sp. Raoultella_ornithinolytica Propionibacterium (Acne) Kluyvera_ascorbata Enterobacter_sp._10-17 Kluyvera_sp After TYM Culture OTU Counts w/ Sequencing
20 18S Shows P.citrinum Growth PathoSEEK TAC OTU Counts Before vs. After DNA TYM Biomerieux Culture Before TYM Culture OTU Counts w/ 18S Sequencing Penicillium_sp._568_FbG fungal_endophyte Delftia_sp._JC257 Penicillium_citrinum Penicillium_citrinum Penicillium_sp._2433_FbLB fungal_endophyte fungal_endophyte Penicillium_citrinum Penicillium_sp._568_FbG After TYM Culture OTU Counts w/ 18S Sequencing
21 18S and Aspergillus Failure to Grow PathoSEEK TYM OTU Counts Before TYM Culture OTU Counts w/ 18S Sequencing Fusarium Aspergillus_niger funga_endophyte Aspergillus_niger Aspergillus_niger After TYM Culture OTU Counts w/ 18S Sequencing
22 16S primers on 3M petri film vs Biomerieux bacterium_cicc_23843 Bacillus_coagulans uncultured_bacterium Aureimonas_sp._PP-WC-4G-234 uncultured_bacterium uncultured_bacterium Ralstonia_pickettii uncultured_bacterium
23 Discordant Before vs After data with culture Raises a Hiesenberg Uncertainty problem for regulators -The act of measuring microbial load, changes the microbial load. But do the differing culture systems agree with one another?
24 18S qpcr, 3M petri film vs Biomerieux Penicillium_citrinum fungal_endophyte Penicillium_citrinum Penicillium_brevicompactum fungal_endophyte
25 Correlations with Bacteria are weak Correl =0.196 Correl =.992
26 18S qpcr specificity When 18S qpcr & Sequencing is performed how many times do we see 16S sequence hits?
27 Future Directions If we want to reduce Pesticide usage, we must have specific microbial testing Beneficial microbes are known to reduce the need for pesticides. Beneficial microbes should not be included in a CFU/g count.
28 Nevada On The Shoulder of Giants
29 Current Microbial Tests Lack Specificity Culture based CFU/g has no bearing on safety Bacteria Grow on/in Yeast and Mold culture (FP) Staphyloccus (Human introduced) Pseudomonas (ubiquitous, harmless except Aeruginosa) Propionibacteria (Human introduced- Acne) Bacillus Likely beneficial Many forms of visible mold don t grow at all (FN) Culture systems failed to detect some Penicillium species (FN) and some aspergillus species
30 FDA is Moving to Sequence Based Safety Testing Lets get cannabis on the same footing!
31 DNA Sequence Verification of Cannabis Strains Genetic Fingerprints of Cannabis Products in the market place. Kannapedia.net Links to METRC and Blockchain based proof of existence databases.
32 Blockchains Enable Encryption Proof Time Stamps Create Encryption Key of SNP file with SHA e20b9db09c2af093ef926a3ec77efaec1fc2df Spend BTC with Key. Key is placed into a block and the time stamp is distributed to millions of computers and can never be reversed. Customer can demonstrate in Court that a Key in a timestamped Block unlocks their genetic file and therefore the file had to exist at the time of the block
33 Acknowledgements Medicinal Genomics Yvonne Helbert Jessica Spangler Ryan Lynch Wendell Orphe Lei Zhang Jeremy Rualo Adrian Devitt-Lee Christine Sutera Lei Zhang Ted Foss Doug Smith DigiPath Cindy Orser Glen Marquez Proverde Chris Hudalla Matthew Silva SCLabs Josh Wurzer Alec Dixon
PathogINDICAtor Cq to CFU Equations
PathogINDICAtor Cq to CFU Equations Overview: State regulations for microbial thresholds use nomenclature from culture- based methods to set acceptable thresholds. With this in mind, it was necessary for
More informationOptimized Cannabis Microbial Testing: Combined Use of Medicinal Genomics Extraction Methods With the AriaMx qpcr Instrument
Application Note Optimized Cannabis Microbial Testing: Combined Use of Medicinal Genomics Extraction Methods With the AriaMx qpcr Instrument Authors Scott D. Leppanen Sr. Field Applications Scientist Agilent
More informationPathoSEEK Analysis Quick Reference Tables:... 2 FLOWER... 2 NON FLOWER Matrices... 2 GUMMY... 3
Page 1 of 14 Please refer to http://www.medicinalgenomics.com/product-literature/ for updated protocols and Material Safety Data Sheets (MSDS). Consult MSDS before using any new product. PATHOSEEK is a
More informationPathoSEEK Analysis Quick Reference Tables:... 2 FLOWER... 2 NON FLOWER Matrices... 2 GUMMY... 3
Page 1 of 13 Please refer to http://www.medicinalgenomics.com/product-literature/ for updated protocols and Material Safety Data Sheets (MSDS). Consult MSDS before using any new product. PATHOSEEK is a
