Insights into thrombotic thrombocytopenic purpura by monoclonal antibody-based analysis of the von Willebrand factor cleaving protease, ADAMTS-13

Transcription

1 Faculteit Wetenschappen Departement Chemie Afdeling Biochemie Laboratorium voor Trombose Onderzoek KATHOLIEKE UNIVERSITEIT LEUVEN CAMPUS KORTRIJK Insights into thrombotic thrombocytopenic purpura by monoclonal antibody-based analysis of the von Willebrand factor cleaving protease, ADAMTS-13 Hendrik Feys Proefschrift tot het behalen van de graad van Doctor in de Wetenschappen, 2006 Promotoren: Prof. Dr. H. Deckmyn Prof. Dr. K. Vanhoorelbeke

2

3 Faculteit Wetenschappen Departement Chemie Afdeling Biochemie Laboratorium voor Trombose Onderzoek KATHOLIEKE UNIVERSITEIT LEUVEN CAMPUS KORTRIJK Insights into thrombotic thrombocytopenic purpura by monoclonal antibody-based analysis of the von Willebrand factor cleaving protease, ADAMTS-13 Hendrik Feys Proefschrift tot het behalen van de graad van Doctor in de Wetenschappen, 2006 Promotoren: Prof. Dr. H. Deckmyn Prof. Dr. K. Vanhoorelbeke

4

5 TABLE OF CONTENTS List of abbreviations Aims of the study 13 CHAPTER 1. GENERAL INTRODUCTION Hemostasis Platelets in primary hemostasis Adhesion; GP Ib/IX/V complex, integrin GP Ia/IIa and GP VI Activation and Release Aggregation; Integrin GP IIb/IIIa and Fibrinogen Von Willebrand factor (VWF) Structure-function relationship of VWF domains A1 and A3 domains: interaction with platelet GPIb/IX/V and subendothelium Interaction with subendothelium: domain A3 (and domain A1) Interaction with platelet GP Ib/IX/V: domain A Interactions with integrins α v β 3 and α IIb β 3 ; Domain C FVIII stabilization: involvement of domain region D -D The maverick stuck in the middle: domain A Other interactions VWF gene and biosynthesis VWF regulation of transcription Biosynthesis of VWF Storage and Secretion of VWF Size control of VWF multimers ADAMTS Historical outline ADAMTS-family of metalloproteinases ADAMTS-13 structure ADAMTS-13 mode of action Thrombotic thrombocytopenic purpura (TTP) Acquired TTP Hereditary TTP (Upshaw-Schulman syndrome) TTP Animal Model References 45

6 CHAPTER 2. DEVELOPMENT OF ANTI-HUMAN ADAMTS-13 ANTIBODIES Abstract Introduction Materials and Methods Cloning, Expression and Characterization of recombinant ADAMTS-13 (radamts-13) Cloning of ADAMTS Expression of radamts Purification and Concentration Determination of recombinant ADAMTS Activity Assay for ADAMTS Cloning and Expression of recombinant CUB2 Domain Cloning of recombinant CUB2 Domain Expression of recombinant CUB2 Domain Generation and Characterization of polyclonal anti-cub2 Antiserum Generation of polyclonal anti-cub2 Antiserum Characterization of polyclonal anti-cub2 Antiserum Anti-ADAMTS-13 screening ELISA ELISA to immobilize radamts Immunization Protocol Immunoprecipitation for domain mapping of mabs Other Results Recombinant ADAMTS-13 is an active VWF cleaving Protease Development of an ADAMTS-13 specific screening Assay Expression of recombinant CUB2 Domain Generation of a polyclonal anti-cub2 Antiserum Setting up a specific anti-adamts-13 screening Assay Development of mabs, combining genetic and classical Immunization Methods Initial Characterization of mabs Intact disulphide bridges are important for recognition of most epitopes Domain mapping of mabs using immunoprecipitation mab 3H9 inhibits ADAMTS-13 function Discussion Addendum Acknowledgements Contributions References 84

7 CHAPTER 3. ADAMTS-13 PLASMA LEVEL DETERMINATION UNCOVERS ANTIGEN ABSENCE IN ACQUIRED THROMBOTIC THROMBOCYTOPENIC PURPURA AND ETHNIC DIFFERENCES Abstract Introduction Materials and Methods Production of polyclonal antiserum against recombinant CUB2 (also see Chapter 2) Production of recombinant ADAMTS-13 (also see Chapter 2) SDS-PAGE and Western Blot DNA Immunization Fusion and Screening of hybridomas Immunosorbent and inhibition assays with radamts ADAMTS-13 antigen assay Results Generation of mabs against ADAMTS Binding of anti-adamts-13 mabs to radamts Sandwich ELISA for detection of plasma ADAMTS Properties of the ADAMTS-13 antigen ELISA and choice of standard ADAMTS-13 antigen levels in a Chinese pedigree with TTP ADAMTS-13 antigen levels in TTP patients Optimization Discussion Contributions References 101 CHAPTER 4. ADAMTS-13 PLASMA ANTIGEN TITER CHANGES IN HEALTH AND DISEASE Abstract Introduction Materials and Methods Blood collection and normal pool Physiological conditions Pathologic conditions ADAMTS-13 antigen ELISA Multimer analysis and densitometric scanning C-reactive protein measurements Statistical analysis Results Physiologic Conditions ADAMTS-13 antigen levels decrease in elderly 111

8 ADAMTS-13 is low in neonates and very low in the umbilical cord ADAMTS-13 antigen in women on oral contraceptives and in pregnancy Pathologic conditions Post operative state Inflammatory bowel disease (IBD) Severe sepsis ADAMTS-13 antigen in liver cirrhosis Discussion Contributions References 123 CHAPTER 5. IN VITRO STUDY OF A NOVEL ADAMTS-13 MUTATION (R1095W) Abstract Introduction Materials and Methods Genotyping Mutagenesis Expression of ADAMTS-13 variants Activity measurements Antigen measurements Western blotting Immunoflurescent staining Results Genotyping reveals the presence of a novel mutation and a polymorphism In vitro study on R1095W Expression yield Determination of specific VWF cleaving activity Immunofluorescent staining Discussion Contributions References 139 CHAPTER 6. GENERAL DISCUSSION AND FUTURE PERSPECTIVES 143 CHAPTER 7. NEDERLANDSTALIGE SAMENVATTING 149 Dankwoord 158 Scientific Achievements 175

9 LIST OF ABBREVIATIONS a.o. ADAM ADAMTS-13 ADP AHF ATP approx. a-v5 bp BSA CD cdna CHO CRP cttp Cys-rich Da DAPI DIC DL DNA E.C. e.g. EC 50 ECL ECM EDTA ELISA ER et al etc FBS FcR Fg FITC FIX FIXa FRETS-VWF73 amongst others A Disintegrin And Metalloprotease A Disintegrin And Metalloprotease with ThromboSpondin-1 motifs adenosine diphosphate anti-hemophilic factor adenosine triphosphate Approximately anti-v5 basepairs Bovine Serum Albumin cluster of differentiation Copy Deoxyribonucleic Acid Chinese Hamster Ovary C-reactive protein Congenital TTP Cystein-rich Dalton (non-standard unit for molecular weight ) 4'-6-Diamidino-2-phenylindole Disseminated Intravascular Coagulation Detection Limit Deoxyribonucleic Acid Enzyme Class for example Effective concentration; concentration at half maximum Enhance Chemiluminescence Extracellular Matrix Ethylene diamine tetraacetic acid Enzyme-Linked Immunosorbent Assay Endoplasmic reticulum et alia; and others etcetera Fetal Bovine Serum Fc receptor Fibrinogen Fluoresceine Isothiocyanate (clotting) factor IX activated (clotting) factor IX Trivial name for a synthetic and fluorogenic ADAMTS-13 substrate

10 FVIII (clotting) factor VIII FX (clotting) factor X GAM Goat anti-mouse GP Glycoprotein GuHCl Guanidine hydrochloride HEPES N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (buffer component) HIV Human Immunodeficiency Virus HRP Horse Radish Peroxidase HUS Hemolytic Uremic Syndrome HUVEC Human umbilical vein endothelial cell i.c. In casu; in this case i.e. that is IBD Inflammatory Bowel Disease IC 50 Ig IL IPTG ISTH kb kda LB LRR Inhibitory concentration at half maximum Immunoglobulin Interleukin β-isopropylthiogalactoside International Society of Thrombosis and Haemostasis 10 3 basepairs Kilodalton (10 3 dalton) Luria Broth Leucine-rich repeat M Molar (mol L -1 ) m/v Mass percentage mab Monoclonal Antibody Met-turn Methionin turn MP Multi Purpose mrna Messenger RNA (Ribonucleic acid) NB Neonate NHP Normal Human pooled Plasma no. Number OD xnm OPD PBS Optical Density; a measure for the absorbance at a wavelength of x nm o-phenylenediamine dihydrochloride Phosphate buffered saline PBS-T Phosphate buffered saline supplemented with 0.1 % (v/v) Tween 20 PCR Polymerase Chain Reaction PE Plasma Exchange PT Prothrombin Time aptt Partial Thromboplastin Time radamts-13 Recombinant ADAMTS-13

11 RNA rpm RT SD SDS-PAGE SkM SNP SSC SVMP syn. TBS TSP-1 TTP TXA2 UC UL VWF MM UL-VWF USS UV v/v VLA VWD VWF VWF:Ag VWF:CBA VWFAgII VWF-CP WB Y Ribonucleic Acid Rounds per minute Room Temperature Standard deviation Sodium dodecyl sulphate polyacrylamide gel electrophoresis Skimmed milk Single nucleotide polymorphism Scientific and Standardization Committee Snake Venom Metalloprotease Synonymous Tris Buffered Saline Thrombospondin-1 Thrombotic Thrombocytopenic Purpura Thromboxane A2 Umbilical Cord Ultra Large Von Willebrand Factor Multimers Ultra large Von Willebrand factor Upshaw-Schulman syndrom; the pathology associated with cttp Ultraviolet Volume percentage Very Late Antigen Von Willebrand s Disease Von Willebrand Factor VWF Antigen; assay for VWF protein concentration VWF Collagen Binding Assat; assay for VWF activity towards collagen Von Willebrand factor Antigen II Von Willebrand factor Cleaving Protease (syn. for ADAMTS-13) Western blot Years (of age)

12

13 Aims of the study AIMS OF THE STUDY Hemostasis is a very complex process, involving a vast number of indispensable proteins. Hence, understanding the lot requires detailed insight into all of these participating factors, thereby challenging the scientist to gain broad knowledge of the field (review of the literature in Chapter 1). From the experimental point of view it is practically impossible to address all of these interactors at once and therefore some are lifted out for thorough investigation, without losing grip on the entire picture. In this dissertation, experimental investigation of the relationship between von Willebrand factor (VWF) and A Disintegrin And Metalloprotease with Thrombospondin type 1 motifs # 13 (ADAMTS-13) as mediators for thrombotic thrombocytopenic purpura (TTP) will be explained. The PhD project fits into a novel track that has been set out by a number of independent research groups in These groups were the first to identify the von Willebrand factor (VWF) cleaving protease, ADAMTS- 13. It is a plasma metalloprotease that specifically catalyzes the proteolysis of VWF. The latter is involved in platelet recruitment to sites of vascular injury in the arterial system. Von Willebrand factor is a multimeric protein of which the activity directly relates to the number of composing protomers. Hence, extremely large VWF multimers are extremely active and bear the potential of spontaneous platelet interactions which may lead to intravascular aggregate formation, blocking terminal arterioles and causing ischemia. Fortunately, ADAMTS-13 enzymatically cleaves these ultra large VWF to normal, lower molecular weight forms, a process that obviously is indispensable for normal hemostasis. Absent or dysfunctional ADAMTS-13 hence can result in severe organ failure as a consequence of the above mentioned ischemia, a disease called thrombotic thrombocytopenic purpura (TTP). The existence of a VWF cleaving enzyme was already hypothesized in the mid-eighties when patients suffering from TTP were found to have these extremely large VWF molecules in their plasma. It took another decade to successfully and specifically design in vitro VWF proteolysis assays and it seemed that this protease required non-physiologic conditions like mild denaturation and low ionic strength to be able to exert its function in vitro. Finally, in 2001, it was purified and characterized as a distant member of the ADAMTSfamily of metalloproteases; ADAMTS-13. The Laboratory for Thrombosis Research has a large expertise in the field of monoclonal antibodies and its applications, with successful immunobiotechnologic research on platelet receptors GP Ib/IX/V and GP IaIIa, but also on VWF itself. Exploiting this expertise, our first goal is to generate monoclonal antibodies against human ADAMTS-13 (Chapter 2). The mabs can then serve many potential goals; (i) as basic reagents for western blotting, immunoprecipitation, immunosorbent assays and immunocytochemistry (ii) as potential tool for the in vivo inhibition of VWF proteolysis in an animal model for TTP and (iii) for structure-function analysis including epitope mapping and interference with enzyme function. In the case of ADAMTS-13, the experimental part of generating antibodies is seriously hampered by the lack of basic biochemistry tools (proteinaceous antigen, commercial antibodies for screening tests, etc) and basic knowledge (novelty of the ADAMTS-family of proteins). Therefore an alternative biochemical approach called genetic immunization has been applied. Basically, a humoral immune response can equally be evoked by exposure to an 13

