Eukaryotic Gene Prediction. Wei Zhu May 2007

Size: px
Start display at page:

Download "Eukaryotic Gene Prediction. Wei Zhu May 2007"

Transcription

1 Eukaryotic Gene Prediction Wei Zhu May 2007

2 In nature, nothing is perfect... - Alice Walker

3 Gene Structure

4 What is Gene Prediction? Gene prediction is the problem of parsing a sequence into nonoverlapping coding segments (CDSs) consisting of exons separated by introns.

5 Signal Sensors A signal sensor evaluates fixed-length features in DNA. Start codons Stop codons Donor sites Acceptor sites Promoters Poly-A signals

6 Content Sensors A content sensor evaluates variable-length features which extend from one signal to another: Exons Introns Intergenic regions UTRs

7 Gene Prediction Approaches Intrinsic (ab( initio) GENSCAN, FGENESH, GeneMark.hmm GlimmerM, Genie; Extrinsic (similarity-based) Spliced alignment: GenomeScan, EuGene,, FGENESH+, FGENESH_C, GeneId+, etc; Genomic comparison: TwinScan,, TWAIN, SLAM, SGP, FGENESH_2, etc; Integrated GeneScope, GeneMachine,, JIGSAW, RiceGAAS, Ensembl,, EVM etc.

8 ab initio Gene Prediction Adopt a rigorous probabilistic model of sequence structure and choose the most probable parse according to that probabilistic model. Pros Cons Fast and efficient Remarkable accuracy at the nucleotide level Less than 50% accuracy at the gene level

9 Development of a Gene Finder Build the model Train the model to generate the related parameters Predict/Evaluate

10 Imperfect Model GT..AG A G G T 1-bp intron

11 Nucleotide level Exon level Gene level Accuracy Evaluation

12 Nucleotide/Base Level Prediction accuracy per base coding/non-coding

13 Exon Level Prediction accuracy with respect to exact prediction of exon start and end points

14 Gene/Protein Level Prediction accuracy with respect to the protein product encoded by the predicted gene

15 A Simple Calculation Given x accuracy at exon level, the accuracy of the prediction at the gene level is: P = P (all exons correctly predicted) =x n, where n is the number of exons in the gene. Typically, x<90% and n=5,, then P = 0.9x0.9x0.9x0.9x0.9 = 59%

16 Performance Species-specific setting GC content Gene density Gene/Exon/Intron length distribution Codon usage Benchmark training data set test data set

17 Maize Gene Prediction

18 Gene Finders

19 Accuracy

20 Challenges of Intrinsic Approaches Alternative splicing Nested/overlapped genes Extremely long/short genes Extremely long introns Extremely short exons Non-canonical introns Frame-shift errors Split start codons (that is, the start codon is split by an intron in the genomic sequence) UTR introns Non-ATG triplet as the start codon Polycistronic genes

21 Gene Prediction Approaches Intrinsic (ab( initio) GENSCAN, FGENESH, GeneMark.hmm GlimmerM, Genie; Extrinsic (similarity-based) Spliced alignment: GenomeScan, EuGene,, FGENESH+, FGENESH_C, GeneId+, etc; Genomic comparison: TwinScan,, TWAIN, SLAM, SGP, FGENESH_2, etc; Integrated GeneScope, GeneMachine,, JIGSAW, RiceGAAS, Ensembl,, etc.

22 Similarity-based Gene Prediction EST/cDNA spliced alignment Protein spliced alignment Genomic comparison Intra-genomic Inter-genomic

23 EST/cDNA Spliced Alignment

24 Pros and Cons Pros Cons High accuracy Unavailability or incompleteness of transcript sequence data Extra computation to generate alignments Diverse sequence quality Incomplete full-length cdna Contamination Incorrect sequence orientations

25 Genomic Comparison Microsynteny between M. truncatula and Arabidopsis Hongyan et al, 2003

26 Gene Structure of Syntenic and non-syntenic Homologous Genes Hongyan et al, 2003

27 Comparative Analysis of Cereal Gene Structures

28 Comparative Analysis of Cereal Gene Promoters

29 Pros and Cons Pros Aid to identify low expressed genes Identify genes in multiple species simultaneously Aid to identify transcription factor binding sites Uncover non-protein coding genes Cons Performance will depend on the evolutionary distance between the compared sequences. Exon/intron boundaries may not be conserved