More informationPathoSEEK Microbial Safety Testing Platform on the AriaMX Real-Time PCR System No Decontamination Step Page 1 of 9
Page 1 of 9 Please refer to http://www.medicinalgenomics.com/product-literature/ for updated protocols and Material Safety Data Sheets (MSDS). Consult MSDS before using any new product. PATHOSEEK is a
More informationFinding and optimizing soil microbes for enhancing agricultural productivity and sustainability
Finding and optimizing soil microbes for enhancing agricultural productivity and sustainability Daniel Schachtman University of Nebraska, Lincoln June 30, 2015 Nebraska is a Living Laboratory for agricultural
More informationReal-Time Quantitative PCR (qpcr) Protocol... 5 Glossary and Definitions DICSCLAIMER LIMITED USE LABEL LICENSE... 10
Page 1 of 10 Please refer to http://www.medicinalgenomics.com/product-literature/ for updated protocols and Material Safety Data Sheets (MSDS). Consult MSDS before using any new product. PATHOSEEK is a
More informationPathoSEEK Microbial Safety Testing Platform on the AriaMX Real-Time PCR System Decontamination Step Included Page 1 of 11.
Page 1 of 11 Please refer to http://www.medicinalgenomics.com/product-literature/ for updated protocols and Material Safety Data Sheets (MSDS). Consult MSDS before using any new product. PATHOSEEK is a
More informationPathogINDICAtor qpcr Microbial Detection Assay on the AriaMX Real-Time PCR System Optional Decontamination Step Page 1 of 12.
Page 1 of 12 Please refer to http://www.medicinalgenomics.com/product-literature/ for updated protocols and Material Safety Data Sheets (MSDS). Consult MSDS before using any new product. PATHOGINDICATOR
More informationValidation of the BacT/Alert as an Alternative Sterility Test for Dendreon s Autologous Cell Therapy Product Timothy Wood QC Scientist
Validation of the BacT/Alert as an Alternative Sterility Test for Dendreon s Autologous Cell Therapy Product Timothy Wood QC Scientist Somatic Cell Therapy Symposium, Bethesda MD September 28, 2007 1 Overview
More informationName: Ally Bonney. Date: January 29, 2015 February 24, Purpose
Name: Ally Bonney Title: Genome sequencing and annotation of Pseudomonas veronii isolated from Oregon State University soil and 16S rrna characterization of Corvallis, OR soil microbial populations Date:
More informationPathoSEEK Microbial Safety Testing Platform on the BIO-RAD CFX96 Touch Real-Time PCR Detection System Decontamination Step Included Page 1 of 13
Page 1 of 13 Please refer to http://www.medicinalgenomics.com/product-literature/ for updated protocols and Material Safety Data Sheets (MSDS). Consult MSDS before using any new product. PATHOSEEK is a
More informationngs metagenomics target variation amplicon bioinformatics diagnostics dna trio indel high-throughput gene structural variation ChIP-seq mendelian
Metagenomics T TM storage genetics assembly ncrna custom genotyping RNA-seq de novo mendelian ChIP-seq exome genomics indel ngs trio prediction metagenomics SNP resequencing bioinformatics diagnostics
More informationAssessing barley malt associated microbial diversity using next generation sequencing
Assessing barley malt associated microbial diversity using next generation sequencing Mandeep Kaur 1, Evan Evans 1, Doug Stewart 2, Agnieszka Janusz 2, Barbara Holland 1 and John Bowman 1 1 University
More informationdbcamplicons pipeline Amplicons
dbcamplicons pipeline Amplicons Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Microbial community analysis Goal:
More informationdbcamplicons pipeline Amplicons
dbcamplicons pipeline Amplicons Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Microbial community analysis Goal:
More informationIDENTIFIABILITY OF THE HUMAN MICROBIOME: INVESTIGATOR PERSPECTIVES
IDENTIFIABILITY OF THE HUMAN MICROBIOME: INVESTIGATOR PERSPECTIVES Data Sharing Policies in Genomic Research Developed in the context of large-scale sequencing studies (HGP, HapMap) Primary purpose: create
More informationIntroducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight
Introducing QIAseq Accelerate your NGS performance through Sample to Insight solutions Sample to Insight From Sample to Insight let QIAGEN enhance your NGS-based research High-throughput next-generation
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationSymbio Alliance. Laboratory Training - RTO Technical Services.