14 Aims of the study expression plasmid encoding the antigen of interest instead of the proteinaceous antigen itself. This technique hence overcomes the lack of antigen which is inherent to scientific research on newly discovered proteins. In a second stage of the project we wanted to develop a test that can accurately measure levels of ADAMTS- 13 antigen in plasma and recombinant expression media (Chapter 3). No such assay was available at the time, since most research laboratories had been focusing on the development of easier and faster activity assays. To achieve this goal, the specific antibodies developed in the early stage of the project have been vaildated in an enzyme-linked immunosorbent assay or ELISA. High affinity antibodies will be selected and optimized for immobilizing the antigen in a microtiter plate. Labeled antibodies of other epitope specificity accounted for the detection of the immobilized protein. This easy and performable assay has contributed in gaining insight into the ADAMTS-13 plasma titers in diverse pathological or physiologic conditions. The correlation between activity and antigen could also tell us if inhibitors, activators or physiologic processes exist or take place in a certain condition. Moreover, racial and genetic (e.g. polymorphisms) backgrounds could potentially also influence levels of ADAMTS-13, which will be detected with the presented assay. In the fourth chapter of this PhD dissertation the plasma ADAMTS-13 antigen levels in a set of physiologic and pathological conditions are investigated prospectively (Chapter 4). ADAMTS-13 antigen levels in plasma samples from umbilical cords, newborn infants, pregnant women and women taking oral contraceptives are compared with those in normal individuals, using the antigen determination ELISA developed in chapter 3. Moreover, a series of pathological conditions including severe sepsis, inflammatory bowel disease, liver cirrhosis and operative state are also investigated. These data can inform us on the effects that a general bodily state has on ADAMTS-13 levels or vice versa, especially for those conditions that have been linked with TTP (i.c. pregnancy, sepsis, inflammation). The last chapter focuses on the elucidation of the molecular effect of a novel ADAMTS-13 mutation causing the congenital form of TTP, generally referred to as Upshaw-Schulman syndrome (Chapter 5). This is done by mutagenesis of the expression plasmid encoding wild-type ADAMTS-13. Subsequent in vitro expression in heterologous cells has informed us about the molecular defect that is caused by the mutant protein. This aids in understanding the pathogenesis of congenital TTP in this patient and maybe even in the mechanism involved in VWF proteolysis. 14

15

16

17 CHAPTER 1 GENERAL INTRODUCTION 1.1 HEMOSTASIS 1.2 PLATELETS IN PRIMARY HEMOSTASIS 1.3 VON WILLEBRAND FACTOR (VWF) 1.4 ADAMTS-13

18 CHAPTER 1: General Introduction The heart is pumping oxygen-poor blood to the lungs, in which carbon dioxide is released and oxygen is loaded (lesser circulation). Oxygenized blood is then pumped to all organs (greater circulation), which consume oxygen and release carbon dioxide through respiration. Through arteries (arterial circulation), either directed to the lungs (pulmonary circulation) or to the remaining organs (systemic circulation), the heart is hence pumping blood at high velocity. On the other hand, blood is slowed down in tissue microvasculature and having passed through these capillary vessels, blood is transported in the veins (venous circulation). In these vessels, blood is stationary or flowing slowly, mainly by means of muscle contraction in the surroundings. The biophysical properties of flowing blood and transporting vessels, have made these different vascular systems dependent on evenly different tools to prevent blood from leaking out after damage. 1.1 HEMOSTASIS The self-containing property of (human) circulation is generally referred to as hemostasis. It involves all mechanisms necessary for maintaining blood within the vascular system, hence preventing blood loss. Blood platelets and their main interactors are responsible for the so-called primary hemostasis, in which vessel systems are protected from blood loss posterior to vessel damage. Secondary hemostasis or coagulation involves a complex series of enzyme-mediated reactions, leading to a firm fibrin plug that seals off vessel injuries. Although they involve two totally different types of regulation, there is no well-defined boundary between primary and secondary hemostasis, in vivo. Moreover, they are interdependent and many interactors present in primary are also involved in secondary hemostasis and vice versa. This work focuses on A Disintegrin And Metalloprotease with ThromboSpondin-1 motifs 13 (ADAMTS-13) and von Willebrand factor (VWF), two of the main participants in primary hemostasis. 1.2 PLATELETS IN PRIMARY HEMOSTASIS Human blood consists of an aqueous fraction (plasma) in which circulating cells are suspended. Three different cell types are distinguished; erythrocytes, leukocytes and thrombocytes or blood platelets (Figure 1). The first are anuclear and contain hemoglobin which carries oxygen to tissues, to be consumed during respiration. The second is a cell group with different cell types exerting diverse functions, all related to immunity and defense. The third are smaller, anuclear cells and are mainly responsible for sealing off injured vessels. They specialized to act at high blood velocities which impose rheologic forces at the damaged vessel wall. Blood platelets also aid in repairing the injured vessel by releasing growth factors and cytokines. On the other hand, recent work has stipulated a role of platelets in many more processes than vessel repair, e.g. angiogenesis 1, atherosclerosis 2 and immunity 3. Resting human platelets have a discoid morphology with a diameter of 1.5 to 2.5 µm and a volume of 7.0 fl 4. Normal human blood has platelet counts varying between and 400 x 10 3 cells per µl. The importance of blood platelets in hemostasis is apparent from medical conditions in which the patelet count drops below 18

19 CHAPTER 1: General Introduction 20 to 30 x 10 3 platelets per µl of blood (thrombocytopenia), when bleeding can occur as a consequence of minor trauma. The most serious risk of bleeding, generally occurs when the platelet count falls below 10,000 per µl, at which time, spontaneous excessive bleeding can rapidly lead to anemia and death. Thrombocytopenia can have a variety of causes, one of which is treated in this thesis. On the other hand, thrombocytosis, or platelet counts above 400 x 10 3 per µl, can occur in combination with myeloproliferative disorders, is hereditary or secondary to other diseases and falls beyond the scope of this work 5,6. Figure 1: Blood Cells. Each cell type, present in blood, is indicated by a colored arrow (From: Platelet function comprises a triad of responses to injury: adhesion, release (or secretion) and aggregation. Each of these different functions are complementary in the framework of bleeding cessation in damaged vessels in general and in arterial systems in particular Adhesion; GP Ib/IX/V complex, integrin GP Ia/IIa and GP VI The inner part of healthy blood vessels is covered with a monolayer of endothelial cells serving a wide range of functions. When these endothelial cells are destroyed (mechanical or chemical injury, infection, apoptosis, etc), subendothelial proteins are exposed to the blood lumen and this de novo contact triggers the complex vessel repair system. Collagen is the major thrombogenic constituent of the subendothelial matrix, but also VWF, bound to collagen, will react with hemostatic components. However, as a consequence of blood flow, blood components (e.g. platelets) are subjected to wall shear stress upon interaction with the damaged vessel wall. Adhesion and arrest on the site of injury hence requires specialized membrane anchored receptors that can bind to subendothelial structures. The glycoprotein Ib/IX/V complex (GP Ib/IX/V) is a large receptor complex of the leucine-rich repeat family (LRR) and is uniquely present on platelets 8. It binds to subendothelial VWF via the N-terminal portion of the GP Ibα constituent. This binding is reversible and cycles between on and off, causing the platelet to roll on the VWF matrix, under the influence of the shear stress. Rolling on the subendothelial matrix allows secondary interactions to take place, facilitating arrest of the platelets. These secondary receptors (GP VI and GP Ia/IIa) can directly interact with collagen, this time employing irreversible bond strengths (Figure 2). 19

20 CHAPTER 1: General Introduction These interactions lead to firm adhesion of the platelet and to full arrest on the reactive subendothelial surface. GP Ia/IIa (syn. α 2 β 1, VLA-2) is a member of the integrin family and contains a specialized domain (I-domain) that coordinates a Mg 2+ ion. This ion can interact with a glutamate residue embedded in a conserved amino acid sequence within the collagen triple helical structure. This interaction causes the receptor to adopt a different conformation fine-tuning the binding with its ligand GP VI (syn. p62) is a molecule that contains two immunoglobulin domains and binds to triple helical collagen structures and causes platelet activation. It therefore is one of many signaling receptors responsible for platelet activation, the following important step necessary to substantiate and expand the platelet plug Figure 2: Schematic representation of primary hemostasis. Primary hemostasis is depicted in discrete steps, but in reality this is a continuous and dynamic process Activation and Release Upon their adhesion and because they undergo de novo interactions, platelets are activated, undergoing dramatic changes. Activated platelets reorganize their actin-cytoskeleton within seconds, changing their shape from a discoid to a spiny, irregular appearance. This phenomenon is induced by shifts in the cytosolic free calcium concentration as a consequence of signaling pathways. The rise in free calcium ions also induces release (syn. granular secretion) in the cell surroundings. Release is the second phenomenon 20

21 CHAPTER 1: General Introduction mentioned in the triad above and it is a major next step in primary hemostasis, since it triggers a series of protein interactions leading to the recruitment of more platelets and the activation of nearby adhering platelets. Platelets contain dense granules (syn. δ-granules) and α-granules, each containing different factors. α-granules are the most abundant and contain soluble adhesive proteins (a.o. VWF, fibrinogen, thrombospondin-1, P-selectin), enzymes and inhibitors (a.o. plasminogen), procoagulants (a.o. Factor V), growth factors (a.o. platelet derived growth factor, transforming growth factor-α) and small interactors (a.o. Mg 2+, guanine). The α-granules content serves mainly to enhance the adhesion process and promote cellcell interactions. The content of the dense granules functions primarily to recruit platelets to the site of injury. It contains activating agents (a.o. ADP, ATP, serotonin) and small interactors (a.o. Ca 2+, pyrophosphate) Aggregation; Integrin GP IIb/IIIa and Fibrinogen The most obvious and probably most important consequence of release and activation is the phenomenon of aggregation, the third element in the primary hemostasis triad. It is the process in which platelets interact with each other and contract, finalizing the plug that seals off the potential leaking locus. In fact, except for the first layer in contact with the reactive subendothelial surface, essentially the entire thrombus is constituted of aggregated platelets. Aggregation is primarily mediated through the integrin GP IIb/IIIa (syn. α IIb β 3 ) and fibrinogen (Fg) and to a lesser extent by VWF and fibrin. Fibrinogen is a symmetrical dimer of three different polypeptide chains (α 2 β 2 γ 2 ). It has several functions in vascular wound healing but is also a modulator in the inflammatory responses and in neoplasia 18. It circulates freely in plasma but cannot interact with resting platelets. The Fg structure is extended and contains sequence repeats which allow this molecule to cross-link platelets via their integrin GP IIb/IIIa and hence establish an aggregate, provided the integrin is in an active conformation 19. When fibrinogen is cleaved by thrombin, fibrin is generated. This fiber-like protein can be compared with steal in armed concrete and therefore stabilizes the newly formed platelet aggregate. In parallel, the rigid aggregate contracts by means of a myosin-ii related mechanical system, resulting in an insoluble platelet-rich plug 17. To restrict the growing platelet plug to the site of injury, surrounding endothelial cells release several specialized factors to inactivate or inhibit platelet aggregation. Many of these factors are short-lived (prostaglandin I 2 and nitric oxide), others have continuous activity (CD39) It must be stressed that this simplified discrete-step overview of primary hemostasis is in fact a fast and continuous interplay of many more participants, of which many details still need to be elucidated. Moreover, hemostasis is very much depending on the availability of all these factors and hence can differ substantially as to the locus where the injury takes place. Endothelial cells, for instance, have differing properties throughout the vasculature and the same accounts for tissue arrangement in the subendothelium. 21

22 CHAPTER 1: General Introduction 1.3 VON WILLEBRAND FACTOR (VWF) In 1971, Zimmerman et al. coincidently discovered a factor that was in tight complex with the already known plasma antihemophilic factor (AHF) or clotting factor VIII (FVIII) 23. They denominated this protein AHF-like antigen, because they were not sure whether the protein was a distinct entity or a variant of the already described FVIII. This is a protein of the coagulation cascade which is responsible for the bleeding disorder hemophilia A when being deficient. Later studies showed that the plasma protein complex in fact merely contained 1% of FVIII, whilst the rest was the newly discovered AHF-like antigen. Other groups showed that it was a completely different protein, not directly related with nor responsible for hemophilia A. The newly discovered protein is now known as von Willebrand factor (VWF) and has several indispensable functions, all in hemostasis. The importance of VWF is displayed in the most common bleeding disorder known in men, von Willebrand disease, first described by Dr. Erich von Willebrand to be pseudo-hemophilia 24,25. Figure 3 : Schematic representation of VWF 26. Binding sites are shown by a black line below the depicted VWF monomer and the enlarged view of the A-domains is depicted in detail above the VWF monomer. Domains A1 and A3 have a conserved disulfide bond that results in a typical loop. RGDS is the single amino acid notation of the recognition sequence for GP IIb/IIIa Structure-function relationship of VWF domains Von Willebrand factor circulates in plasma as a series of multimers, ranging from 500 kda to 10,000 kda 26. The multimers are composed of so-called protomers (syn. subunits), which are in fact dimers, hence containing duplicate domains, one for each monomer. Each monomer is a glycoprotein with 22 carbohydrate side chains, which represent between 10% and 19% of the total molecular mass of a monomer; 278 kda 27. Monomeric VWF is composed of four types of repeating domains designated D1-D2-D -D3-A1-A2-A3-D4-B1-22