30 Tiling Array

31 ARTADE -ARabidopsis Tiling-Array-based Detection of Exons

32 Gene Prediction Approaches Intrinsic (ab( initio) GENSCAN, FGENESH, GeneMark.hmm GlimmerM, Genie; Extrinsic (similarity-based) Spliced alignment: GenomeScan, EuGene,, FGENESH+, FGENESH_C, GeneId+, etc; Genomic comparison: TwinScan,, TWAIN, SLAM, SGP, FGENESH_2, etc; Integrated GeneScope, GeneMachine,, JIGSAW (combiner), RiceGAAS, Ensembl,, etc.

33 Gene Discovery via Multiple Gene Finders

34 EVM

35 TIGR Rice Genome Annotation Pipeline

36 RiceGAAC

37 Ensembl Gene Prediction Procedure

38 Summary Nothing is perfect Each gene identification approach has its own features and limitations; Genome annotation is an on-going process, and the accuracy is being improved along with the accumulation of the evidence data;trnasnorna trnasnorna

39 Case Study

40 Sorghum-Rice Synteny and EST Read Pair

41 Create a Gene Model

42 Expression Data Data Type EST/FL-cDNA Peptide MPSS SAGE Microarray Tiling array Data Source PASA/Manual curation Koller et al., PNAS, 2002 (6,296 peptides/2,528 fgenesh models) Blake Meyers ( mpss.udel.edu/rice/) 126,663 tags from MGOS ( NSF Rice Oligonucleotide Array project ( ricearrary.org) Deng lab, Yale University

43 Expression Data in Gbrowse

44 GATCGATC I. Library construction Brenner et al., PNAS 97: AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA mrna MPSS SEQUENCING TECHNOLOGY 1) Cut w/ DpnII 2) Ligate MmeI adapter MmeI TTTTT AAAAA 3) Cut to capture bp signature 4) Add DNA barcode, amplify & capture on beads Each bead contains the amplified product derived from the 3 end of a single transcript. II. Loading the flow cell + NNNN III. Sequencing of tags Brenner et al., Nat. Biotech. 18: NNNX NNXN RS RS CODEX1 CODEX2 2) Sequence by hybridization NXNN RS CODEX3 XNNN RS CODEX4 1) Add adaptors 16 cycles for 4 bp 3) Digest with Type IIS enzyme to uncover next 4 bases, repeat cycle

45 Ovary and mature stigma

46 Refine Gene Structure

47 Have no fear of perfection - you'll never reach it. - Salvador Dalí

GenBank Growth. In 2003 ~ 31 million sequences ~ 37 billion base pairs

GenBank Growth. In 2003 ~ 31 million sequences ~ 37 billion base pairs Gene Finding GenBank Growth GenBank Growth In 2003 ~ 31 million sequences ~ 37 billion base pairs GenBank: Exponential Growth Growth of GenBank in billions of base pairs from release 3 in April of 1994

More information

Gene Prediction. Mario Stanke. Institut für Mikrobiologie und Genetik Abteilung Bioinformatik. Gene Prediction p.

Gene Prediction. Mario Stanke. Institut für Mikrobiologie und Genetik Abteilung Bioinformatik. Gene Prediction p. Gene Prediction Mario Stanke mstanke@gwdg.de Institut für Mikrobiologie und Genetik Abteilung Bioinformatik Gene Prediction p.1/23 Why Predict Genes with a Computer? tons of data 39/250 eukaryotic/prokaryotic

More information

TIGR THE INSTITUTE FOR GENOMIC RESEARCH

TIGR THE INSTITUTE FOR GENOMIC RESEARCH Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,

More information

Genscan. The Genscan HMM model Training Genscan Validating Genscan. (c) Devika Subramanian,

Genscan. The Genscan HMM model Training Genscan Validating Genscan. (c) Devika Subramanian, Genscan The Genscan HMM model Training Genscan Validating Genscan (c) Devika Subramanian, 2009 96 Gene structure assumed by Genscan donor site acceptor site (c) Devika Subramanian, 2009 97 A simple model