Symbio Alliance Laboratory Training - RTO Technical Services Brisbane: 44-52 Brandl St, Eight Mile Plains, Qld, 4113 07-3340 5700 Melbourne: Unit 15, 640-680 Geelong Rd, Brooklyn, Vic, 3012 03-9318 0677
More informationEfficient Characterisation of Bacterial Contaminants in the Milk industry: A Case for Molecular Sequencing
SA Society of Dairy Technology 2015 Dairy Symposium 14 16 April, 2015 Cape St. Francis Resort, Cape St. Francis, Eastern Cape Efficient Characterisation of Bacterial Contaminants in the Milk industry:
More informationDr. Gary Mumaugh. DNA Technology
Dr. Gary Mumaugh DNA Technology Genetic Engineering Recombinant DNA Technology Times Recombinant DNA Production Recombinant DNA Applications Recombinant DNA Usages Recombinant DNA Social Considerations
More informationCulture Vs. qpcr. Daniel Grandio Gonzalez
Culture Vs. qpcr Daniel Grandio Gonzalez Introduction Legionelosis, Pontiac Fever, Mycobacteriosis Legionella: Hot water tanks, showers, cooling towers, swimming pools Environmental Mycobacteria: Purified
More informationDNA REPLICATION & BIOTECHNOLOGY Biology Study Review
DNA REPLICATION & BIOTECHNOLOGY Biology Study Review DNA DNA is found in, in the nucleus. It controls cellular activity by regulating the production of, which includes It is a very long molecule made up
More informationMicrobial Community Assembly and Dynamics:.from AMD biofilms to colonization of the premature infant gut
Microbial Community Assembly and Dynamics:.from AMD biofilms to colonization of the premature infant gut Jill Banfield Talk Overview i) AMD microbial biofilms: an example of reproducible community assembly
More informationB R I N G C O M P U T A T I O N T O L I F E
B R I N G C O M P U T A T I O N T O L I F E Founding team: Four biological engineers Alec Nielsen, PhD MIT Biological Engineering Genetic engineer, cell biophysicist, comp. biologist Published circuits
More informationGenetic Engineering 1 of 27 Boardworks Ltd 2012
Genetic Engineering 1 of 27 Boardworks Ltd 2012 2 of 27 Boardworks Ltd 2012 What is genetic engineering? 3 of 27 Boardworks Ltd 2012 DNA of living organisms can be modified by the insertion or removal
More informationIndustry Case Study: A Microbial Investigation of Contamination by Burkholderia multivorans. Jim Klein and Geert Verdonk Merck & Co., Inc.
Industry Case Study: A Microbial Investigation of Contamination by Burkholderia multivorans Jim Klein and Geert Verdonk Merck & Co., Inc. Messages The role of microbiological analysis The role of subject
More informationA risk based approach to managing environmental excursions
A risk based approach to managing environmental excursions RACI: Monitoring & protecting your GMP facility s Environment 20 th April Ngoc Anh-Thu Phan www.eurofins.com Content Introduction Risk Assessment
More information11/1/2010. Key Points to Remember
A Review of Microbial Limits and Objectionable Organisms Steven Schnittger, The Estee Lauder Companies, Inc. Key Points to Remember Cosmetic products are not required to be sterile It is the aim of all
More informationM1D2: Diagnostic Primer Design 2/10/15
M1D2: Diagnostic Primer Design 2/10/15 Announcements 1. Expanded office hours for this week: Wednesday, 3-5pm in 16-319 Friday, 3-5pm in 16-319 Sunday, 3-5pm in 16-319 2. Weekly office hours (starting
More information2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationSuperior accuracy and speed MicroSEQ Rapid Microbial Identification System
Superior accuracy and speed MicroSEQ Rapid Microbial Identification System Featuring the 3500 Genetic Analyzer Achieve right-the-fi rst-time microbial identifi cation Next-generation, high-throughput comparative
More informationAmplicon size (bp) E ± SD
Development of a probe-based qpcr assay for the detection of constitutional and somatic deletions in the NF1 gene. Application to genetic testing and tumor analysis. Terribas E, Garcia-Linares C, Lázaro
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationExploring of microrna markers for body fluid identification using NGS
Exploring of microrna markers for body fluid identification using NGS Zheng Wang, Yiping Hou Institute of Forensic Medicine Sichuan University, China Barcelona May, 11, 2016 Outline Introduction of Institute
More informationMicrobials. Impact on agriculture and the seed industry. Marcus Meadows-Smith. BioConsortia, Inc.