23 CHAPTER 1: General Introduction B2-B3-C1-C2, from amino to carboxyl terminal end (Figure 3) 28. The primary translation product bears a signal peptide (pre-pro-vwf) of 22 amino acids and an unusually large pro-peptide (pro-vwf) of 741 residues that comprises domains D1 and D A1 and A3 domains: interaction with platelet GPIb/IX/V and subendothelium The A-domains (A1, A2 and A3) are conserved among different vertebrates and they are found in distinct proteins 29, in which they are generally referred to as VWF A-like domains. These adhesive modules have been described in integrins as so-called I-domains and in adhesive molecules like complement factor B and collagens 30. Crystals have been prepared of both the VWF A1 and the A3 domains, but not the A2 domain, giving new insights in the conformational complexity of these adhesive structures (Figure 4) 31,32. Both A1 and the A3 domain, contain an intrachain disulfide loop of identical length, spanning from C 1272 to C 1458 and from C 1686 to C 1872 for the A1 and the A3 domain, respectively (note: amino acids are numbered from the initial methionine residue in pre-pro-vwf and single amino acid coding is used in compliance with the most recent ISTH VWF SSC nomenclature guidelines; Despite considerable homology of A1, A3 and the enclosed A2 domain, no such cystein loop is present in the latter. From the crystals it was also found that the VWF A-domains adopt a dinucleotide binding fold, which consists of a central hydrophobic parallel beta sheet flanked on both sides with amphipatic alpha helices Interaction with subendothelium: domain A3 (and domain A1) The interaction of VWF with the subendothelium is one of the initial steps in the formation of a platelet plug, necessary to heal damaged arterial vessels. Subendothelium is composed of typical structural proteins and proteoglycans, conferring the vessel wall into a rigid but supple tissue. Of those structural proteins, collagen is the most reactive with VWF and the interactions with collagens type I and type III are most extensively studied, because of their abundance in vessels. The former being present mainly in the deeper layers of the vessel wall, while the latter is predominant in the superficial area of the lumen-side subendothelium 33. Collagen binding was at first believed to be an exclusive property of the A3 domain, with no contribution of other VWF modules, whatsoever. Later studies revealed that domain A1 can adequately substitute for A3 in recruiting flowing platelets to collagen Nonetheless, it was found that VWF binding to subendothelium could be completely abolished by a monoclonal antibody aimed at the VWF A3 domain, exerting antithrombotic effects in a primate thrombosis model 37. This indicates the relative importance of the VWF A3 collagen interaction over the A1 homologue, in vivo. The putative binding mechanism and the residues involved in binding of A3 to fibril-forming collagen were deduced by Romijn et al. in two consecutive papers 38,39 and very recently Lisman et al. published the binding site of collagen type III for VWF

24 CHAPTER 1: General Introduction Figure 4 : Ribbon diagram of the VWF A1 (left) and the VWF A3 domain (right). The structural similarity can be appreciated as both A1 and A3 exist of six central beta sheets, surrounded by seven alpha helices. Both A1 and A3 contain a disulfide bond creating a loop, which is not the case in domain A2. Figures were adopted from references 31,41,42. The role of collagens in VWF binding to subendothelium is undoubted, but other structures may be involved and may play an essential role, in vivo. One of those is the ability of VWF to self-associate, providing a VWF active surface on top of the collagen bound VWF molecules 43. The initial experiments were constitutively performed at a shear rate of 1500 s -1, but later experiments showed that this interaction equally takes places in static conditions 44. Apart from VWF self-association, potential heparin binding sites in VWF may interact with matrix structures homologous to heparin (so-called glycosaminoglycans) and the potential interaction with sulfated glycolipids could also contribute, but details remain to be clarified Interaction with platelet GP Ib/IX/V: domain A1 The initial interaction of VWF with blood platelets is accomplished through binding with the platelet GP Ib/IX/V complex. This receptor consists of three structurally related proteins: GP IX, GP V and GP Ib in a 2:1:2 ratio, anchored in the membrane and linked together by non-covalent salt bridges 46. GP Ib (~25,000 copies/platelet) itself is made up of two portions, designated GP Ibα and GP Ibβ, covalently linked with a disulfide bridge 47. The N-terminal region of GP Ibα interacts with the VWF A1 domain, establishing a lowaffinity bond, necessary for retarding the flowing platelet onto the active surface. The most striking VWF feature is its ability to dramatically shift from a non-adhesive, plasma soluble protein to a multi-potent sticky protein, providing an activated surface for flowing platelets. To this purpose, the conformation of VWF can radically alter upon interaction with deeper endothelium, so to expose its binding sites for GP Ib/IX/V and allow platelet adherence. Indeed, the unchallenged VWF cannot bind with its major blood platelet receptor and hence in vitro static studies always require non-physiologic modulators like ristocetin 48 or botrocetin 49, which can induce conformational changes comparable to those in vivo. In fact, 24

25 CHAPTER 1: General Introduction recently our group has found that the N-terminal D D3 portion of VWF is responsible for shielding the sticky, centrally located A1 domain, explaining the weak interaction of soluble VWF with the platelet receptor 50. The A1 and A3 domains have been extensively studied using crystals 31,41, co-crystals with a function blocking antibody 51,52 and for A1 also co-crystals with recombinant N-terminal GP Ibα 32. These data have demonstrated a typical α/β fold with a central β-sheet, flanked by α-helices on each side, as in the homologous I domains of integrin subunits α M and α 53,54 L. A binding pocket is provided by the amino terminal portion of helix α3, forming the bottom of a depression in an extended surface including also strand β3. An in vitro flow-study, hence not requiring modulators as in static assays, demonstrated that amino acids E 1359 and K 1362, located within the above mentioned binding pocket, are indispensable for GP Ibα binding to domain A Interactions with integrins α v β 3 and α IIb β 3 ; Domain C1 Von Willebrand factor contains an RGD amino acid sequence within the C1 domain (Figure 3) at positions 2507 to This typical integrin recognition sequence was initially identified in fibronectin as being sufficient for adhesion of this protein to a number of cells 56. Later on, it was found that it is conserved in several adhesive proteins and necessary to support binding to integrin receptors, in many but not all cases 57. The RGD sequence in VWF is the sole known and essential binding site for platelet integrin GP IIb/IIIa. This receptor is abundant on the platelet membrane (~80,000 copies/platelet) and indispensable for normal platelet aggregation, mediated through VWF and Fg after activation 47. This can be demonstrated by selective GP IIb/IIIa blocking agents which can prevent platelet agglutination in thrombosis models 58. The need for platelets to have more than one type of receptor involved in VWF binding is inherently linked to their mode of action at a site of injury in an arterial vessel, where shear rates are high rendering initial arrest through integrins impossible. Studies with selective blockage of GP Ib/IX/V at levels of elevated shear stress prove that GP IIb/IIIa-VWF interaction alone is not sufficient for platelet agglutination and vice versa 59. This interplay of receptors is the hallmark of platelet function during hemostasis, making it very difficult to focus experimental studies on one single receptor FVIII stabilization: involvement of domain region D -D3 Factor VIII (FVIII) is an important co-factor in catalysis of FX by means of FIXa during coagulation, which finally leads to the formation of fibrin-rich clots in secondary hemostasis but also to consolidation of the platelet-rich plug 60. The importance of this co-factor is mirrored in a well characterized bleeding disorder called hemophilia A, caused by deficiency of this clotting factor. FVIII is associated with VWF in circulation by a high affinity bond in the D -D3 (amino acids 763 to 1035) domain area of the mature VWF monomer. This association stabilizes the clotting factor which would otherwise be rapidly cleared from solution. The stabilization is an important VWF feature, since known mutations within the D -D3 area cause a mild bleeding disorder with resemblance to hemophilia A

26 CHAPTER 1: General Introduction The maverick stuck in the middle: domain A2 Thanks to detailed studies of A1 and A3 domain function by inhibiting molecules in flow and static studies, the structure-function relationship of these two has been extensively described in the literature. Moreover, crystal and co-crystal structures unraveled many of the structural features responsible for the above mentioned goals. To date, the A2 domain has not been characterized in that much detail, maybe because its contribution in primary hemostasis is not that obvious compared to its neighbors. Nevertheless, this domain passively exerts one of the most important modulatory roles in controlling thrombus size and hence preventing thrombosis. Figure 5 : Ribbon representation of a molecular model of the VWF A2 domain developed by Sutherland et al. 65. The most important finding is the location of the ADAMTS-13 scissile bond (red sphere), completely embedded in the center fold and hence difficult to reach for the enzyme. The conformational changes responsible for exposing the cleavage site have not been described. Green spheres represent some known type 2A mutation sites (both group 1 and group 2 mutations are depicted). α-helices are shown as purple cylinders and β-sheets are shown as yellow arrows. Within the A2 domain lies a specific cleavage site for ADAMTS-13 (A Disintegrin And Metalloprotease with ThromboSpondin-1 motifs), a plasma metalloprotease that will be discussed in detail. The enzyme catalyzes the hydrolysis of the Y M 1606 peptide bond and makes specific cleavage products of 140 kda and 176 kda appear on reducing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) with subsequent western blotting. The cleavage site has been deduced by epitope mapping of peptide-directed monoclonal antibodies and N-terminal sequence determination of cleavage products of VWF, present in plasma 66. Indeed, the proteolysed fragments can be detected in plasma, showing in vivo ADAMTS-13 activity, although the greater part of VWF molecules doesn t get cleaved, presumably because the Y-M peptide bond in circulating VWF is sterically hidden within the conformational complexity of both the A2 and the surrounding domains (Figure 5) 65. The underlying mechanism allowing some of the A2 domains to be 26

27 CHAPTER 1: General Introduction susceptible to ADAMTS-13 enzymatic action is unclear. Also, the exact binding pocket and the amino acids involved in in vivo proteolysis have not been described but could be hypothesized from in vitro proteolysis experiments with truncated VWF mutants demonstrating an A2 fragment, spanning a region from D 1596 to R 1668, to be the minimal substrate for cleavage by ADAMTS The neighboring domains, or even further located VWF domains, may modulate or change the receptiveness to the enzyme, perhaps determining whether an A2 domain will be cleaved or not 68. Type 2A (group 2) von Willebrand disease (VWD) is an illness caused by mutations within the VWF A2 domain leading to a decreased number of high multimers (see ) resulting in mild to moderate bleeding 69 (Figure 6). The high multimers contain a greater number of potential interaction sites, reducing the free energy for secondary interactions with the substrate. This biophysical property is called avidity and is an important feature, since larger multimers are hemostatically the most active. Deficiency of large multimers hence causes spontaneous bleeding, just because of the inability of smaller multimers to firmly interact with subendothelial collagen and platelets. The mechanism underlying the disappearance of high multimers in type 2A (group 2) VWD can be ascribed to increased proteolysis by ADAMTS-13 70, but the exact structural malformations at the molecular level involved have not been elucidated. The cryptic feature of the Y-M scissile bond is hence significantly important in preventing excessive trimming by ADAMTS-13. Also, one can appreciate the subtle molecular changes this domain must be prone to; exposure to proteolysis or not can seriously change the course of thrombus formation (see also further), albeit that a strict binary (cleavage or not) role can probably not be ascribed to ADAMTS-13 70, Other interactions From the above analysis it is clear that VWF is an adhesive protein, with many potential interactors. Other interactors than the well-known platelet receptors and subendothelial structures have been suggested. It has been shown, for instance, that VWF is capable of binding to cross-linked fibrin. This might be important for platelet adhesion at sites of vascular injury with even a potential role for VWF in secondary hemostasis 72. The exact domains or structures involved in this interaction have not been elucidated, yet 73. Von Willebrand factor has also been shown to bind sulfated glycolipids, present on cellular membranes. Since these are also present on platelet membranes, they may serve an accessory role in promoting interactions with VWF. The binding site for sulfatides is apparently located within residues in the A1 domain loop 45,74. 27

28 CHAPTER 1: General Introduction Figure 6 : Schematic representation of all known VWD type 2A (group 2) mutations. These mutations all reside within the A2 domain and alter its conformation so to expose the cleavage site for ADAMTS-13 (blue arrow). Excessive ADAMTS-13 enzymatic function leads to a decrease in circulating high VWF multimers causing mild to moderate bleeding in affected individuals. Cysteines involved in loop formation in A1 and A3 are depicted as blue circles. Single letter amino acid coding and numbering from the initiation methionine is used according to international standards. Figure was adapted from Hassenpflug et al VWF gene and biosynthesis VWF regulation of transcription The human VWF gene spans ~180 kilo base pairs (kb), contains 52 exons and is located at the tip of the short arm of chromosome 12, region 12p12-12pter 75,76. Since VWF expression has only been found in endothelial cells and megakaryocytes (nucleated precursors of platelets), specific regulatory elements within the gene region and the differentiated cell must be present. Indeed, ninety nucleotides upstream of the initiation codon, a core promoter is found, capable of inducing expression in any cell type 77,78. But, further upstream resides a first positive regulatory sequence, whereas a second one is found close to the first untranslated exon of the VWF gene. These regulatory domains contain potential binding sites for GATA and SP1 transcription factors and mutation of the GATA binding site abolishes promoter activity in endothelial cells 77. Endothelial cells contain GATA-2, but it has not been demonstrated that this factor truly is involved in VWF gene expression regulation 79. Apart from the positive regulatory domains, repressor sites must prevent promoter activation in non-endothelial cell types 80. Mutations in an NF1-like protein binding site prevented NF1-like protein to bind and this initiated transcription in non-endothelial cells, albeit when performed in a truncated promoter area, not in the full upstream regulatory sequence Biosynthesis of VWF As mentioned above, VWF is present in plasma as a series of multimers as a consequence of complex intracellular processes, which are at present not completely understood. Our level of understanding as outlined below is the result of studies on either heterologous cells or endothelial cells, hence not much is known of VWF bio-processing in megakaryocytes