More information

Outline. Introduction to ab initio and evidence-based gene finding. Prokaryotic gene predictions

Outline. Introduction to ab initio and evidence-based gene finding. Prokaryotic gene predictions Outline Introduction to ab initio and evidence-based gene finding Overview of computational gene predictions Different types of eukaryotic gene predictors Common types of gene prediction errors Wilson

More information

How to design an HMM for a new problem. HMM model structure. Inherent limitation of HMMs. Duration modeling. Duration modeling

How to design an HMM for a new problem. HMM model structure. Inherent limitation of HMMs. Duration modeling. Duration modeling How to design an HMM for a new problem Architecture/topology design: What are the states, observation symbols, and the topology of the state transition graph? Learning/Training: Fully annotated or partially

More information

Outline. Gene Finding Questions. Recap: Prokaryotic gene finding Eukaryotic gene finding The human gene complement Regulation

Outline. Gene Finding Questions. Recap: Prokaryotic gene finding Eukaryotic gene finding The human gene complement Regulation Tues, Nov 29: Gene Finding 1 Online FCE s: Thru Dec 12 Thurs, Dec 1: Gene Finding 2 Tues, Dec 6: PS5 due Project presentations 1 (see course web site for schedule) Thurs, Dec 8 Final papers due Project

More information

GENOME ANNOTATION INTRODUCTION TO CONCEPTS AND METHODS. Olivier GARSMEUR & Stéphanie SIDIBE-BOCS

GENOME ANNOTATION INTRODUCTION TO CONCEPTS AND METHODS. Olivier GARSMEUR & Stéphanie SIDIBE-BOCS GENOME ANNOTATION INTRODUCTION TO CONCEPTS AND METHODS Olivier GARSMEUR & Stéphanie SIDIBE-BOCS Introduction two main concepts: Identify the different elements of the genome, (location and stucture) :

More information

Collect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017

Collect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017 Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l

More information

Collect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018

Collect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018 Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l

More information

Gene Structure & Gene Finding Part II

Gene Structure & Gene Finding Part II Gene Structure & Gene Finding Part II David Wishart david.wishart@ualberta.ca 30,000 metabolite Gene Finding in Eukaryotes Eukaryotes Complex gene structure Large genomes (0.1 to 10 billion bp) Exons and

More information

Genome annotation & EST

Genome annotation & EST Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary

More information

Gene Prediction 10/21/05

Gene Prediction 10/21/05 Gene Prediction 1/21/5 1/21/5 Gene Prediction Announcements Eam 2 - net Friday Posted online: Eam 2 Study Guide 544 Reading Assignment (2 papers) (formerly Gene Prediction - ) 1/21/5 D Dobbs ISU - BCB

More information

UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding

UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene

More information

Gene Identification in silico

Gene Identification in silico Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction

More information

Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)

Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA

More information

A Crash Course in Gene and Genome Annotation

A Crash Course in Gene and Genome Annotation A Crash Course in Gene and Genome Annotation Lieven Sterck, Bioinformatics & Systems Biology VIB-UGent Lieven.sterck@psb.vib-ugent.be This Project is financially supported by the European Commission under

More information

ab initio and Evidence-Based Gene Finding

ab initio and Evidence-Based Gene Finding ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene

More information

ProGen: GPHMM for prokaryotic genomes

ProGen: GPHMM for prokaryotic genomes ProGen: GPHMM for prokaryotic genomes Sharad Akshar Punuganti May 10, 2011 Abstract ProGen is an implementation of a Generalized Pair Hidden Markov Model (GPHMM), a model which can be used to perform both

More information

Methods and Algorithms for Gene Prediction

Methods and Algorithms for Gene Prediction Methods and Algorithms for Gene Prediction Chaochun Wei 韦朝春 Sc.D. ccwei@sjtu.edu.cn http://cbb.sjtu.edu.cn/~ccwei Shanghai Jiao Tong University Shanghai Center for Bioinformation Technology 5/12/2011 K-J-C

