Eukaryotic Gene Prediction. Wei Zhu May 2007
|
|
- Claude Jones
- 6 years ago
- Views:
Transcription
1 Eukaryotic Gene Prediction Wei Zhu May 2007
2 In nature, nothing is perfect... - Alice Walker
3 Gene Structure
4 What is Gene Prediction? Gene prediction is the problem of parsing a sequence into nonoverlapping coding segments (CDSs) consisting of exons separated by introns.
5 Signal Sensors A signal sensor evaluates fixed-length features in DNA. Start codons Stop codons Donor sites Acceptor sites Promoters Poly-A signals
6 Content Sensors A content sensor evaluates variable-length features which extend from one signal to another: Exons Introns Intergenic regions UTRs
7 Gene Prediction Approaches Intrinsic (ab( initio) GENSCAN, FGENESH, GeneMark.hmm GlimmerM, Genie; Extrinsic (similarity-based) Spliced alignment: GenomeScan, EuGene,, FGENESH+, FGENESH_C, GeneId+, etc; Genomic comparison: TwinScan,, TWAIN, SLAM, SGP, FGENESH_2, etc; Integrated GeneScope, GeneMachine,, JIGSAW, RiceGAAS, Ensembl,, EVM etc.
8 ab initio Gene Prediction Adopt a rigorous probabilistic model of sequence structure and choose the most probable parse according to that probabilistic model. Pros Cons Fast and efficient Remarkable accuracy at the nucleotide level Less than 50% accuracy at the gene level
9 Development of a Gene Finder Build the model Train the model to generate the related parameters Predict/Evaluate
10 Imperfect Model GT..AG A G G T 1-bp intron
11 Nucleotide level Exon level Gene level Accuracy Evaluation
12 Nucleotide/Base Level Prediction accuracy per base coding/non-coding
13 Exon Level Prediction accuracy with respect to exact prediction of exon start and end points
14 Gene/Protein Level Prediction accuracy with respect to the protein product encoded by the predicted gene
15 A Simple Calculation Given x accuracy at exon level, the accuracy of the prediction at the gene level is: P = P (all exons correctly predicted) =x n, where n is the number of exons in the gene. Typically, x<90% and n=5,, then P = 0.9x0.9x0.9x0.9x0.9 = 59%
16 Performance Species-specific setting GC content Gene density Gene/Exon/Intron length distribution Codon usage Benchmark training data set test data set
17 Maize Gene Prediction
18 Gene Finders
19 Accuracy
20 Challenges of Intrinsic Approaches Alternative splicing Nested/overlapped genes Extremely long/short genes Extremely long introns Extremely short exons Non-canonical introns Frame-shift errors Split start codons (that is, the start codon is split by an intron in the genomic sequence) UTR introns Non-ATG triplet as the start codon Polycistronic genes
21 Gene Prediction Approaches Intrinsic (ab( initio) GENSCAN, FGENESH, GeneMark.hmm GlimmerM, Genie; Extrinsic (similarity-based) Spliced alignment: GenomeScan, EuGene,, FGENESH+, FGENESH_C, GeneId+, etc; Genomic comparison: TwinScan,, TWAIN, SLAM, SGP, FGENESH_2, etc; Integrated GeneScope, GeneMachine,, JIGSAW, RiceGAAS, Ensembl,, etc.