Microbials Impact on agriculture and the seed industry Marcus Meadows-Smith BioConsortia, Inc. Seed Central, UC Davis, 9 February 2017 Agenda 1) Introduction to Microbials - Marcus Meadows-Smith, CEO,
More information3. How can you test a food to find out if it contains materials derived from a GMO?
GMO Investigator LAB Name Introduction With the world population exploding and farmable land disappearing, agricultural specialists are concerned about the world's ability to produce enough food to feed
More informationMeet the iseq 100 System.
Meet your new lab partner our smallest, most accessible, and affordable next-generation sequencing (NGS) solution ever. Want deeper biological insights, better experimental efficiency, and greater discovery
More informationSenSATIVAx (Maryland) Plant/Microbial DNA Purification Kit Page 1 of 9
Page 1 of 9 Please refer to http://www.medicinalgenomics.com/product-literature/ for updated protocols and Material Safety Data Sheets (MSDS). Consult MSDS before using any new product. SENSATIVAX is a
More informationMicrobiomics I August 24th, Introduction. Robert Kraaij, PhD Erasmus MC, Internal Medicine
Microbiomics I August 24th, 2017 Introduction Robert Kraaij, PhD Erasmus MC, Internal Medicine r.kraaij@erasmusmc.nl Welcome to Microbiomics I Infection & Immunity MSc students Only first day no practicals
More informationNext Generation Sequencing Applications in Food Safety and Quality
Next Generation Sequencing Applications in Food Safety and Quality Our science National and international centre of excellence for interdisciplinary investigation and problem solving across plant and bee
More informationCH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationApplications of Next Generation Sequencing in Metagenomics Studies
Applications of Next Generation Sequencing in Metagenomics Studies Francesca Rizzo, PhD Genomix4life Laboratory of Molecular Medicine and Genomics Department of Medicine and Surgery University of Salerno
More informationJohn Kough, Ph.D. Office Of of Pesticide P rograms Programs
John Kough, Ph.D. Office of Pesticide Programs Microbial Pesticides 78 registered Bacteria (39) 17 Bacillus thuringiensis subspecies 10 other Bacillus species 10 Pseudomonas species 2 Agrobacterium isolates
More informationBacterial Transformation Lab - pglo
Bacterial Transformation Lab - pglo Name: Date: Pre-Lab Score: Lab Overview: In this investigation, you will gain an understanding of the techniques of culturing E. coli bacteria and transforming using
More informationMicrobiomes and metabolomes
Microbiomes and metabolomes Michael Inouye Baker Heart and Diabetes Institute Univ of Melbourne / Monash Univ Summer Institute in Statistical Genetics 2017 Integrative Genomics Module Seattle @minouye271
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationAnalytical Service Code
Mycometrics, LLC. 9 Deer Park Dr. Suite K-18 Monmouth Junction, NJ 08852 Tel: 732-355-9018 Fax: 732-658-5185 Email: quest@mycometrics.com URL: www.mycometrics.com Analytical Service Code Microbial Identification
More informationMetagenomic 3C, full length 16S amplicon sequencing on Illumina, and the diabetic skin microbiome
Also: Sunaina Melissa Gardiner UTS Catherine Burke UTS Michael Liu UTS Chris Beitel UTS, UC Davis Matt DeMaere UTS Metagenomic 3C, full length 16S amplicon sequencing on Illumina, and the diabetic skin
More informationChapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
More informationChapter 9 Genetic Engineering
Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation
More informationEnvironmental Monitoring Solutions
Sanitation Verification Allergen Control General Microbiological Monitoring Pathogen Screening Environmental Monitoring Solutions The Four Pillars of a Robust Environmental Monitoring Program Sanitation