29 CHAPTER 1: General Introduction After removal of the signal peptide and initial glycosylation steps, pro-vwf monomers assemble to form dimers (pre-protomer) in the endoplasmic reticulum (ER) (Figure 7). The initial glycosylation might be an important trigger for multimer formation since tunicamycin, an antibiotic that inhibits carbohydrate-side chain attachment, prevents multimer assembly in endothelial cells 81. Dimer formation is made possible through covalent disulfide bridges formed in the C-terminal sequence CK (downstream of the C2 domain), a process often referred to as tail-to-tail association 82. The CK domain sequence has no homology with other known structures and is therefore poorly understood, but it definitely comprises the minimal structure required for dimerization 83. Next, 12 N-linked and 10 O-linked carbohydrate side-chains are attached to the molecules and the N-linked sugars are additionally modified by sulfation, a process for which the biomolecular background is unclear 84. Once the VWF is transported into the Golgi apparatus, multimers are formed through disulfide linkage employing cystein residues in the D -D3 region of the dimer. Multimer formation requires both the D1-D2 pro-vwf structures and the D -D3 area wherein the cysteins, that eventually will form disulfide bridges, are located 85. The propeptide D1-D2 domains act as an isomerase, promoting the head-to-head arrangement, eventually leading to (ultra) large VWF multimers 86,87. This was shown by in vitro co-expression of the mature VWF sequence and the propeptide, hence residing on separate plasmids, in heterologous cells. In this experiment, the propeptide, even without being a continuous part of the VWF polypeptide, could promote multimer formation, whilst only dimers were formed in the absence of the pro- VWF portion. Indeed, site-directed mutagenesis in pro-vwf, aimed at vicinal cystein residues (a typical feature of isomerase enzymes), showed an indispensable role of those amino acids in promoting multimer formation 29. The formation of disulfide bridges in organelles like ER and Golgi is nonetheless quite unusual since these compartments have low ph, which is not favorable for an oxidation event. Even more, this low ph is required for multimerization, as addition of ammonium chloride, raising the internal ph of the cell, prevents multimer formation 81. An important remark on the presented biosynthesis scheme is that, although generally accepted, not necessarily dimers are employed as protomers for building a multimer. This has been illustrated by the VWF mutation C2773R causing VWD type IID, characterized by loss of high multimers. Despite the inability of this mutant to form dimers on its own (which is logical since the tail-to-tail dimerization is impaired), mutant monomers are incorporated anyhow in the nascent multimer in vivo, arranged by the heterozygous wild-type allele 88. This leads to a dominant negative phenotype, since each incorporated mutant monomer forms a physical barrier and is no longer available for further protomer attachment. Two incorporations in a nascent polymer hence prematurely abrogate further multimer growth and so the phenotype can be explained. This suggests that even monomers, without previously being arranged into a tail-to-tail organized dimer (i.e. the generally accepted protomer for VWF multimerization) can be randomly added to a nascent VWF molecule. 29

30 CHAPTER 1: General Introduction Figure 7 : Biosynthesis pathway of VWF, simplified scheme indicating the best known transitions 89. Many of the presented data have been collected through in vitro analyses of VWF expression and a certain care must be taken into account when doing so, because endothelial cells can rapidly alter VWF gene expression when transferred to laboratory conditions 90. Moreover, Aird et al showed regional heterogeneity in VWF gene expression, possibly accounting for the diversity found in histochemical and mrna analysis of different vascular preparations As a final step in VWF biosynthesis, the pro-vwf polypeptide is proteolytically removed from mature VWF by furin (syn. PACE) and released into plasma, where it can be detected as VWFAgII There has been speculation on a possible role of VWFAgII as it apparently contains an active collagen binding domain and it has been shown to inhibit collagen-induced platelet aggregation Whether it has the same effect during thrombus formation in vivo and hence counteracts VWF is still to be shown, but its presence in plasma and its release from endothelial cells after stimulation, may definitely be of significant importance. 30

31 CHAPTER 1: General Introduction Storage and Secretion of VWF After multimerization in endothelial cells, VWF molecules can either directly be secreted into the circulating blood (constitutive pathway) or stored in specialized organelles (regulatory pathway) from which they only are released upon stimulation with secretagogues (a.o. epinephrine, desmopressin, histamine) 100. Most probably only the regulatory pathway is found in megakaryocytes as has been pointed out from studies with type 3 VWD pigs having had bone marrow transplants 101. Multimers that are released from organelles are larger (i.e. contain more protomers) than the ones that are constitutively secreted. This may have physiological importance, since more protomers account for higher avidity and are hence hemostatically more active/effective, as mentioned previously 102. What mechanism directs molecules to either pathway is not known, but it is assumed that the mature VWF subunits involved in both pathways are identical 26. The storage granules in endothelial cells are called Weibel-Palade bodies and are a unique property of endothelial cells 103. Moreover it was found that the formation of these organelles is an intrinsic property of VWF itself, i.e. endothelial cells lacking VWF will have no such bodies The underlying mechanism is much debated, but it is assumed that multimer assembly itself is the actual trigger for storage, with multimer size as criterion for storage (ultra large) or direct secretion (regular size) 102,104. P-selectin (syn. GMP-140, PADGEM) is also found in Weibel-Palade bodies and may act as a receptor for leukocytes and/or platelets upon the endothelium. This receptor has also been shown to act as an anchor for freshly released UL-VWF, after stimulation of cultured HUVECs (human umbilical cord vein endothelial cells) with histamine 107,108. Other possible components of Weibel-Palade bodies include interleukin-8 (IL-8), eotaxin-3, endothelin-1 and angiopoietin-2, implicating a role for these organelles in cell adhesion, vascular tone, inflammation and hemostasis Platelet VWF is stored within the α-granules and released upon stimulation, e.g. at a site of vascular injury. As in endothelial cells, the α-granules contain UL-VWF, most likely meant to enrich the vascular lesion locus with the uttermost adhesive molecules so to promote platelet-platelet interactions 114, Size control of VWF multimers The above mentioned biosynthesis results in a series of multimers ranging from 500 kda for the protomer (in fact a dimer) to 10,000 kda for the UL-VWF molecules, the latter safely stored in specialized organelles 26. Hence, one would think an internal control mechanism, inherently linked to biosynthesis, assures the size distribution of VWF molecules found in normal plasma. Yet, other important players are involved in controlling the size of VWF multimers and in particular that of the extremely adhesive UL-VWF. For instance, one research group repeatedly demonstrated that thrombospondin-1 (TSP-1) directly controls VWF multimer size by reducing the disulfide bonds that actually make up the polymeric backbone This property has been attributed to the C-terminal calcium binding moiety within the TSP-1 molecule and requires a free thiol at position Thrombospondin-1 is found in very low concentrations in normal plasma but can easily be raised ~100 fold after platelet activation since the α-granules contain vast amounts of this protein 119. Bonnefoy et al. recently described that TSP-1 rather protects subendothelium-bound VWF from degradation by the VWF specific cleaving protease ADAMTS-13 (see further), thereby acting as a provider of large 31

32 CHAPTER 1: General Introduction multimers, opposite to what Xie et al. published 120. It has indeed been shown that both TSP-1 and ADAMTS- 13 bind to the VWF A3 domain, providing a plausible biophysical explanation for the protective property of TSP-1 118,121. The best studied and probably biologically the most significant VWF cleaving enzyme is ADAMTS-13 or A Disintegrin And Metalloprotease with ThromboSpondin-1 motifs 13. Previously called Von Willebrand Factor Cleaving Protease 122,123, or VWF-CP, its existence was hypothesized in the mid-eighties because substantial amounts of specifically cleaved VWF moieties could be detected on reducing SDS-PAGE, as mentioned previously 124,125. That ADAMTS-13 is probably biologically the most relevant, is evidenced from the observation that a deficiency leads to a rare but severe microangiopathy known as thrombotic thrombocytopenic purpura or TTP ADAMTS Historical outline In 1924, Dr. Eli Moschcowitz described a case of a 16-year old girl who died of an until then unknown disease, characterized by high fever, small petechiae and anemia 127. Post-mortem microscopic analysis revealed the presence of hyaline (white-colored) thrombi in many tissues, including the heart and kidney. The investigator concluded that death resulted from a powerful poison causing agglutination of platelets and hemolysis. Later on the illness was classified among the thrombotic microangiopathies, to which also hemolytic uremic syndrome (HUS) belongs 128, and was referred to as thrombotic thrombocytopenic purpura (TTP). The disease remained mysterious until Moake et al. discovered unusually large VWF (UL-VWF) multimers in the plasma of TTP patients (Figure 8) 126. They hypothesized that the inability to reduce the size of these extremely large molecules could form the basis of the disease, especially as these UL-VWF had not been reported in the circulation of normal individuals. This finding led many researchers into the quest for the enzyme responsible for cleavage of (UL)VWF and hence responsible for TTP when deficient. Unfortunately, the enzyme seemed untraceable, although stepwise progress was made in the late eighties and nineties. 32

33 CHAPTER 1: General Introduction Figure 8 : Multimer analysis of VWF on 1.5% SDS-agarose gel. (right panel) Pooled plasma from normal human donors (NHP, n=20) was assessed in parallel with plasma from a TTP patient (TTP). The unusually large VWF multimers (UL VWF MM) can be seen on the cathodic topside of the gel, above the horizontal line, which bounds the largest detectable multimer in normal plasma. (left panel) Densitometric analysis of the SDS-agarose gel is depicted on the right. The surface area X (between vertical lines, below the tracing and above the baseline) was calculated to be half that of surface area Y, indicating the presence of unusually large multimers in the patient s plasma. The group of Dr. Ruggeri identified the specific cleavage site, which is located in the A2 domain of VWF. Their method to detect definite proteolytic fragments on western blot allowed to show increased or decreased VWF proteolysis in certain diseases 124,129. The specific proteolysis of VWF results in a typical pattern on reducing SDS PAGE western blot comprising the 225 kda or non-cleaved band, representing intact VWF monomers, and two smaller bands of 140 kda and 176 kda, representing proteolysed monomers 125. Despite some attempts, no observation of in vitro proteolysis, resulting in the exact same pattern as plasma VWF, was made, indicative for the specialized nature of this enzyme 130,131. Later on it was shown that the well-described biophysical susceptibility of VWF to shear stress could actually be the key to unraveling the mechanism of proteolysis 132. After many speculations on the nature of the enzyme 115,130, two independent research groups could show that it was a metalloprotease that was responsible for generating the VWF sub-bands on western blot (or the reduced ladder size on multimer agarose electrophoresis) 122,133. Apart from the identification of the nature of the enzyme, it was also found that extreme conditions were necessary to allow for VWF cleavage in vitro. Furlan et al. applied 1.0 M of urea, the addition of Ba 2+ ions and a low ionic strength buffer, while Tsai et al denatured the substrate using guanidine chloride, with no further addition of non-physiologic salts. These data add to the assumption that VWF needs to be conformationally challenged to expose its A2 domain in order to let the metalloprotease attack the Y-M scissile bond. This in vitro assessment of specific proteolytic activity towards VWF caused quite a revolution, since for the first time the HUS could easily be distinguished from TTP as it was shown that TTP patients indeed had severely reduced levels of the VWF cleaving protease (VWF-CP), whilst HUS patients had normal levels 134. Although quite heavily debated afterwards, it is now indeed generally accepted that HUS and TTP are distinct illnesses bearing alike symptoms, but having different etiologies and mechanisms 135,