22 Similarity-based Gene Prediction EST/cDNA spliced alignment Protein spliced alignment Genomic comparison Intra-genomic Inter-genomic
23 EST/cDNA Spliced Alignment
24 Pros and Cons Pros Cons High accuracy Unavailability or incompleteness of transcript sequence data Extra computation to generate alignments Diverse sequence quality Incomplete full-length cdna Contamination Incorrect sequence orientations
25 Genomic Comparison Microsynteny between M. truncatula and Arabidopsis Hongyan et al, 2003
26 Gene Structure of Syntenic and non-syntenic Homologous Genes Hongyan et al, 2003
27 Comparative Analysis of Cereal Gene Structures
28 Comparative Analysis of Cereal Gene Promoters
29 Pros and Cons Pros Aid to identify low expressed genes Identify genes in multiple species simultaneously Aid to identify transcription factor binding sites Uncover non-protein coding genes Cons Performance will depend on the evolutionary distance between the compared sequences. Exon/intron boundaries may not be conserved
30 Tiling Array
31 ARTADE -ARabidopsis Tiling-Array-based Detection of Exons
32 Gene Prediction Approaches Intrinsic (ab( initio) GENSCAN, FGENESH, GeneMark.hmm GlimmerM, Genie; Extrinsic (similarity-based) Spliced alignment: GenomeScan, EuGene,, FGENESH+, FGENESH_C, GeneId+, etc; Genomic comparison: TwinScan,, TWAIN, SLAM, SGP, FGENESH_2, etc; Integrated GeneScope, GeneMachine,, JIGSAW (combiner), RiceGAAS, Ensembl,, etc.
33 Gene Discovery via Multiple Gene Finders
34 EVM
35 TIGR Rice Genome Annotation Pipeline
36 RiceGAAC
37 Ensembl Gene Prediction Procedure
38 Summary Nothing is perfect Each gene identification approach has its own features and limitations; Genome annotation is an on-going process, and the accuracy is being improved along with the accumulation of the evidence data;trnasnorna trnasnorna
39 Case Study
40 Sorghum-Rice Synteny and EST Read Pair
41 Create a Gene Model
42 Expression Data Data Type EST/FL-cDNA Peptide MPSS SAGE Microarray Tiling array Data Source PASA/Manual curation Koller et al., PNAS, 2002 (6,296 peptides/2,528 fgenesh models) Blake Meyers ( mpss.udel.edu/rice/) 126,663 tags from MGOS ( NSF Rice Oligonucleotide Array project ( ricearrary.org) Deng lab, Yale University
43 Expression Data in Gbrowse
44 GATCGATC I. Library construction Brenner et al., PNAS 97: AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA AAAAAAA mrna MPSS SEQUENCING TECHNOLOGY 1) Cut w/ DpnII 2) Ligate MmeI adapter MmeI TTTTT AAAAA 3) Cut to capture bp signature 4) Add DNA barcode, amplify & capture on beads Each bead contains the amplified product derived from the 3 end of a single transcript. II. Loading the flow cell + NNNN III. Sequencing of tags Brenner et al., Nat. Biotech. 18: NNNX NNXN RS RS CODEX1 CODEX2 2) Sequence by hybridization NXNN RS CODEX3 XNNN RS CODEX4 1) Add adaptors 16 cycles for 4 bp 3) Digest with Type IIS enzyme to uncover next 4 bases, repeat cycle
45 Ovary and mature stigma
46 Refine Gene Structure
47 Have no fear of perfection - you'll never reach it. - Salvador Dalí
GenBank Growth. In 2003 ~ 31 million sequences ~ 37 billion base pairs
Gene Finding GenBank Growth GenBank Growth In 2003 ~ 31 million sequences ~ 37 billion base pairs GenBank: Exponential Growth Growth of GenBank in billions of base pairs from release 3 in April of 1994
More informationGene Prediction. Mario Stanke. Institut für Mikrobiologie und Genetik Abteilung Bioinformatik. Gene Prediction p.