More information

AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG

AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT AGCTAGGCTCCGGATGCGACCAGCTTTGATAGATGAATATAGTGT

More information

Gene Regulation 10/19/05

Gene Regulation 10/19/05 10/19/05 Gene Regulation (formerly Gene Prediction - 2) Gene Prediction & Regulation Mon - Overview & Gene structure review: Eukaryotes vs prokaryotes Wed - Regulatory regions: Promoters & enhancers -

More information

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016 Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA

More information

Gene Prediction in Eukaryotes

Gene Prediction in Eukaryotes Gene Prediction in Eukaryotes Jan-Jaap Wesselink Biomol Informatics, S.L. jjw@biomol-informatics.com June 2010/Madrid jjw@biomol-informatics.com (BI) Gene Prediction June 2010/Madrid 1 / 34 Outline 1 Gene

More information

132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, This exposition is based on the following source, which is recommended reading:

132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, This exposition is based on the following source, which is recommended reading: 132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, 214 1 Gene Prediction Using HMMs This exposition is based on the following source, which is recommended reading: 1. Chris Burge and Samuel

More information

FAST AND ACCURATE GENE PREDICTION BY PROTEIN HOMOLOGY

FAST AND ACCURATE GENE PREDICTION BY PROTEIN HOMOLOGY FAST AND ACCURATE GENE PREDICTION BY PROTEIN HOMOLOGY by Rong She Master of Science, Simon Fraser University, 2003 Bachelor of Engineering, Shanghai Jiaotong University, 1993 THESIS SUBMITTED IN PARTIAL

More information

Grundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, This exposition is based on the following source, which is recommended reading:

Grundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, This exposition is based on the following source, which is recommended reading: Grundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, 211 155 12 Gene Prediction Using HMMs This exposition is based on the following source, which is recommended reading: 1. Chris Burge and Samuel

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica

The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database

More information

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance

More information

#26 - Gene Prediction 10/22/07

#26 - Gene Prediction 10/22/07 BCB 444/544 Required Reading (before lecture) Lecture 26 Mon Oct 22 - Lecture 26 Gene Prediction Chp 8 - pp 97-112 Gene Prediction Wed Oct 24 - Lecture 27 (will not be covered on Exam 2) Regulatory Element

More information

Improved Splice Site Detection in Genie

Improved Splice Site Detection in Genie Improved Splice Site Detection in Genie Martin Reese Informatics Group Human Genome Center Lawrence Berkeley National Laboratory MGReese@lbl.gov http://www-hgc.lbl.gov/inf Santa Fe, 1/23/97 Database Homologies

More information

Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ),

Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ), Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ), 2012-01-26 What is a gene What is a transcriptome History of gene expression assessment RNA-seq RNA-seq analysis

More information

CSE 527 Computational Biology Autumn Lectures ~14-15 Gene Prediction

CSE 527 Computational Biology Autumn Lectures ~14-15 Gene Prediction CSE 527 Computational Biology Autumn 2004 Lectures ~14-15 Gene Prediction Some References A great online bib http://www.nslij-genetics.org/gene/ A good intro survey JM Claverie (1997) "Computational methods

More information

Lab Week 9 - A Sample Annotation Problem (adapted by Chris Shaffer from a worksheet by Varun Sundaram, WU-STL, Class of 2009)

Lab Week 9 - A Sample Annotation Problem (adapted by Chris Shaffer from a worksheet by Varun Sundaram, WU-STL, Class of 2009) Lab Week 9 - A Sample Annotation Problem (adapted by Chris Shaffer from a worksheet by Varun Sundaram, WU-STL, Class of 2009) Prerequisites: BLAST Exercise: An In-Depth Introduction to NCBI BLAST Familiarity

More information

Evidence Combination in Hidden Markov Models for Gene Prediction

Evidence Combination in Hidden Markov Models for Gene Prediction Evidence Combination in Hidden Markov Models for Gene Prediction by Bronislava Brejová A thesis presented to the University of Waterloo in fulfilment of the thesis requirement for the degree of Doctor

More information

Annotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence

Annotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence Annotating 7G24-63 Justin Richner May 4, 2005 Zfh2 exons Thd1 exons Pur-alpha exons 0 40 kb 8 = 1 kb = LINE, Penelope = DNA/Transib, Transib1 = DINE = Novel Repeat = LTR/PAO, Diver2 I = LTR/Gypsy, Invader

More information

Annotation of contig27 in the Muller F Element of D. elegans. Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans.