34 CHAPTER 1: General Introduction In 2001, independent groups identified the true identity of the VWF cleaving protease as being the thirteenth member of the ADAMTS-family of metalloproteases, ADAMTS This finding has in turn brought about a revolution, as new techniques for the assessment of ADAMTS-13 antigen and activity are being developed 140,141 and new insights on the mechanisms involved are acquired 142,143. All of these will be addressed in detail below ADAMTS-family of metalloproteinases Metalloproteinases are all hydrolases (E.C. 3.4), catalyzing hydrolysis employing metal ions which are coordinated by histidine residues within the complex secondary structure of the enzyme 144. Most of them require Zn 2+ and the metzincins, i.e. the superfamily to which the ADAMTSs belong, all have a characteristic methionine containing Met-turn, just beneath the catalytic moiety 145,146. Within the metzincin superfamily, matrixins, serralysins and astacins are found as are the adamalysins, to which ADAMs, ADAMTSs and very recently ADAMTSLs belong 147. The first ADAMTS protein was described in 1997 and 19 family members have been identified by now, but many open questions remain as to the function of many of these and the structure-function relationship of the diverse modules that make up the ADAMTSs 148. Substrate specificity (although only for 10 ADAMTSs substrate specificity is known) and overall homology allowed for the elucidation of phylogenetic relationships amongst ADAMTSs 149. ADAMTS-1, -4, -5 and -8 all cleave the major cartilage proteoglycan aggrecan and are hence referred to as aggrecanases. ADAMTS-2, - 3 and -14 are procollagen N-propeptidases, involved in the processing of procollagens. Mutations in ADAMTS2 cause Ehlers-Danlos syndrome type VIIc, a disease characterized by severe skin fragility and joint laxity 150. ADAMTS-9 and -20 are called GON-ADAMTSs because of the structural gon-1-like element and its relationship to well-studied ADAMTSs in Caenorhabditis elegans, involved in gonadal development Very recently, also ADAMTS-7 has been shown to be involved in cartilage breakdown as the catabolic enzyme for COMP or cartilage oligomeric matrix protein 154. ADAMTS-6, -10, -12 and -16 to -19 may be called orphan ADAMTSs since no outspoken function or biological role has been defined for them, yet 147. Because of substrate specificity, but also due to the abnormally short pro-peptide and the unique C- terminal domains, ADAMTS-13 seems the furthest away from its family members (see below)

35 CHAPTER 1: General Introduction Figure 9 : The ADAMTS-family of metzincins. All 19 members are composed of several modules depicted as colored bars and oval circles (legend upper left). All proteins are depicted from left to right corresponding to the N-terminus and C-terminus, respectively. Some enzymes contain specialized structures at their C- terminus (mucin-like, PLAC [protease and lacumin motif], gon-1-like and CUB motifs). To the right, known substrates for certain members are depicted, for all other members, no substrate has been found, yet. Note the discordant buildup of ADAMTS-13, relative to the other family members. ADAMTS-11 was originally described as a unique member, later studies corrected that it was identical to ADAMTS-5. Figure was adapted based on Porter et al. 147 All ADAMTS members (Figure 9) have a signal peptide, a pro-domain, a metalloprotease catalytic domain, a disintegrin-like domain, a central thrombospondin type 1-like repeat, a cystein-rich domain, a typical spacer domain with yet undistinguished structural features and a variable number of C-terminal thrombospondin-1 repeats, ranging from 14 in the case of ADAMTS-20 and -9 to none in the case of ADAMTS-4 156,157. Some ADAMTSs have further specialized C-terminal structures of which ADAMTS-13 is exceptional in being the only ADAMTS having CUB (complement subcomponent C1r/C1s/embryonic sea urchin protein Uegf (urchin epidermal growth factor)/bone morphogenetic protein 1) domains 158. From the phylogenetic point of view, ADAMTS-13 is the furthest away from its family members 159, indicating extensive specialization throughout evolution. Another of its remarkable features is the aberrantly short propeptide sequence, not able to preserve latency of the enzyme, as in most other characterized ADAMTSs (except for ADAMTS-7) The highly specialized ADAMTS-13 is also well preserved amongst other species, ranging from mouse (Mus musculus) to Japanese puffer fish (Takifugu rubripes), suggesting important contributions of each module in ADAMTS-13 function 163. The fact that the identified ADAMTS-13 mutations causing TTP are widespread and hence no clear hot-spot locus has been found, adds to this 139. (note: notation of the gene is ADAMTS-13 in 35

36 CHAPTER 1: General Introduction italic, while the protein is written as ADAMTS-13, according to the official nomenclature consultable at ADAMTS-13 structure ADAMTS-13 is a glycoprotein containing 10 potential N-glycosylation sites and an RGD sequence, which is a potential integrin recognition sequence (Figure 10) 56,158. The ADAMTS-13 gene is 37 kb long, composed of 29 exons and the genomic sequence allows alternative splicing, as has been described for other family members 139,157,164. The protein consists of 1427 amino acids including signal- and pro-peptide, resulting in a calculated molecular mass of ~150 kda. The apparent molecular mass, observed by reducing SDS-PAGE and subsequent coomassie staining of the purified protein is ~200 kda, indicating that glycosylation has indeed taken place 137. Western blotting of non-reduced ADAMTS-13 results in a faster migrating band of ~170 kda. ADAMTS-13 mrna has been reported in a vast amount of tissues, but detection of protein has not been reported in all of these. At first it was believed that the main ADAMTS-13 production site was situated in the liver, more particular in stellate cells 165. Recent reports show evidence for a major input by endothelial cells, secreting the enzyme directly into plasma 166,167. Moreover, ADAMTS-13 mrna and protein have been found in human platelets, but the contribution to the plasma level has not been adressed in detail 168,169. The enzyme is composed of an N-terminal signal peptide, which is rapidly cleaved by a signal peptidase on its way through the ER 147. The pro-peptide is cleaved by furin, which recognizes the conserved amino acid sequence RXR/KR, just upstream of the initiating alanine of the metalloprotease domain (Figure 10) 170. Sitedirected mutagenesis of this recognition sequence and recombinant expression resulted in the secretion of pro-adamts-13, as did expression of wild type ADAMTS-13 in a furin deficient cell line, suggesting a minor role of the pro-peptide in the regulation of the secretory pathway 162. As mentioned previously, this proenzyme is also active towards VWF, at least when assessed in the partial denaturing conditions in vitro, again indicative for an insignificant influence of the pro-domain on protein folding. The metalloprotease domain contains the Zn 2+ coordinating structure, which is essential for the effective catalysis process. Other ions have been shown to promote in vitro VWF processing by ADAMTS , but it is unclear whether these effectively replace Zn 2+ or rather promote Zn 2+ re-uptake after it has been chelated by anti-coagulant agents like citrate or ethylene diamine tetraacetic acid (EDTA) 171. In ADAMTSs, the conserved motif containing the histidine residues is generally HEXXHXXG/N/SXXHD, where X represents any amino acid residue and the conserved aspartic acid residue at the end distinguishes ADAMs from ADAMTSs 145. In ADAMTS-13, this sequence corresponds to 224 HEIGHSFGLEHD 234. Other residues within the metalloprotease domain, namely E 83, D 173, C 281 and D 284, are predicted to be necessary for coordination of a Ca 2+ metal ion 122,133,158 (Figure 10). This metal ion is probably important in preserving the secondary structure of the domain. The methionine residue at position 249 is embedded in the conserved sequence VMA, which is present in all ADAMTSs as the consensus sequence V/IMA/S and which accounts for the specific met-turn, characteristic for metzincins 146,172,

37 CHAPTER 1: General Introduction Figure 10 : Amino acid sequence of ADAMTS-13. Arrows indicate the initiating amino acid of the domain mentioned. Brackets below the sequence highlight potential N-glycosylation sites according to the consensus sequence (NXT/S). The RGD(S) sequence is boxed and in the metalloprotease domain, the histidines within the consensus sequence HEXXHXXG/N/SXXHD are boxed, too. The boxed residues E 83, D 173, C 281 and D 284 are predicted to coordinate a Ca 2+ ion. Figure was adapted from Zheng et al. 158 Although there is no evidence to date that ADAMTSs bind to (certain) integrins, like ADAMs they all have a disintegrin-like domain, homologous to that of snake venom metalloproteases (SVMPs), which are indeed able to inhibit integrin-ligand interactions Many interactions with integrins are mediated through RGD recognition motifs, which is however not present in this part of ADAMTS-13, nor in the homologous SVMPs. The latter interact with integrins (mainly) through a conserved XXCD sequence, which is not present in the disintegrin domain of ADAMTS-13. It is hence not known why disintegrin domains are present in ADAM(TS)s in general and in ADAMTS-13 in particular 174. Another important feature of the disintegrin domain is the presence of eight well conserved cystein residues, albeit with unknown function 177. In between the disintegrin domain and the cystein-rich domain (Cys-rich domain), a first thrombospondin-1 repeat (TSP1-1) is located, unofficially designated as the central thrombospondin repeat, since it is conserved among all ADAMTSs 178. This type of repeat shares homology with the modules found in both thrombospondin-1 (TSP-1) and thrombospondin-2 (TSP-2) and it is one of the major features of the enzyme family, distinguishing them from ADAMs 178. TSP1-1 contains a complete WXXW sequence, potentially 37

38 CHAPTER 1: General Introduction modified by C-mannosylation and a CSXS/TCG sequence which is likely to be an O-fucosylation site 179. The latter motif has been reported to be important for the interaction of TSP-1 with CD36 (syn. GP IV or GP IIIb), present on platelets, endothelial cells and monocytes 180. Some early reports had linked the presence of CD36 auto-antibodies with TTP, providing data to hypothesize on a significant role of this receptor, but apart from clinical observations, no direct evidence has come up so far 181. Moreover, the presence of these autoantibodies in a number of other, unrelated, thrombocytopenias, excludes a unique relationship of CD36 autoantibodies and TTP/ADAMTS As in the disintegrin domain, the Cys-rich domain contains a conserved cystein signature composed of ten residues, consistent in ADAMTSs and ADAMs 147,183. Although rather expected in the disintegrin area, an RGD(S) sequence is found in the Cys-rich domain, as in ADAMTS To date, no interactions with integrins have been elucidated in general and for this domain in particular, hence the question arises whether this RGD consensus motif is cryptic or essential for ADAMTS-13 function. In fact, site-directed mutagenesis, exchanging the aspartic acid residue for a glutamic acid (RGD RGE), caused no substantial activity difference compared with the wild-type protein 184. Yet again, activity was assessed in partially denaturing conditions and is hence not necessarily physiologically relevant. Reports on ADAM proteins indicated that the cystein rich domain may be important for substrate specificity, at least in ADAM10 and ADAM The spacer domain is a typical feature of ADAMTSs and has no apparent structural similarities with any other polypeptide 147. In ADAMTS-4, it is important for the interaction with the extracellular matrix (ECM) and for shielding the active site 186. In ADAMTS-13, this domain may also play an important role, since C- terminally truncated mutants containing domains up until the spacer domain, retained VWF cleaving capacity, similar to the wild type enzyme, whilst deletion of this domain caused severe activity reduction 143,184. This was assessed both in a static assay, containing partially denaturing agents and in flow chambers, where no urea nor guanidine chloride is present 71. In ADAMTS-1, -4, -8 and -9, specific cleavage events occur within the spacer domain, reducing the size of the molecule and most likely exerting a physiologically relevant effect Whether this also happens within the ADAMTS-13 spacer is not sure, but it is known that plasma-derived ADAMTS-13 migrates as three separate bands on western blot, each having the same N-terminal sequence 137. This suggests that the bands are truncated forms, possibly as a result of alternative splicing or removal of either oligosaccharide side-chains or C-terminal polypeptides 158. Both thrombin and plasmin have been reported to specifically cleave ADAMTS , though not resulting in the migration pattern mentioned above and most probably not as a constitutive interaction, but rather as a consequence of coagulation/fibrinolysis cascade activation. Furthermore, it cannot be excluded that the triplet is an artifact, since taking blood on broad spectrum protease inhibitors on top of the usual anticoagulant, makes the two lowest bands disappear (unpublished data, Anderson PJ and Sadler JE). Purified recombinant ADAMTS-13 time-dependently loses activity and measurable antigen (on western blot) when stored at 4 C even in the presence of broad range protease inhibitors (Pefabloc SC without EDTA, own observations), maybe as a consequence of auto-proteolysis 190. However, the presence of trace amounts of other metalloproteases, derived from the expression medium or expressing cells, cannot be excluded and moreover, auto-proteolysis of other ADAMTSs is debated 147,