Gene Prediction Mario Stanke mstanke@gwdg.de Institut für Mikrobiologie und Genetik Abteilung Bioinformatik Gene Prediction p.1/23 Why Predict Genes with a Computer? tons of data 39/250 eukaryotic/prokaryotic
More informationTIGR THE INSTITUTE FOR GENOMIC RESEARCH
Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,
More informationGenscan. The Genscan HMM model Training Genscan Validating Genscan. (c) Devika Subramanian,
Genscan The Genscan HMM model Training Genscan Validating Genscan (c) Devika Subramanian, 2009 96 Gene structure assumed by Genscan donor site acceptor site (c) Devika Subramanian, 2009 97 A simple model
More informationOutline. Introduction to ab initio and evidence-based gene finding. Prokaryotic gene predictions
Outline Introduction to ab initio and evidence-based gene finding Overview of computational gene predictions Different types of eukaryotic gene predictors Common types of gene prediction errors Wilson
More informationHow to design an HMM for a new problem. HMM model structure. Inherent limitation of HMMs. Duration modeling. Duration modeling
How to design an HMM for a new problem Architecture/topology design: What are the states, observation symbols, and the topology of the state transition graph? Learning/Training: Fully annotated or partially
More informationOutline. Gene Finding Questions. Recap: Prokaryotic gene finding Eukaryotic gene finding The human gene complement Regulation
Tues, Nov 29: Gene Finding 1 Online FCE s: Thru Dec 12 Thurs, Dec 1: Gene Finding 2 Tues, Dec 6: PS5 due Project presentations 1 (see course web site for schedule) Thurs, Dec 8 Final papers due Project
More informationGENOME ANNOTATION INTRODUCTION TO CONCEPTS AND METHODS. Olivier GARSMEUR & Stéphanie SIDIBE-BOCS
GENOME ANNOTATION INTRODUCTION TO CONCEPTS AND METHODS Olivier GARSMEUR & Stéphanie SIDIBE-BOCS Introduction two main concepts: Identify the different elements of the genome, (location and stucture) :
More informationCollect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
More informationCollect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
More informationGene Structure & Gene Finding Part II
Gene Structure & Gene Finding Part II David Wishart david.wishart@ualberta.ca 30,000 metabolite Gene Finding in Eukaryotes Eukaryotes Complex gene structure Large genomes (0.1 to 10 billion bp) Exons and
More informationGenome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
More informationGene Prediction 10/21/05
Gene Prediction 1/21/5 1/21/5 Gene Prediction Announcements Eam 2 - net Friday Posted online: Eam 2 Study Guide 544 Reading Assignment (2 papers) (formerly Gene Prediction - ) 1/21/5 D Dobbs ISU - BCB
More informationUCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
More informationGene Identification in silico
Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction
More informationGenome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
More informationA Crash Course in Gene and Genome Annotation
A Crash Course in Gene and Genome Annotation Lieven Sterck, Bioinformatics & Systems Biology VIB-UGent Lieven.sterck@psb.vib-ugent.be This Project is financially supported by the European Commission under
More informationab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
More informationProGen: GPHMM for prokaryotic genomes
ProGen: GPHMM for prokaryotic genomes Sharad Akshar Punuganti May 10, 2011 Abstract ProGen is an implementation of a Generalized Pair Hidden Markov Model (GPHMM), a model which can be used to perform both
More informationMethods and Algorithms for Gene Prediction
Methods and Algorithms for Gene Prediction Chaochun Wei 韦朝春 Sc.D. ccwei@sjtu.edu.cn http://cbb.sjtu.edu.cn/~ccwei Shanghai Jiao Tong University Shanghai Center for Bioinformation Technology 5/12/2011 K-J-C
More informationAGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG
AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT AGCTAGGCTCCGGATGCGACCAGCTTTGATAGATGAATATAGTGT
More informationGene Regulation 10/19/05
10/19/05 Gene Regulation (formerly Gene Prediction - 2) Gene Prediction & Regulation Mon - Overview & Gene structure review: Eukaryotes vs prokaryotes Wed - Regulatory regions: Promoters & enhancers -
More informationBi 8 Lecture 5. Ellen Rothenberg 19 January 2016
Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA
More informationGene Prediction in Eukaryotes
Gene Prediction in Eukaryotes Jan-Jaap Wesselink Biomol Informatics, S.L. jjw@biomol-informatics.com June 2010/Madrid jjw@biomol-informatics.com (BI) Gene Prediction June 2010/Madrid 1 / 34 Outline 1 Gene
More information132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, This exposition is based on the following source, which is recommended reading:
132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, 214 1 Gene Prediction Using HMMs This exposition is based on the following source, which is recommended reading: 1. Chris Burge and Samuel