More informationThe Microbiology of Food
The Microbiology of Food Bio 8 - Fall 2018 Tu 6:30PM - 9:00PM Anderson, Room 309 Instructor: Benjamin Wolfe (Assistant Professor, Department of Biology) e-mail: benjamin.wolfe@tufts.edu Office Hours: 3:30-:30pm
More informationBiotechnology. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc., unless otherwise noted
Biotechnology Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc., unless otherwise noted Biotechnology Any technical procedure used to isolate, analyze or manipulate genes
More informationRiboPrinter microbial characterization system
DuPont Qualicon RiboPrinter microbial characterization system Staphylococcus epidermidis RiboGroup 102-45-3 DEDICATED TO MICROBIOLOGY OK. You found it. Now what? RiboPrinter microbial characterization
More informationComputing with large data sets
Computing with large data sets Richard Bonneau, spring 2009 Lecture 14 (week 8): genomics 1 Central dogma Gene expression DNA RNA Protein v22.0480: computing with data, Richard Bonneau Lecture 14 places
More informationONAMER M. PRESERVATIVE and ANTIMICROBIAL ONAMER
ONAMER M PRESERVATIVE and ANTIMICROBIAL ONAMER M Stepan Lipid Nutrition is a division of Stepan Company which manufactures lipid and polymer based ingredients. HO OH SUMMARY Our quaternary ammonium polymer
More informationTargeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales
Targeted Sequencing Using Droplet-Based Microfluidics Keith Brown Director, Sales brownk@raindancetech.com Who we are: is a Provider of Microdroplet-based Solutions The Company s RainStorm TM Technology
More informationSupplementary Information for
Supplementary Information for Microbial community dynamics and stability during an ammonia- induced shift to syntrophic acetate oxidation Jeffrey J. Werner 1,2, Marcelo L. Garcia 3, Sarah D. Perkins 3,
More informationRibotyping Easily Fills in for Whole Genome Sequencing to Characterize Food-borne Pathogens David Sistanich
Ribotyping Easily Fills in for Whole Genome Sequencing to Characterize Food-borne Pathogens David Sistanich Technical Support Specialist Hygiena, LLC Whole genome sequencing (WGS) has become the ultimate
More informationNeed for Standardization in Drinking Water Analyses
30/01-2017 Need for Standardization in Drinking Water Analyses Identification of bacteria using 16S rrna Amplicon Sequencing Jakob Brandt PhD student Per Halkjær Nielsen & Mads Albertsen CENTER FOR MICROBIAL
More informationExploring Chromodomain Genes in the Fungus Fusarium graminearum Through Targeted Genetic Manipulation
Exploring Chromodomain Genes in the Fungus Fusarium graminearum Through Targeted Genetic Manipulation Alec Peters Dr. Michael Freitag Laboratory Dept of Biochemistry/Biophysics Oregon State University
More informationRapid Bacterial Identification Using a Mass Spectrometry Based Molecular Diagnostics Approach: Evaluation of the Iridica Platform
Rapid Bacterial Identification Using a Mass Spectrometry Based Molecular Diagnostics Approach: Evaluation of the Iridica Platform Alec Saitman, PhD, Jane Y. Yang PhD, Sharon Reed, David Pride, Michele
More informationInsight into microbial world molecular biology research in environmental microbiology
Insight into microbial world molecular biology research in environmental microbiology Aleksandra Ziembi ska The Silesian University of Technology, Environmental Biotechnology Department aleksandra.ziembinska@polsl.pl
More informationResearchers use genetic engineering to manipulate DNA.
Section 2: Researchers use genetic engineering to manipulate DNA. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the different tools and processes used in genetic
More informationWater Quality and Waller Creek Dr. Kinney & UTBIOME Collaborators. What is in Waller Creek? A Wide Variety of Biota!