39 CHAPTER 1: General Introduction Following the spacer domain, seven more thrombospondin-1 repeats precede the C-terminal CUB-domains. Overall homology of mouse ADAMTS-13 with human ADAMTS-13 is 69%, with the central thrombospondin- 1 repeat sharing 88% of its amino acids, indicating its biologic stability throughout evolution. Human ADAMTS-13 TSP1-6 has the least homology with the murine equivalent (31%) and is, together with TSP1-4, the only domain in which so far no TTP causing missense mutations have been described (see Table 2). Despite the evolutionary preservation of the enzyme, murine ADAMTS-13 is not or merely active towards human VWF, although that may be due to molecular differences in VWF, too 192. Truncation after the spacer domain revealed a down-regulatory role for the thrombospondin-1 repeat tail of ADAMTS-13 71, as this mutant exerted greater activity towards its substrate (UL-VWF in this case). The C-terminal unique domains are called CUB domains, designated CUB1 and CUB2 (with CUB2 being the uttermost C-terminal domain) and are present in quite some proteins involved in the regulation of development 193. Recombinant CUB1, CUB 1+ 2 and synthetically CUB1 derived peptides were shown to partially inhibit the UL-VWF ADAMTS-13 interaction, whilst recombinant CUB2 alone exerted no such effect 71. Moreover, the same report showed direct interaction of CUB1 with UL-VWF in static assays, hypothesizing that this is the domain needed for docking onto exposed UL-VWF. Apparently, this is in conflict with the observation that C-terminally truncated ADAMTS-13 easily cleaves UL-VWF, hence not requiring the docking abilities of the CUB1 domain. The authors also noticed the paradoxical findings and hypothesized that apart from the CUB1 domain, another, yet unidentified, secondary domain must be directly interacting with UL-VWF, since ADAMTS-13 truncated after the spacer domain could also interact with UL-VWF in a static immunosorbent assay (ELISA). Recent data gave new insights in the plausible role of the ADAMTS-13 C-terminal CUB domains. Shang and co-workers showed that these unique domains are capable and necessary for apical sorting of the enzyme in both endothelial and Madin-Darby kidney cells 166. They showed that a signal sequence must be contained within the CUB domains, since a recombinant green fluorescent protein, fused to the ADAMTS-13 CUB domains, was expressed unidirectional in contrast to a non-fused recombinant protein that was found randomly ADAMTS-13 mode of action As mentioned earlier, activity of ADAMTS-13 is difficult to assess in vitro without partial denaturation of the substrate. It is therefore generally accepted that the Y-M scissile bond is inaccessible because of its embedded location in the A2 three-dimensional structure. The assays used before 2005 were all based on the initial methods developed by Tsai et al. and Furlan et al., employing semi-denaturing media 122,133. These assays have been subjected to thorough independent analysis and the different experimental approaches for residual VWF multimer analysis have been compared 194. In 2005, Kokame et al. presented a fluorogenic VWF-based substrate (FRETS-VWF73) that does not require (partial) denaturation and therefore provides a more physiologic approach for in vitro ADAMTS-13 activity measurement 140. The recombinant VWF fragment is based on the sequence D1596-R1668 in the A2 domain and is the minimal substrate, still recognized by ADAMTS Whether this assay indeed fully mimics the in vivo situation is unlikely, not because of inherent ADAMTS-13 features, but rather due to the nature of the truncated substrate, for wild type VWF is a complex molecule, most likely involved in the regulation of its own processing by this 39

40 CHAPTER 1: General Introduction metalloprotease 132,195,196. The development of new assays has not ceased and newer approaches can lead to new insights 197,198. Dong et al. showed that upon histamine stimulation of cultured human umbilical vein endothelial cells (HUVECs) under flow, UL-VWF is released from the internal pool and presented on the luminal surface of the cells 142. These UL-VWF can be visualized microscopically by perfusion with washed platelets, which will attach like beads-on-a-string (Figure 11). Some strings were over several millimeters in length, although it has not been proven that these extremely long structures were derived from one and the same VWF molecule. Plasma from a TTP patient, containing less than 10 % cleaving protease activity, was not able to make the strings disappear, whereas normal plasma did. The interaction could indeed be mediated by ADAMTS-13, since ADAMTS-13 coated beads adhered to the exposed strings in both venous and arterial shear velocities 199. Moreover, it was shown that these beads could interact with both coated A1 and A3 domains, with a slight preference for domain A3. The authors proposed that ADAMTS-13 in solution can access the A2 domain of UL-VWF, presented on the endothelial cell, via docking onto A3. The freshly proteolysed VWF would then no longer be unusually large and adopt a conformation which is further inaccessible for the metalloprotease, explaining the difficulties to perform in vitro cleavage of regular VWF multimers. The same group then showed by several experiments that P-selectin is the most likely candidate to immobilize the UL-VWF strings on the endothelial cell surface 200. Using an inhibitory anti-p-selectin antibody, formation of UL-VWF string could indeed be prevented, whilst RGDS peptides, heparin or an anti-integrin α v β 3 antibody could not. This could be the reason why P-selectin is co-localized in Weibel-Palade bodies, a hitherto vague relationship. Figure 11 : UL-VWF can be visualized by perfusion of washed platelets over histamine stimulated HUVECs, cultured on cover slides. The strings can be several millimeters in length, although it is not sure whether those long structures are derived from one and the same VWF molecule. Normal plasma (B) could rapidly make the strings disappear, while plasma from TTP patients (A) (containing less than 10% activity) wasn t able to do so. Figure adapted from Dong et al

41 CHAPTER 1: General Introduction The list of mutations in ADAMTS-13 that cause TTP is extending and it seems that no clear hot-spot strikes the eye (see further), indicating an important contribution of nearly all modules that make up the enzyme, which was hypothesized previously due to the overall well-conserved nature of ADAMTS-13. Despite the predicted docking role of CUB 1, the results of Tao et al. 71 also left some open questions as to other interactors (see 1.4.3). Epitope-mapping of auto-antibodies from patients who suffer from acquired TTP, showed that they are mainly interacting with the Cys-rich/spacer area, providing proof for the physiological relevance of these modules 201,202, although antibodies to other domains (e.g. CUB) were equally found. Moreover, the above mentioned studies of Soejima et al. 184 and Zheng et al. 143 lined the way for further examination of these domains. Gao et al. recently showed that the Cys-rich/spacer region interacts with a predicted α-helix just upstream of the Y-M scissile bond, delivering preliminary data for a direct interactive role with VWF, adding to the epitope and mutant data 203. Despite these interesting findings, not much is known about the exact docking and interaction mechanism involved, in vivo. Speculations on the presence of co-factors in plasma, influencing ADAMTS-13 VWF proteolysis, have been made 68,142, but not much is known on the nature of these. Nishio et al. 68 provided evidence that the platelet receptor complex GP Ib/IX/V is involved, because recombinant GP Ibα could time-dependently enhance the in vitro proteolysis of a recombinant A1A2A3 fragment. Soluble GP Ibα, called glycocalicin, is present in plasma, but with hitherto unknown function; the results of Nishio et al. could link this soluble receptor moiety to ADAMTS-13 function. The same study also indicated a negative modulatory role for the VWF A1 domain, provided it is in complex with A1A2A3, since soluble A1 exerted no effect on the in vitro cleavage of A2A3. Whether this domain wields the same function when continuous with the whole VWF multimer is not known Thrombotic thrombocytopenic purpura (TTP) Thrombotic thrombocytopenic purpura is a rare disease with 3.7 cases per million annually, in the United States of America (registered from 1968 to 1991) 204. Patients symptoms are severe thrombocytopenia with platelet counts below 20,000 per µl, hemolytic anemia with fragmented red blood cells (shistocytes) in a peripheral blood smear and global or focal ischemic neurological signs according to Moake 135,136. Earlier on, in the mid-sixties, a classical TTP pentad of symptoms was formulated, often still used as diagnostic criterion 205,206, adding renal dysfunction and fever to the above stated triad 207. The latter two are not imperatively connected to TTP and should therefore be considered with caution. Without treatment, the intravascular platelet-rich aggregates cause ischemic disease with multiple organ failure leading to death in nearly all affected patients 208. The disease is characterized by the appearance of UL-VWF, which cause spontaneous platelet agglutination in the microvasculature, leading to thrombocytopenia and local ischemia. The etiology of disease is not well comprehended, although it is known that TTP can be secondary to existing challenges the organism is or has been exposed to (see below). The importance of this disease lies not only within its incidence, but furthermore in its molecular mechanism that most likely will reveal important clinical and basic insights in the field of hematology and hemostasis research. Two major forms of TTP are being distinguished, based on the genetic and molecular background; acquired TTP and hereditary TTP (syn. familial TTP, congenital TTP, Upshaw-Schulman syndrome) 209,

42 CHAPTER 1: General Introduction Acquired TTP In nearly all cases, TTP is acquired, with auto-antibodies against ADAMTS-13 either blocking its function or causing rapid clearance from circulation 135,211. The sudden auto-immune reaction is of unknown origin and therefore this type of TTP is often referred to as idiopathic, or unknown etiology. Sometimes, acquired TTP can be secondary to other clinical manifestations including bone marrow transplantation, human immunodeficiency virus (HIV) infection, ticlopidine treatment and others (Table 1) 135, Patients suffering from this disease require plasma exchange treatment, an empirically designed therapy that literally replaces the patient s plasma with donor equivalents 215. Treatment has reduced mortality rates to approximately 20% of affected patients 216, where originally 90 % of TTP patients did not survive the first TTP bout. Of course, potential complications using donor material are obvious, stating a definite need to investigate less dangerous approaches like recombinant enzyme technologies 217 or the use of antithrombotics aiming at primary adhesion 218. Supplemental treatments, mainly aiming at the hyperactive immune system, including corticosteroid administration, retuximab treatment (monoclonal anti-cd20) and splenectomy have been applied with alternating success Relapse in acquired TTP patients is high (up to 36%) and can occur even years after having suffered a first bout 222, but most frequently during the first year after disease onset 223. Patient follow-up is therefore imperative, but unfortunately no real discrepancies between non-relapsing and relapsing patients have come up, yet 205. Table 1 : Clinical subtypes of TTP. Table was adopted from Allford et al Hereditary TTP (Upshaw-Schulman syndrome) This form of TTP is extremely rare with few well-described cases, autosomal recessive inherited and hence caused by homozygous or compound heterozygous mutations in the ADAMTS-13 gene 139. It usually presents during childhood, although cases of later onset have been reported 224. It is also characterized by frequent relapse, as no de novo synthesis of functionally active ADAMTS-13 is possible in these patients

43 CHAPTER 1: General Introduction Since ADAMTS-13 has been identified, over sixty mutations that are causative or presumably causative for TTP, have been described in the literature (Table 2). No clear pattern can be drawn, as mutations are randomly spread across the gene and only a few have been characterized in vitro. These patients are treated with regular plasma infusion (every 3 to 4 weeks) to supplement their deficient plasma with donor ADAMTS-13. Plasma exchange is needless, since no inhibitor or plasma factor needs to be disposed of TTP Animal Model In 2005, Motto et al. published a knockout ADAMTS-13 -/- mouse model 225. The animals were viable, refuting earlier assumptions that complete genetic deficiency is lethal, based on the absence of clear null alleles and hypothesizing on ADAMTS-13 involvement in embryonic development 139. ADAMTS-13 -/- mice had no apparently different phenotype than their healthy relatives, apart from the in vitro absence of VWF cleaving activity. The most important observation was that, despite complete lack of in vitro metalloprotease activity, TTP or alike symptoms did not set in, implying that additional factors, next to lacking ADAMTS-13, are essential to induce the disease. These so-called triggers were already hypothesized, since family members with the same in vitro VWF-CP data (total lack of activity) presented with clinical phenotypic variability 139,224. The most likely candidate for triggering TTP is endothelium activation, as this process involves release of thrombogenic UL-VWF multimers, alluding to a significant contribution of the substrate itself in TTP etiology 136,142. Anticipating on this central idea, the authors back-crossed the mutant mouse in the murine CASA/rk genetic background, as this strain has significantly higher VWF antigen levels than the originally studied strain (mixed C57BL/6j and 129X1/SvJ; ADAMTS-13 B/129 ), which apparently lacked homology with human TTP, from the clinical point of view. Indeed, some, but not all, CASA/rk ADAMTS-13 -/- presented with features comparable to the human illness. Strikingly, no correlation between VWF antigen levels and disease severity was found, despite the above stated assumption and the subsequent findings in the CASA/rk strain. Banno et al. also constructed a knockout ADAMTS-13 -/- mouse and came to the same overall conclusions 226. Very recently, Chauhan et al. showed that human ADAMTS-13 acts as a natural anti-thrombotic in a wildtype murine venous thrombosis model 227. The same group also showed that stimulated ADAMTS-13 -/- endothelium presents a surface for the formation and subsequent embolization of thrombi, providing new insights in the potential disease mechanism, albeit that in humans, mainly arterioles are affected 127,228. Taken together, the most recent results show that ADAMTS-13 not only plays a role in TTP, but that it is furthermore a regulator of thrombus growth, labeling it as a promising tool for gaining clinical as well as basic insights in hemostasis. 43

44 CHAPTER 1: General Introduction Table 2 : Published mutations in the ADAMTS-13 gene, most likely involved in TTP. (Probable) SNPs are not depicted. n.d. means the author did not describe this feature. Exon/Intron Nucleotide Amino Acids Domain In Vitro Analysis Reference 1 Ex C>T Q44Stop Propeptide no Int. 3 5 border Splice Metalloprotease yes Ex C>G I79M Metalloprotease no Ex G>A V88M Metalloprotease no Ex C>G H96D Metalloprotease no Ex del29 Frameshift Metalloprotease no Ex C>T R102C Metalloprotease no Int G>A Splice Metalloprotease yes Ex C>T R193W Metalloprotease yes Ex C>T T196I Metalloprotease no Ex T>C S203P Metalloprotease no Int G>A Splice Metalloprotease yes Int A>G n.d. Metalloprotease no Ex T>A L232Q Metalloprotease no Ex C>A H234Q Metalloprotease no Ex G>C D235H Metalloprotease no Ex del6 n.d. Metalloprotease no Ex. 7 n.d. A250V Metalloprotease yes Ex C>G S263C Metalloprotease no Ex G>C R268P Metalloprotease yes Ex G>A C311Y Disintegrin-like no Int. 8 del29 n.d. Disintegrin-like no Ex C>T P353L Disintegrin-like no Ex del18 W365C + del3 Disintegrin-like no Ex G>A W390Stop TSP1-1 no Ex G>C W390C TSP1-1 no Ex G>A R398H TSP1-1 no Int T>G Splice TSP1-1 yes Ex. 12 Acc splice G>A n.d. n.d. no Ex C>T Q449Stop Cystein-rich yes Ex C>T P457L Cystein-rich no Ex G>A R507Q Cystein-rich no Ex G>A C508Y Cystein-rich yes Ex A>G R528G Cystein-rich no Int G>A Splice Cystein-rich no Ex delTT Frameshift Spacer no Ex C>T A596V Spacer no Ex A>T I673F Spacer yes Ex C>T R692C TSP1-2 no Ex C>T A732V TSP1-2 no Ex T>C C758R TSP1-3 no Ex delG Frameshift TSP1-3 no Ex del26 Frameshift TSP1-3 no Ex delAT Frameshift TSP1-4 no Ex G>C C908S TSP1-5 no Ex G>A C908Y TSP1-5 yes Ex C>T R910Stop TSP1-5 no Ex del6 C977W + del2 TSP1-6 no Ex T>G C1024G TSP1-7 no Ex A>T R1034Stop TSP1-7 no Ex delCT R1096Stop TSP1-8 no Ex C>T R1123C TSP1-8 yes Ex C>T R1206Stop CUB1 no Ex G>A C1213Y CUB1 no Ex. 26 n.d. R1219W CUB1 no Ex G>T G1239V CUB1 yes Ex G>A W1245X CUB1 no Ex insT Frameshift CUB1 no Ex C>T R1336W CUB2 no Ex insA Frameshift CUB2 no