More informationFAST AND ACCURATE GENE PREDICTION BY PROTEIN HOMOLOGY
FAST AND ACCURATE GENE PREDICTION BY PROTEIN HOMOLOGY by Rong She Master of Science, Simon Fraser University, 2003 Bachelor of Engineering, Shanghai Jiaotong University, 1993 THESIS SUBMITTED IN PARTIAL
More informationGrundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, This exposition is based on the following source, which is recommended reading:
Grundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, 211 155 12 Gene Prediction Using HMMs This exposition is based on the following source, which is recommended reading: 1. Chris Burge and Samuel
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationThe Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica
The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database
More informationIntroduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
More information#26 - Gene Prediction 10/22/07
BCB 444/544 Required Reading (before lecture) Lecture 26 Mon Oct 22 - Lecture 26 Gene Prediction Chp 8 - pp 97-112 Gene Prediction Wed Oct 24 - Lecture 27 (will not be covered on Exam 2) Regulatory Element
More informationImproved Splice Site Detection in Genie
Improved Splice Site Detection in Genie Martin Reese Informatics Group Human Genome Center Lawrence Berkeley National Laboratory MGReese@lbl.gov http://www-hgc.lbl.gov/inf Santa Fe, 1/23/97 Database Homologies
More informationAnalysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ),
Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ), 2012-01-26 What is a gene What is a transcriptome History of gene expression assessment RNA-seq RNA-seq analysis
More informationCSE 527 Computational Biology Autumn Lectures ~14-15 Gene Prediction
CSE 527 Computational Biology Autumn 2004 Lectures ~14-15 Gene Prediction Some References A great online bib http://www.nslij-genetics.org/gene/ A good intro survey JM Claverie (1997) "Computational methods
More informationLab Week 9 - A Sample Annotation Problem (adapted by Chris Shaffer from a worksheet by Varun Sundaram, WU-STL, Class of 2009)
Lab Week 9 - A Sample Annotation Problem (adapted by Chris Shaffer from a worksheet by Varun Sundaram, WU-STL, Class of 2009) Prerequisites: BLAST Exercise: An In-Depth Introduction to NCBI BLAST Familiarity
More informationEvidence Combination in Hidden Markov Models for Gene Prediction
Evidence Combination in Hidden Markov Models for Gene Prediction by Bronislava Brejová A thesis presented to the University of Waterloo in fulfilment of the thesis requirement for the degree of Doctor
More informationAnnotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence
Annotating 7G24-63 Justin Richner May 4, 2005 Zfh2 exons Thd1 exons Pur-alpha exons 0 40 kb 8 = 1 kb = LINE, Penelope = DNA/Transib, Transib1 = DINE = Novel Repeat = LTR/PAO, Diver2 I = LTR/Gypsy, Invader
More informationAnnotation of contig27 in the Muller F Element of D. elegans. Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans.
David Wang Bio 434W 4/27/15 Annotation of contig27 in the Muller F Element of D. elegans Abstract Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans. Genscan predicted six
More informationThe Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
More informationAnnotating the Genome (H)
Annotating the Genome (H) Annotation principles (H1) What is annotation? In general: annotation = explanatory note* What could be useful as an annotation of a DNA sequence? an amino acid sequence? What
More informationTechnical Note. GeneChip Exon Array Design
GeneChip Exon Array Design AFFYMETRIX PRODUCT FAMILY > RNA ARRAYS AND REAGENTS > Technical Note GeneChip Exon Array Design The primary objective for the design of this first-generation GeneChip Exon Array
More informationAnnotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More informationDraft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009
Page 1 Draft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009 Page 2 Introduction: Annotation is the process of analyzing the genomic sequence of an organism. Besides identifying
More information9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3
cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences
More informationLecture 7 Motif Databases and Gene Finding
Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 7 Motif Databases and Gene Finding Motif Databases & Gene Finding Motifs Recap Motif Databases TRANSFAC
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationGenome Annotation. What Does Annotation Describe??? Genome duplications Genes Mobile genetic elements Small repeats Genetic diversity
Genome Annotation Genome Sequencing Costliest aspect of sequencing the genome o But Devoid of content Genome must be annotated o Annotation definition Analyzing the raw sequence of a genome and describing