Water Quality and Waller Creek Dr. Kinney & UTBIOME Collaborators The Visible & The Invisible What is in Waller Creek? A Wide Variety of Biota! Yellow crowned Night Heron at 24th Street Bridge June 2003
More informationMochamad Nurcholis. Food Technology Department Agricuktural Technology Faculty Brawijaya University 2013
Mochamad Nurcholis Food Technology Department Agricuktural Technology Faculty Brawijaya University 2013 Microbial Identification Type Conventional Identification DNA Hybridization PCR Amplification DNA
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationAntibiotic Resistance Genes: From The Farm To The Human Gut
Shanghai 2015 Antibiotic Resistance Genes: From The Farm To The Human Gut Baoli Zhu, PhD Institute of Microbiology, Chinese Academy Beijing Key Lab of Microbial Drug Resistance and Resistome zhubaoli@im.ac.cn
More informationCHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.
CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? 35 INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment,
More informationMicrobiome Analysis. Research Day 2012 Ranjit Kumar
Microbiome Analysis Research Day 2012 Ranjit Kumar Human Microbiome Microorganisms Bad or good? Human colon contains up to 100 trillion bacteria. Human microbiome - The community of bacteria that live
More informationProviding clear solutions to microbiological challenges TM. cgmp/iso CLIA. Polyphasic Microbial Identification & DNA Fingerprinting
Providing clear solutions to microbiological challenges TM Cert. No. 2254.01 Polyphasic Microbial Identification & DNA Fingerprinting Microbial Contamination Tracking & Trending cgmp/iso-17025-2005 CLIA
More informationANALYTICAL REPORT: Comparison of the Microbial Recovery Efficacy of QI Medical EnviroTest Paddles versus a Conventional Contact Plate
FOCUS Scientific Services LLC ANALYTICAL REPORT: Comparison of the Microbial Recovery Efficacy of QI Medical EnviroTest Paddles versus a Conventional Contact Plate REPORT: FS-QI-GM-003 Study Manager: Anthony
More informationAccugen Laboratories, Inc.
Lab# 97478-2 www.accugenlabs.com Page 1 of 7 Accugen Laboratories, Inc. FINAL REPORT ASTM G22 ASTM Designation: G22-76(1996) "Standard Practice for determining Resistance of Plastics to Bacteria (Withdrawn
More informationSummary Report. Training Course for Microbial Data Analysis
Summary Report Training Course for Microbial Data Analysis Hosted by: WFCC-MIRCEN World Data Center for Microorganisms (WDCM) Organized by: World Federation for Culture Collections (WFCC) The Center for
More informationMetagenomics Computational Genomics
Metagenomics 02-710 Computational Genomics Metagenomics Investigation of the microbes that inhabit oceans, soils, and the human body, etc. with sequencing technologies Cooperative interactions between
More informationChapter 8 Recombinant DNA Technology. 10/1/ MDufilho
Chapter 8 Recombinant DNA Technology 10/1/2017 1 MDufilho The Role of Recombinant DNA Technology in Biotechnology Biotechnology? Recombinant deoxyribonucleic acid (DNA) technology Intentionally modifying
More informationMethods that do not require growth in laboratory PCR
Methods that do not require growth in laboratory PCR Nucleotide sequencing MLST/MLVST Profiles Microarrays Polymerase Chain Reaction [PCR] Use to find a rare sequence in a pool of many different sequences
More informationGenetics module. DNA Structure, Replication. The Genetic Code; Transcription and Translation. Principles of Heredity; Gene Mapping
Genetics module Lectures DNA Structure, Replication The Genetic Code; Transcription and Translation Principles of Heredity; Gene Mapping Controlling Gene Expression Mutation and Cancer Textbook: Introduction
More informationAnalysis of milk microbial profiles using 16s rrna gene sequencing in milk somatic cells and fat
Analysis of milk microbial profiles using 16s rrna gene sequencing in milk somatic cells and fat Juan F. Medrano Anna Cuzco* Alma Islas-Trejo Armand Sanchez* Olga Francino* Dept. of Animal Science University
More informationAbstract... i. Committee Membership... iii. Foreword... vii. 1 Scope Introduction Standard Precautions References...
Vol. 28 No. 12 Replaces MM18-P Vol. 27 No. 22 Interpretive Criteria for Identification of Bacteria and Fungi by DNA Target Sequencing; Approved Guideline Sequencing DNA targets of cultured isolates provides
More informationBiosc10 schedule reminders
Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,
More informationPractical Bioinformatics for Life Scientists. Week 14, Lecture 27. István Albert Bioinformatics Consulting Center Penn State
Practical Bioinformatics for Life Scientists Week 14, Lecture 27 István Albert Bioinformatics Consulting Center Penn State No homework this week Project to be given out next Thursday (Dec 1 st ) Due following
More informationWhat s Spoiling Your Beer?