Annotation of contig27 in the Muller F Element of D. elegans. Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans. David Wang Bio 434W 4/27/15 Annotation of contig27 in the Muller F Element of D. elegans Abstract Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans. Genscan predicted six

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

Annotating the Genome (H)

Annotating the Genome (H) Annotating the Genome (H) Annotation principles (H1) What is annotation? In general: annotation = explanatory note* What could be useful as an annotation of a DNA sequence? an amino acid sequence? What

More information

Technical Note. GeneChip Exon Array Design

Technical Note. GeneChip Exon Array Design GeneChip Exon Array Design AFFYMETRIX PRODUCT FAMILY > RNA ARRAYS AND REAGENTS > Technical Note GeneChip Exon Array Design The primary objective for the design of this first-generation GeneChip Exon Array

More information

Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G

Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of

More information

Key Area 1.3: Gene Expression

Key Area 1.3: Gene Expression Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?

More information

Draft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009

Draft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009 Page 1 Draft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009 Page 2 Introduction: Annotation is the process of analyzing the genomic sequence of an organism. Besides identifying

More information

9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3

9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3 cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences

More information

Lecture 7 Motif Databases and Gene Finding

Lecture 7 Motif Databases and Gene Finding Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 7 Motif Databases and Gene Finding Motif Databases & Gene Finding Motifs Recap Motif Databases TRANSFAC

More information

Chapter 1. from genomics to proteomics Ⅱ

Chapter 1. from genomics to proteomics Ⅱ Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more

More information

Genome Annotation. What Does Annotation Describe??? Genome duplications Genes Mobile genetic elements Small repeats Genetic diversity

Genome Annotation. What Does Annotation Describe??? Genome duplications Genes Mobile genetic elements Small repeats Genetic diversity Genome Annotation Genome Sequencing Costliest aspect of sequencing the genome o But Devoid of content Genome must be annotated o Annotation definition Analyzing the raw sequence of a genome and describing

More information

Computational Gene Finding in the Human Malaria Parasite Plasmodium vivax

Computational Gene Finding in the Human Malaria Parasite Plasmodium vivax Honours Thesis Computational Gene Finding in the Human Malaria Parasite Plasmodium vivax Alexander David Stivala 271025 Supervisor: Dr Anthony Wirth October 25, 2006 Abstract Different approaches to genome

More information

EECS730: Introduction to Bioinformatics

EECS730: Introduction to Bioinformatics EECS730: Introduction to Bioinformatics Lecture 08: Gene finding aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggc tatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatt

More information

Introduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph

Introduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph Introduction to Plant Genomics and Online Resources Manish Raizada University of Guelph Genomics Glossary http://www.genomenewsnetwork.org/articles/06_00/sequence_primer.shtml Annotation Adding pertinent

More information

Regulation of bacterial gene expression

Regulation of bacterial gene expression Regulation of bacterial gene expression Gene Expression Gene Expression: RNA and protein synthesis DNA ----------> RNA ----------> Protein transcription translation! DNA replication only occurs in cells

More information

May 16. Gene Finding

May 16. Gene Finding Gene Finding j T[j,k] k i Q is a set of states T is a matrix of transition probabilities T[j,k]: probability of moving from state j to state k Σ is a set of symbols e j (S) is the probability of emitting

More information

GENOME ANNOTATION INTRODUCTION TO CONCEPTS AND METHODS. Olivier GARSMEUR. Training course in Bioinformatics applied to Musa genome November 2013

GENOME ANNOTATION INTRODUCTION TO CONCEPTS AND METHODS. Olivier GARSMEUR. Training course in Bioinformatics applied to Musa genome November 2013 GENOME ANNOTATION INTRODUCTION TO CONCEPTS AND METHODS Olivier GARSMEUR Training course in Bioinformatics applied to Musa genome 18-22 November 2013 Introduction two main concepts: Identify the different