More informationComputational Gene Finding in the Human Malaria Parasite Plasmodium vivax
Honours Thesis Computational Gene Finding in the Human Malaria Parasite Plasmodium vivax Alexander David Stivala 271025 Supervisor: Dr Anthony Wirth October 25, 2006 Abstract Different approaches to genome
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 08: Gene finding aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggc tatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatt
More informationIntroduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph
Introduction to Plant Genomics and Online Resources Manish Raizada University of Guelph Genomics Glossary http://www.genomenewsnetwork.org/articles/06_00/sequence_primer.shtml Annotation Adding pertinent
More informationRegulation of bacterial gene expression
Regulation of bacterial gene expression Gene Expression Gene Expression: RNA and protein synthesis DNA ----------> RNA ----------> Protein transcription translation! DNA replication only occurs in cells
More informationMay 16. Gene Finding
Gene Finding j T[j,k] k i Q is a set of states T is a matrix of transition probabilities T[j,k]: probability of moving from state j to state k Σ is a set of symbols e j (S) is the probability of emitting
More informationGENOME ANNOTATION INTRODUCTION TO CONCEPTS AND METHODS. Olivier GARSMEUR. Training course in Bioinformatics applied to Musa genome November 2013
GENOME ANNOTATION INTRODUCTION TO CONCEPTS AND METHODS Olivier GARSMEUR Training course in Bioinformatics applied to Musa genome 18-22 November 2013 Introduction two main concepts: Identify the different
More informationSequence Analysis. II: Sequence Patterns and Matrices. George Bell, Ph.D. WIBR Bioinformatics and Research Computing
Sequence Analysis II: Sequence Patterns and Matrices George Bell, Ph.D. WIBR Bioinformatics and Research Computing Sequence Patterns and Matrices Multiple sequence alignments Sequence patterns Sequence
More informationAnnotating Fosmid 14p24 of D. Virilis chromosome 4
Lo 1 Annotating Fosmid 14p24 of D. Virilis chromosome 4 Lo, Louis April 20, 2006 Annotation Report Introduction In the first half of Research Explorations in Genomics I finished a 38kb fragment of chromosome
More informationBS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
More informationTranscriptomics. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona
Transcriptomics Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Central dogma of molecular biology Central dogma of molecular biology Genome Complete DNA content of
More informationEGPred: Prediction of Eukaryotic Genes Using Ab Initio Methods After Combining With Sequence Similarity Approaches
Methods EGPred: Prediction of Eukaryotic Genes Using Ab Initio Methods After Combining With Sequence Similarity Approaches Biju Issac and Gajendra Pal Singh Raghava 1 Institute of Microbial Technology,
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationComputational annotation of eukaryotic gene structures: algorithms development and software systems
Retrospective Theses and Dissertations 2007 Computational annotation of eukaryotic gene structures: algorithms development and software systems Michael Edward Sparks Iowa State University Follow this and
More informationEukaryotic Gene Structure
Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and
More informationCSE 527 Computational Biology" Gene Prediction"
CSE 527 Computational Biology" Gene Prediction" Gene Finding: Motivation" Sequence data flooding in" What does it mean?" "protein genes, RNA genes, mitochondria, chloroplast, regulation, replication, structure,
More informationLecture 10. Ab initio gene finding
Lecture 10 Ab initio gene finding Uses of probabilistic sequence Segmentation models/hmms Multiple alignment using profile HMMs Prediction of sequence function (gene family models) ** Gene finding ** Review
More informationChimp Chunk 3-14 Annotation by Matthew Kwong, Ruth Howe, and Hao Yang
Chimp Chunk 3-14 Annotation by Matthew Kwong, Ruth Howe, and Hao Yang Ruth Howe Bio 434W April 1, 2010 INTRODUCTION De novo annotation is the process by which a finished genomic sequence is searched for
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationBacterial Genome Annotation
Bacterial Genome Annotation Bacterial Genome Annotation For an annotation you want to predict from the sequence, all of... protein-coding genes their stop-start the resulting protein the function the control
More informationMolecular Genetics of Disease and the Human Genome Project
9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit
More informationBi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
More informationLecture 2: Biology Basics Continued. Fall 2018 August 23, 2018