What s Spoiling Your Beer? the MiL, Inc. MICROBE INOTECH LABORATORIES, INC. The Microbiology of Beer Contamination Microorganisms that contribute to the spoilage of beer, such as bacteria, wild yeasts,
More informationTECHNICAL LEAFLET. MEDI-MEDIA-FILL KIT SUPPLY PACKAGE (Code: MR-25/S)
TECHNICAL LEAFLET MEDI-MEDIA-FILL KIT SUPPLY PACKAGE (Code: MR-25/S) TEST AGAR PLATES FOR PERSONNEL AND ENVIRONMENTAL MICROBIOLOGICAL MONITORING COMPONENTS: Test Agar Plates Data Log Sheet Technical Leaflet
More informationChallenges in Microbial Assays of Produced Waters L. Keith McLeroy
Challenges in Microbial Assays of Produced Waters L. Keith McLeroy Technical Advisor, M-I SWACO/Schlumberger Introduction Abstract Most often oil and gas produced waters are allowed to either accumulate
More informationMB311 Molecular Microbiology Laboratory. Spring 2017: Tuesday/Thursday 9:00-11:50 am; Nash 304
MB311 Molecular Microbiology Laboratory Spring 2017: Tuesday/Thursday 9:00-11:50 am; Nash 304 Instructor: Dr. Walt Ream reaml@science.oregonstate.edu ALS1081 737-1791 Office Hours: by appointment. Teaching
More informationChapter 10 Genetic Engineering: A Revolution in Molecular Biology
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical
More informationThe right answer, every time
MICROSEQ MICROBIAL IDENTIFICATION SYSTEM The right answer, every time Definitive identification of bacterial and fungal isolates. Accuracy adds confidence. When microbial contamination poses problems,
More informationThe effect of host genetics factors on
The effect of host genetics factors on shaping Die Universität pig gut Hohenheim microbiota M. Maushammer 1, A. Camarinha-Silva 1, M. Vital 2, R. Wellmann 1, S. Preuss 1, J. Bennewitz 1 1 University of
More informationGenomic and Proteomic Analysis of Deep Underground Microbial Communities
Genomic and Proteomic Analysis of Deep Underground Microbial Communities Kenneth F. Reardon, Chemical & Biological Engineering, Colorado State University Amy Pruden, Civil & Environmental Engineering,
More informationCBC Data Therapy. Metagenomics Discussion
CBC Data Therapy Metagenomics Discussion General Workflow Microbial sample Generate Metaomic data Process data (QC, etc.) Analysis Marker Genes Extract DNA Amplify with targeted primers Filter errors,
More informationCurrent molecular diagnostic system
LAMP-BART Name: Chris Wong Supervisor: Prof. Margaret Ip Joint Graduate Seminar Department of Microbiology The Chinese University of Hong Kong 18 th December 2012 Current molecular diagnostic system Detection
More informationGM (Genetically Modified) Plants. Background
1 GM (Genetically Modified) Plants Background Genetically modified crops (GM) have been used since 1996 in the U.S. GM crops contain foreign genetic material The DNA may be from another plant or from a
More informationRiboPrinter microbial characterization system
DuPont Qualicon RiboPrinter microbial characterization system Staphylococcus epidermidis RiboGroup 102-45-3 OK. You found it. Now what? DuPont Qualicon 1.800.863.6842 2 RiboPrinter microbial characterization
More informationUnit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms
Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Duncanrig Secondary JHM&MHC 2015 Page 1 of 18 On completion of this
More informationValidation of qpcr Rapid Bacterial Quantification through Viable E. coli cell count in the Saginaw Bay Watershed
Validation of qpcr Rapid Bacterial Quantification through Viable E. coli cell count in the Saginaw Bay Watershed TYLER LEFEVRE ADVISOR: DR. TAMI SIVY 1 Overview Introduction to fecal coliforms Current
More informationMicroSEQ TM ID Rapid Microbial Identification System:
MicroSEQ TM ID Rapid Microbial Identification System: the complete solution for reliable genotypic microbial identification 1 The world leader in serving science Rapid molecular methods for pharmaceutical
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More information