More information

Sequence Analysis. II: Sequence Patterns and Matrices. George Bell, Ph.D. WIBR Bioinformatics and Research Computing

Sequence Analysis. II: Sequence Patterns and Matrices. George Bell, Ph.D. WIBR Bioinformatics and Research Computing Sequence Analysis II: Sequence Patterns and Matrices George Bell, Ph.D. WIBR Bioinformatics and Research Computing Sequence Patterns and Matrices Multiple sequence alignments Sequence patterns Sequence

More information

Annotating Fosmid 14p24 of D. Virilis chromosome 4

Annotating Fosmid 14p24 of D. Virilis chromosome 4 Lo 1 Annotating Fosmid 14p24 of D. Virilis chromosome 4 Lo, Louis April 20, 2006 Annotation Report Introduction In the first half of Research Explorations in Genomics I finished a 38kb fragment of chromosome

More information

BS 50 Genetics and Genomics Week of Oct 24

BS 50 Genetics and Genomics Week of Oct 24 BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.

More information

Transcriptomics. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona

Transcriptomics. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Transcriptomics Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Central dogma of molecular biology Central dogma of molecular biology Genome Complete DNA content of

More information

EGPred: Prediction of Eukaryotic Genes Using Ab Initio Methods After Combining With Sequence Similarity Approaches

EGPred: Prediction of Eukaryotic Genes Using Ab Initio Methods After Combining With Sequence Similarity Approaches Methods EGPred: Prediction of Eukaryotic Genes Using Ab Initio Methods After Combining With Sequence Similarity Approaches Biju Issac and Gajendra Pal Singh Raghava 1 Institute of Microbial Technology,

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

Computational annotation of eukaryotic gene structures: algorithms development and software systems

Computational annotation of eukaryotic gene structures: algorithms development and software systems Retrospective Theses and Dissertations 2007 Computational annotation of eukaryotic gene structures: algorithms development and software systems Michael Edward Sparks Iowa State University Follow this and

More information

Eukaryotic Gene Structure

Eukaryotic Gene Structure Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and

More information

CSE 527 Computational Biology" Gene Prediction"

CSE 527 Computational Biology Gene Prediction CSE 527 Computational Biology" Gene Prediction" Gene Finding: Motivation" Sequence data flooding in" What does it mean?" "protein genes, RNA genes, mitochondria, chloroplast, regulation, replication, structure,

More information

Lecture 10. Ab initio gene finding

Lecture 10. Ab initio gene finding Lecture 10 Ab initio gene finding Uses of probabilistic sequence Segmentation models/hmms Multiple alignment using profile HMMs Prediction of sequence function (gene family models) ** Gene finding ** Review

More information

Chimp Chunk 3-14 Annotation by Matthew Kwong, Ruth Howe, and Hao Yang

Chimp Chunk 3-14 Annotation by Matthew Kwong, Ruth Howe, and Hao Yang Chimp Chunk 3-14 Annotation by Matthew Kwong, Ruth Howe, and Hao Yang Ruth Howe Bio 434W April 1, 2010 INTRODUCTION De novo annotation is the process by which a finished genomic sequence is searched for

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

Bacterial Genome Annotation

Bacterial Genome Annotation Bacterial Genome Annotation Bacterial Genome Annotation For an annotation you want to predict from the sequence, all of... protein-coding genes their stop-start the resulting protein the function the control

More information

Molecular Genetics of Disease and the Human Genome Project

Molecular Genetics of Disease and the Human Genome Project 9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit

More information

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8 Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically

More information

Lecture 2: Biology Basics Continued. Fall 2018 August 23, 2018

Lecture 2: Biology Basics Continued. Fall 2018 August 23, 2018 Lecture 2: Biology Basics Continued Fall 2018 August 23, 2018 Genetic Material for Life Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine,

More information

ChIP-seq and RNA-seq. Farhat Habib

ChIP-seq and RNA-seq. Farhat Habib ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions

More information

Applications of hidden Markov models to sequence analysis. Lior Pachter

Applications of hidden Markov models to sequence analysis. Lior Pachter Applications of hidden Markov models to sequence analysis Lior Pachter Outline Why do we analyze sequences? What are we looking for? Annotation of DNA sequences I (and HMMs) Alignment Annotation of DNA

More information

Machine Learning Methods for RNA-seq-based Transcriptome Reconstruction

Machine Learning Methods for RNA-seq-based Transcriptome Reconstruction Machine Learning Methods for RNA-seq-based Transcriptome Reconstruction Gunnar Rätsch Friedrich Miescher Laboratory Max Planck Society, Tübingen, Germany NGS Bioinformatics Meeting, Paris (March 24, 2010)

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Gene Finding Genome Annotation

Gene Finding Genome Annotation Gene Finding Genome Annotation Gene finding is a cornerstone of genomic analysis Genome content and organization Differential expression analysis Epigenomics Population biology & evolution Medical genomics

More information

DNA is normally found in pairs, held together by hydrogen bonds between the bases

DNA is normally found in pairs, held together by hydrogen bonds between the bases Bioinformatics Biology Review The genetic code is stored in DNA Deoxyribonucleic acid. DNA molecules are chains of four nucleotide bases Guanine, Thymine, Cytosine, Adenine DNA is normally found in pairs,

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline

Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline Xi Wang Bioinformatics Scientist Computational Life Science Page 1 Bayer 4:3 Template 2010 March 2016 17/01/2017

More information

Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010

Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact

More information

user s guide Question 1

user s guide Question 1 Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966

More information

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences

Transcription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different

More information

An introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy

An introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy An introduction to RNA-seq Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy The central dogma Genome = all DNA in an organism (genotype) Transcriptome = all RNA (molecular

More information

Non-conserved intronic motifs in human and mouse are associated with a conserved set of functions

Non-conserved intronic motifs in human and mouse are associated with a conserved set of functions Non-conserved intronic motifs in human and mouse are associated with a conserved set of functions Aristotelis Tsirigos Bioinformatics & Pattern Discovery Group IBM Research Outline. Discovery of DNA motifs

More information

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

More information

Chapter 4 METHOD FOR PREDICTING GENES IN EUKARYOTIC GENOMES

Chapter 4 METHOD FOR PREDICTING GENES IN EUKARYOTIC GENOMES qene Prediction Chapter 4 METHOD FOR PREDICTING GENES IN EUKARYOTIC GENOMES 4.1 INTRODUCTION Evaluation of seven ab initio methods that were evaluated on a non-homologous mammalian data set (Rogic et al.

More information

Transcription is the first stage of gene expression

Transcription is the first stage of gene expression Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the

More information

ChIP-seq and RNA-seq

ChIP-seq and RNA-seq ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)

More information

Computational gene finding

Computational gene finding Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name minichromosome maintenance complex component 8 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID MCM8 Human The protein encoded by

More information

#28 - Promoter Prediction 10/29/07

#28 - Promoter Prediction 10/29/07 BCB 444/544 Required Reading (before lecture) Lecture 28 Mon Oct 29 - Lecture 28 Promoter & Regulatory Element Prediction Chp 9 - pp 113-126 Gene Prediction - finish it Wed Oct 30 - Lecture 29 Phylogenetics

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

Identifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M.

Identifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M. Identifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M. Brent Prerequisites: A Simple Introduction to NCBI BLAST Resources: The GENSCAN

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

RNA-Seq Software, Tools, and Workflows

RNA-Seq Software, Tools, and Workflows RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:

More information

measuring gene expression December 5, 2017

measuring gene expression December 5, 2017 measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the

More information

Comparative Genomics. Page 1. REMINDER: BMI 214 Industry Night. We ve already done some comparative genomics. Loose Definition. Human vs.

Comparative Genomics. Page 1. REMINDER: BMI 214 Industry Night. We ve already done some comparative genomics. Loose Definition. Human vs. Page 1 REMINDER: BMI 214 Industry Night Comparative Genomics Russ B. Altman BMI 214 CS 274 Location: Here (Thornton 102), on TV too. Time: 7:30-9:00 PM (May 21, 2002) Speakers: Francisco De La Vega, Applied

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the

More information

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018 Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT

More information