Lecture 2: Biology Basics Continued Fall 2018 August 23, 2018 Genetic Material for Life Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine,
More informationChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
More informationApplications of hidden Markov models to sequence analysis. Lior Pachter
Applications of hidden Markov models to sequence analysis Lior Pachter Outline Why do we analyze sequences? What are we looking for? Annotation of DNA sequences I (and HMMs) Alignment Annotation of DNA
More informationMachine Learning Methods for RNA-seq-based Transcriptome Reconstruction
Machine Learning Methods for RNA-seq-based Transcriptome Reconstruction Gunnar Rätsch Friedrich Miescher Laboratory Max Planck Society, Tübingen, Germany NGS Bioinformatics Meeting, Paris (March 24, 2010)
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationGene Finding Genome Annotation
Gene Finding Genome Annotation Gene finding is a cornerstone of genomic analysis Genome content and organization Differential expression analysis Epigenomics Population biology & evolution Medical genomics
More informationDNA is normally found in pairs, held together by hydrogen bonds between the bases
Bioinformatics Biology Review The genetic code is stored in DNA Deoxyribonucleic acid. DNA molecules are chains of four nucleotide bases Guanine, Thymine, Cytosine, Adenine DNA is normally found in pairs,
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationWheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline
Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline Xi Wang Bioinformatics Scientist Computational Life Science Page 1 Bayer 4:3 Template 2010 March 2016 17/01/2017
More informationGenomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact
More informationuser s guide Question 1
Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966
More informationTranscription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences
Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different
More informationAn introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy
An introduction to RNA-seq Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy The central dogma Genome = all DNA in an organism (genotype) Transcriptome = all RNA (molecular
More informationNon-conserved intronic motifs in human and mouse are associated with a conserved set of functions
Non-conserved intronic motifs in human and mouse are associated with a conserved set of functions Aristotelis Tsirigos Bioinformatics & Pattern Discovery Group IBM Research Outline. Discovery of DNA motifs
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More informationChapter 4 METHOD FOR PREDICTING GENES IN EUKARYOTIC GENOMES
qene Prediction Chapter 4 METHOD FOR PREDICTING GENES IN EUKARYOTIC GENOMES 4.1 INTRODUCTION Evaluation of seven ab initio methods that were evaluated on a non-homologous mammalian data set (Rogic et al.
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationChIP-seq and RNA-seq
ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)
More informationComputational gene finding
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
More informationPrimePCR Assay Validation Report
Gene Information Gene Name minichromosome maintenance complex component 8 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID MCM8 Human The protein encoded by
More information#28 - Promoter Prediction 10/29/07
BCB 444/544 Required Reading (before lecture) Lecture 28 Mon Oct 29 - Lecture 28 Promoter & Regulatory Element Prediction Chp 9 - pp 113-126 Gene Prediction - finish it Wed Oct 30 - Lecture 29 Phylogenetics
More informationBiology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
More informationIdentifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M.
Identifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M. Brent Prerequisites: A Simple Introduction to NCBI BLAST Resources: The GENSCAN
More informationUnit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
More informationRNA-Seq Software, Tools, and Workflows
RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:
More informationmeasuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
More informationPrimePCR Assay Validation Report
Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the
More informationComparative Genomics. Page 1. REMINDER: BMI 214 Industry Night. We ve already done some comparative genomics. Loose Definition. Human vs.
Page 1 REMINDER: BMI 214 Industry Night Comparative Genomics Russ B. Altman BMI 214 CS 274 Location: Here (Thornton 102), on TV too. Time: 7:30-9:00 PM (May 21, 2002) Speakers: Francisco De La Vega, Applied
More informationPrimePCR Assay Validation Report
Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the
More informationOutline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018
Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT
More information