45 CHAPTER 1: General Introduction 1.6 REFERENCES 1 Sierko E, Wojtukiewicz MZ. "Platelets and angiogenesis in malignancy." Seminars in Thrombosis and Hemostasis. 2004;30: Tan KT, Lip GY. "The potential role of platelet microparticles in atherosclerosis." Thromb Haemost. 2005;94: Tang YQ, Yeaman MR, Selsted ME. "Antimicrobial peptides from human platelets." Infect Immun. 2002;70: Nachmias VT. "Cytoskeleton of human platelets at rest and after spreading." J Cell Biol. 1980;86: Barbui T, Finazzi G. "Thrombocytosis." In: Loscalzo J, Schafer A, eds. Thrombosis and Hemorrhage. Philadelphia: Lippincott Williams & Wilkins; 2003: ISBN: X 6 Harrison CN. "Platelets and thrombosis in myeloproliferative diseases." Hematology (Am Soc Hematol Educ Program ). 2005; Kroll MH, Reséndiz J. "Mechanisms of Platelet Activation." In: Loscalzo J, Schafer A, eds. Thrombosis and Hemorrhage. Philadelphia: Lippincott Williams & Wilkins; 2003: ISBN: X 8 Clemetson KJ. "Platelet GPIb-V-IX complex." Thromb Haemost. 1997;78: Nieuwenhuis HK, Akkerman JW, Houdijk WP, Sixma JJ. "Human blood platelets showing no response to collagen fail to express surface glycoprotein Ia." Nature. 1985;318: Emsley J, Knight CG, Farndale RW, Barnes MJ, Liddington RC. "Structural basis of collagen recognition by integrin alpha2beta1." Cell. 2000;101: Schoolmeester A, Vanhoorelbeke K, Katsutani S et al. "Monoclonal antibody IAC-1 is specific for activated {alpha}2{beta}1 and binds to amino acids 199 to 201 of the integrin {alpha}2 I-domain." Blood. 2004;104: Van de Walle GR, Vanhoorelbeke K, Majer Z et al. "Two functional active conformations of the integrin alpha 2 beta 1, depending on activation condition and cell type." Journal of Biological Chemistry. 2005;280: Ishibashi T, Ichinohe T, Sugiyama T et al. "Functional significance of platelet membrane glycoprotein p62 (GP VI), a putative collagen receptor." Int J Hematol. 1995;62: Moroi M, Jung SM, Shinmyozu K et al. "Analysis of platelet adhesion to a collagen-coated surface under flow conditions: the involvement of glycoprotein VI in the platelet adhesion." Blood. 1996;88: Nieswandt B, Watson SP. "Platelet collagen interaction: is GPVI the central receptor?" Blood Bori-Sanz T, Inoue KS, Berndt MC, Watson SP, Tulasne D. "Delineation of the region in the glycoprotein VI tail required for association with the Fc receptor gamma-chain." J Biol Chem. 2003;278: Hartwig JH. "Platelet Morphology and Shape Change." In: Loscalzo J, Schafer A, eds. Thrombosis and Hemorrhage. Philadelphia: Lippincott Williams & Wilkins; 2003: ISBN: X 18 Mosesson MW. "Fibrinogen and fibrin structure and functions." J Thromb Haemost. 2005;3: Shattil SJ, Hoxie JA, Cunningham M, Brass LF. "Changes in the platelet membrane glycoprotein IIb.IIIa complex during platelet activation." J Biol Chem. 1985;260: Moncada S, Gryglewski R, Bunting S, Vane JR. "An enzyme isolated from arteries transforms prostaglandin endoperoxides to an unstable substance that inhibits platelet aggregation." Nature. 1976;263: Vallance P, Collier J, Moncada S. "Nitric-Oxide Synthesized from L-Arginine Mediates Endothelium Dependent Dilatation in Human Veins Invivo." Cardiovascular Research. 1989;23: Boegehold MA. "Heterogeneity of endothelial function within the circulation." Current Opinion in Nephrology and Hypertension. 1998;7: Zimmerman TS, Ratnoff OD, Powell AE. "Immunologic differentiation of classic hemophilia (factor 8 deficiency) and von Willebrand's dissase, with observations on combined deficiencies of antihemophilic factor and proaccelerin (factor V) and on an acquired circulating anticoagulant against antihemophilic factor." J Clin Invest. 1971;50: Von Willebrand EA. "Hereditär pseudohemofili." Fin Laekaresaellsk Hand. 1926;68: Rodeghiero F, Castaman G, Dini E. "Epidemiological investigation of the prevalence of von Willebrand's disease." Blood. 1987;69: Ruggeri ZM. "Von Willebrand Factor and the Mechanisms of Platelet Function." Berlin: Springer- Verlag;

46 CHAPTER 1: General Introduction ISBN: Titani K, Kumar S, Takio K et al. "Amino acid sequence of human von Willebrand factor." Biochemistry. 1986;25: Shelton-Inloes BB, Titani K, Sadler JE. "cdna sequences for human von Willebrand factor reveal five types of repeated domains and five possible protein sequence polymorphisms." Biochemistry. 1986;25: Colombatti A, Bonaldo P. "The superfamily of proteins with von Willebrand factor type A-like domains: one theme common to components of extracellular matrix, hemostasis, cellular adhesion, and defense mechanisms." Blood. 1991;77: Perkins SJ, Smith KF, Williams SC et al. "The secondary structure of the von Willebrand factor type A domain in factor B of human complement by Fourier transform infrared spectroscopy. Its occurrence in collagen types VI, VII, XII and XIV, the integrins and other proteins by averaged structure predictions." J Mol Biol. 1994;238: Huizinga EG, Martijn vdp, Kroon J, Sixma JJ, Gros P. "Crystal structure of the A3 domain of human von Willebrand factor: implications for collagen binding." Structure. 1997;5: Huizinga EG, Tsuji S, Romijn RA et al. "Structures of glycoprotein Ibalpha and its complex with von Willebrand factor A1 domain." Science. 2002;297: De Marco L. "Interactions of VWF and Extracellular Matrices." In: Ruggeri ZM, ed. Von Willebrand Factor and the Mechanisms of Platelet Function. Berlin: Springer-Verlag; 1998.ISBN: Bonnefoy A, Romijn RA, Vandervoort PA et al. "von Willebrand factor A1 domain can adequately substitute for A3 domain in recruitment of flowing platelets to collagen." J Thromb Haemost. 2006;4: Hoylaerts MF, Yamamoto H, Nuyts K et al. "von Willebrand factor binds to native collagen VI primarily via its A1 domain." Biochem J. 1997;324 ( Pt 1): Denis C, Baruch D, Kielty CM et al. "Localization of von Willebrand factor binding domains to endothelial extracellular matrix and to type VI collagen." Arterioscler Thromb. 1993;13: Wu D, Vanhoorelbeke K, Cauwenberghs N et al. "Inhibition of the von Willebrand (VWF)-collagen interaction by an antihuman VWF monoclonal antibody results in abolition of in vivo arterial platelet thrombus formation in baboons." Blood. 2002;99: Romijn RA, Bouma B, Wuyster W et al. "Identification of the collagen-binding site of the von Willebrand factor A3-domain." J Biol Chem. 2001;276: Romijn RA, Westein E, Bouma B et al. "Mapping the Collagen-binding Site in the von Willebrand Factor-A3 Domain." J Biol Chem. 2003;278: Lisman T, Raynal N, Groeneveld D et al. "A single high-affinity binding site for von Willebrand Factor in collagen III, identified using synthetic triple-helical peptides." Blood Emsley J, Cruz M, Handin R, Liddington R. "Crystal structure of the von Willebrand Factor A1 domain and implications for the binding of platelet glycoprotein Ib." J Biol Chem. 1998;273: Staelens S. Genetic Engineering, Structural Analysis and in vivo Characterization of the Antithrombotic anti-von Willebrand Factor Antibody 82D6A3. Catholic University of Leuven; Faculty of Science, Department of Chemistry and Biochemistry, Laboratory for Thrombosis Research, 2005.PhD Thesis 43 Savage B, Sixma JJ, Ruggeri ZM. "Functional self-association of von Willebrand factor during platelet adhesion under flow." Proc Natl Acad Sci U S A. 2002;99: Ulrichts H, Vanhoorelbeke K, Girma JP et al. "The von Willebrand factor self-association is modulated by a multiple domain interaction." J Thromb Haemost. 2005;3: Christophe O, Obert B, Meyer D, Girma JP. "The binding domain of von Willebrand factor to sulfatides is distinct from those interacting with glycoprotein Ib, heparin, and collagen and resides between amino acid residues Leu 512 and Lys 673." Blood. 1991;78: Ware J. "Molecular analyses of the platelet glycoprotein Ib-IX-V receptor." Thromb Haemost. 1998;79: Tomiyama Y, Shiraga M, Shattil SJ. "Platelet membrane proteins as adhesion receptors." In: Gresele P, Page C, Fuster V, Vermylen J, eds. Platelets in Thrombotic and Non-Thrombotic Disorders. Cambridge: Cambridge University Press; 2002:80-92.ISBN: Howard MA, Sawers RJ, Firkin BG. "Ristocetin - Means of Differentiating Vonkarman Willebrands Disease Into 2 Groups." Blood. 1973;41: Brinkhous KM, Read MS, Fricke WA, Wagner RH. "Botrocetin (venom coagglutinin): reaction with a broad spectrum of multimeric forms of factor VIII macromolecular complex." Proc Natl Acad Sci U S A. 1983;80:

47 CHAPTER 1: General Introduction 50 Ulrichts H, Udvardy M, Lenting PJ et al. "Shielding of the A1 Domain by the D'D3 Domains of von Willebrand Factor Modulates Its Interaction with Platelet Glycoprotein Ib-IX-V." J Biol Chem. 2006;281: Celikel R, Varughese KI, Madhusudan et al. "Crystal structure of the von Willebrand factor A1 domain in complex with the function blocking NMC-4 Fab." Nat Struct Biol. 1998;5: Staelens S, Hadders MA, Vauterin S et al. "Paratope determination of the antithrombotic antibody 82D6A3 based on the crystal structure of its complex with the von Willebrand factor A3-domain." J Biol Chem. 2006;281: Lee JO, Rieu P, Arnaout MA, Liddington R. "Crystal structure of the A domain from the alpha subunit of integrin CR3 (CD11b/CD18)." Cell. 1995;80: Qu A, Leahy DJ. "Crystal structure of the I-domain from the CD11a/CD18 (LFA-1, alpha L beta 2) integrin." Proc Natl Acad Sci U S A. 1995;92: Vasudevan S, Roberts JR, McClintock RA et al. "Modeling and functional analysis of the interaction between von Willebrand factor A1 domain and glycoprotein Ib alpha." Journal of Biological Chemistry. 2000;275: Pierschbacher MD, Ruoslahti E. "Cell Attachment Activity of Fibronectin Can be Duplicated by Small Synthetic Fragments of the Molecule." Nature. 1984;309: Ruoslahti E, Pierschbacher MD. "New Perspectives in Cell-Adhesion - Rgd and Integrins." Science. 1987;238: De Meyer SF, Ulrichts H, Staelens S et al. "Development of monoclonal antibodies that inhibit platelet adhesion or aggregation as potential anti-thrombotic drugs." Curr Drug Targets Cardiovasc Haematol Disord. In press. 59 Ruggeri ZM, Dent JA, Saldivar E. "Contribution of distinct adhesive interactions to platelet aggregation in flowing blood." Blood. 1999;94: Thompson AR. "Structure and function of the factor VIII gene and protein." Seminars in Thrombosis and Hemostasis. 2003;29: Gaucher C, Mercier B, Jorieux S, Oufkir D, Mazurier C. "Identification of 2 Point Mutations in the Vonwillebrand-Factor Gene of 3 Families with the Normandy Variant of Vonwillebrand Disease." British Journal of Haematology. 1991;78: Cacheris PM, Nichols WC, Ginsburg D. "Molecular Characterization of A Unique Vonwillebrand Disease Variant - A Novel Mutation Affecting Vonwillebrand-Factor Factor-Viii Interaction." Journal of Biological Chemistry. 1991;266: Kroner PA, Friedman KD, Fahs SA, Scott JP, Montgomery RR. "Abnormal Binding of Factor-Viii Is Linked with the Substitution of Glutamine for Arginine-91 in Vonwillebrand-Factor in A Variant Form of Vonwillebrand Disease." Journal of Biological Chemistry. 1991;266: Gu J, Jorieux S, Lavergne JM et al. "Patient with type 2N von Willebrand disease is heterozygous for a new mutation: Gly22Glu. Demonstration of a defective expression of the second allele by the use of monoclonal antibodies." Blood. 1997;89: Sutherland JJ, O'Brien LA, Lillicrap D, Weaver DF. "Molecular modeling of the von Willebrand factor A2 domain and the effects of associated type 2A von Willebrand disease mutations." Journal of Molecular Modeling. 2004;10: Dent JA, Berkowitz SD, Ware J, Kasper CK, Ruggeri ZM. "Identification of a cleavage site directing the immunochemical detection of molecular abnormalities in type IIA von Willebrand factor." Proc Natl Acad Sci U S A. 1990;87: Kokame K, Matsumoto M, Fujimura Y, Miyata T. "VWF73, a region from D1596 to R1668 of von Willebrand factor, provides a minimal substrate for ADAMTS-13." Blood. 2004;103: Nishio K, Anderson PJ, Zheng XL, Sadler JE. "Binding of platelet glycoprotein Ib alpha to von Willebrand factor domain A1 stimulates the cleavage of the adjacent domain A2 by ADAMTS13." Proceedings of the National Academy of Sciences of the United States of America. 2004;101: Nichols WC, Ginsburg D. "von Willebrand disease." Medicine (Baltimore). 1997;76: Hassenpflug WA, Budde U, Obser T et al. "Impact of mutations in the von Willebrand factor A2 domain on ADAMTS 13-dependent proteolysis." Blood. 2006;107: Tao ZY, Peng YD, Nolasco L et al. "Recombinant CUB-1 domain polypeptide inhibits the cleavage of ULVWF strings by ADAMTS13 under flow conditions." Blood. 2005;106: Ribes JA, Francis CW. "Multimer Size Dependence of Vonwillebrand-Factor Binding to Cross-Linked Or Noncrosslinked Fibrin." Blood. 1990;75: Hada M, Kaminski M, Bockenstedt P, Mcdonagh J. "Covalent Cross-Linking of Vonwillebrand-Factor to Fibrin." Blood. 1986;68: Roberts DD, Haverstick DM, Dixit VM et al. "The Platelet Glycoprotein Thrombospondin Binds Specifically to Sulfated Glycolipids." Journal of Biological Chemistry. 1985;260:

48 CHAPTER 1: General Introduction 75 Mancuso DJ, Tuley EA, Westfield LA et al. "Structure of the gene for human von Willebrand factor." J Biol Chem. 1989;264: Ginsburg D, Handin RI, Bonthron DT et al. "Human von Willebrand factor (vwf): isolation of complementary DNA (cdna) clones and chromosomal localization." Science. 1985;228: Jahroudi N, Lynch DC. "Endothelial-Cell-Specific Regulation of Von-Willebrand-Factor Gene- Expression." Molecular and Cellular Biology. 1994;14: Ferreira V, Assouline Z, Schwachtgen JL et al. "The Role of the 5'-Flanking Region in the Cell- Specific Transcription of the Human Von-Willebrand-Factor Gene." Biochemical Journal. 1993;293: Orkin SH. "Gata-Binding Transcription Factors in Hematopoietic-Cells." Blood. 1992;80: Jahroudi N, Ardekani AM, Greenberger JS. "An NF1-like protein functions as a repressor of the von Willebrand factor promoter." Journal of Biological Chemistry. 1996;271: Wagner DD, Mayadas T, Marder VJ. "Initial glycosylation and acidic ph in the Golgi apparatus are required for multimerization of von Willebrand factor." J Cell Biol. 1986;102: Wagner DD, Lawrence SO, Ohlsson-Wilhelm BM, Fay PJ, Marder VJ. "Topology and order of formation of interchain disulfide bonds in von Willebrand factor." Blood. 1987;69: Voorberg J, Fontijn R, Calafat J et al. "Assembly and Routing of Vonwillebrand-Factor Variants - the Requirements for Disulfide-Linked Dimerization Reside Within the Carboxy-Terminal-151 Amino-Acids." Journal of Cell Biology. 1991;113: Carew JA, Browning PJ, Lynch DC. "Sulfation of Vonwillebrand-Factor." Blood. 1990;76: Voorberg J, Fontijn R, van Mourik JA, Pannekoek H. "Domains involved in multimer assembly of von willebrand factor (vwf): multimerization is independent of dimerization." EMBO J. 1990;9: Verweij CL, Hart M, Pannekoek H. "Expression of variant von Willebrand factor (vwf) cdna in heterologous cells: requirement of the pro-polypeptide in vwf multimer formation." EMBO J. 1987;6: Wise RJ, Pittman DD, Handin RI, Kaufman RJ, Orkin SH. "The Propeptide of Vonwillebrand-Factor Independently Mediates the Assembly of Vonwillebrand Multimers." Cell. 1988;52: Schneppenheim R, Brassard J, Krey S et al. "Defective dimerization of von Willebrand factor subunits due to a Cys-> Arg mutation in type IID von Willebrand disease." Proc Natl Acad Sci U S A. 1996;93: Sadler JE. "von Willebrand factor: two sides of a coin." Journal of Thrombosis and Haemostasis. 2005;3: Liaw L, Schwartz SM. "Comparison of Gene-Expression in Bovine Aortic Endothelium In-Vivo Versus In-Vitro - Differences in Growth-Regulatory Molecules." Arteriosclerosis and Thrombosis. 1993;13: Aird WC, Jahroudi N, Weilerguettler H, Rayburn HB, Rosenberg RD. "Human Von-Willebrand-Factor Gene-Sequences Target Expression to A Subpopulation of Endothelial-Cells in Transgenic Mice." Proceedings of the National Academy of Sciences of the United States of America. 1995;92: Wu QY, Drouet L, Carrier JL et al. "Differential Distribution of Vonwillebrand-Factor in Endothelial- Cells - Comparison Between Normal Pigs and Pigs with Vonwillebrand Disease." Arteriosclerosis. 1987;7: Bahnak BR, Wu QY, Coulombel L et al. "Expression of Vonwillebrand-Factor in Porcine Vessels - Heterogeneity at the Level of Vonwillebrand-Factor Messengerrna." Journal of Cellular Physiology. 1989;138: Fay PJ, Kawai Y, Wagner DD et al. "Propolypeptide of von Willebrand factor circulates in blood and is identical to von Willebrand antigen II." Science. 1986;232: Sporn LA, Marder VJ, Wagner DD. "Inducible secretion of large, biologically potent von Willebrand factor multimers." Cell. 1986;46: Wise RJ, Barr PJ, Wong PA et al. "Expression of A Human Proprotein Processing Enzyme - Correct Cleavage of the Vonwillebrand-Factor Precursor at A Paired Basic-Amino-Acid Site." Proceedings of the National Academy of Sciences of the United States of America. 1990;87: Takagi J, Fujisawa T, Sekiya F, Saito Y. "Collagen-Binding Domain Within Bovine Propolypeptide of Vonwillebrand-Factor." Journal of Biological Chemistry. 1991;266: Takagi J, Kasahara K, Sekiya F, Inada Y, Saito Y. "A Collagen-Binding Glycoprotein from Bovine Platelets Is Identical to Propolypeptide of Vonwillebrand-Factor." Journal of Biological Chemistry. 1989;264: Takagi J, Sekiya F, Kasahara K, Inada Y, Saito Y. "Inhibition of Platelet-Collagen Interaction by Propolypeptide of Vonwillebrand-Factor." Journal of Biological Chemistry. 1989;264: Loesberg C, Gonsalves MD, Zandbergen J et al. "The Effect of Calcium on the Secretion of Factor- Viii-Related Antigen by Cultured Human-Endothelial Cells." Biochimica et Biophysica Acta. 1983;763:

49 CHAPTER 1: General Introduction 101 Cramer EM, Bretongorius J, Beesley JE, Martin JF. "Ultrastructural Demonstration of Tubular Inclusions Coinciding with Vonwillebrand-Factor in Pig Megakaryocytes." Blood. 1988;71: Wagner DD. "Cell Biology of Von Willebrand Factor." Annual Review of Cell Biology. 1990;6: WEIBEL ER, PALADE GE. "New cytoplasmatic components in arterial endothelia." J Cell Biol. 1964;23: Hop C, Fontijn R, Vanmourik JA, Pannekoek H. "Polarity of constitutive and regulated von Willebrand factor secretion by transfected MDCK-II cells." Experimental Cell Research. 1997;230: Wagner DD, Saffaripour S, Bonfanti R et al. "Induction of Specific Storage Organelles by Von- Willebrand Factor Propolypeptide." Cell. 1991;64: Voorberg J, Fontijn R, Calafat J et al. "Biogenesis of Vonwillebrand Factor-Containing Organelles in Heterologous Transfected Cv-1 Cells." Embo Journal. 1993;12: McEver RP, Beckstead JH, Moore KL, Marshallcarlson L, Bainton DF. "Gmp-140, A Platelet Alpha- Granule Membrane-Protein, Is Also Synthesized by Vascular Endothelial-Cells and Is Localized in Weibel- Palade Bodies." Journal of Clinical Investigation. 1989;84: Koedam JA, Cramer EM, Briend E et al. "P-Selectin, A Granule Membrane-Protein of Platelets and Endothelial-Cells, Follows the Regulated Secretory Pathway in Att-20 Cells." Journal of Cell Biology. 1992;116: Rondaij MG, Bierings R, Kragt A, van Mourik JA, Voorberg J. "Dynamics and Plasticity of Weibel- Palade Bodies in Endothelial Cells." Arterioscler Thromb Vasc Biol Utgaard JO, Jahnsen FL, Bakka A, Brandtzaeg P, Haraldsen G. "Rapid secretion of prestored interleukin 8 from Weibel-Palade bodies of microvascular endothelial cells." Journal of Experimental Medicine. 1998;188: Oynebraten I, Bakke O, Brandtzaeg P, Johansen FE, Haraldsen G. "Rapid chemokine secretion from endothelial cells originates from 2 distinct compartments." Blood. 2004;104: Ozaka T, Doi Y, Kayashima K, Fujimoto S. "Weibel-Palade bodies as a storage site of calcitonin gene-related peptide and endothelin-1 in blood vessels of the rat carotid body." Anatomical Record. 1997;247: Fiedler U, Scharpfenecker M, Koidl S et al. "The Tie-2 ligand angiopoietin-2 is stored in and rapidly released upon stimulation from endothelial cell Weibel-Paladebodies." Blood. 2004;103: Koutts J, Walsh PN, Plow EF et al. "Active Release of Human Platelet Factor-Viii-Related Antigen by Adenosine-Diphosphate, Collagen, and Thrombin." Journal of Clinical Investigation. 1978;62: Dent JA, Galbusera M, Ruggeri ZM. "Heterogeneity of plasma von Willebrand factor multimers resulting from proteolysis of the constituent subunit." J Clin Invest. 1991;88: Xie L, Chesterman CN, Hogg PJ. "Control of von Willebrand factor multimer size by thrombospondin- 1." J Exp Med. 2001;193: Pimanda J, Hogg P. "Control of von Willebrand factor multimer size and implications for disease." Blood Rev. 2002;16: Pimanda JE, Ganderton T, Maekawa A et al. "Role of thrombospondin-1 in control of von Willebrand factor multimer size in mice." Journal of Biological Chemistry. 2004;279: Dubernard V, Arbeille BB, Lemesle MB, Legrand C. "Evidence for an alpha-granular pool of the cytoskeletal protein alpha-actinin in human platelets that redistributes with the adhesive glycoprotein thrombospondin-1 during the exocytotic process." Arteriosclerosis Thrombosis and Vascular Biology. 1997;17: Bonnefoy A, Daenens K, Feys HB et al. "Thrombospondin-1 controls vascular platelet recruitment and thrombus adherence in mice by protecting (sub)endothelial VWF from cleavage by ADAMTS13." Blood. 2006;107: Lopez JA, Dong JF. "Cleavage of von Willebrand factor by ADAMTS-13 on endothelial cells." Seminars in Hematology. 2004;41: Furlan M, Robles R, Lamie B. "Partial purification and characterization of a protease from human plasma cleaving von Willebrand factor to fragments produced by in vivo proteolysis." Blood. 1996;87: Furlan M. "Von Willebrand factor: molecular size and functional activity." Ann Hematol. 1996;72: Budde U, Dent JA, Berkowitz SD, Ruggeri ZM, Zimmerman TS. "Subunit Composition of Plasma Vonwillebrand-Factor in Patients with the Myeloproliferative Syndrome." Blood. 1986;68: Zimmerman TS, Dent JA, Ruggeri ZM, Nannini LH. "Subunit Composition of Plasma Vonwillebrand- Factor - Cleavage Is Present in Normal Individuals, Increased in Iia-Vonwillebrand Disease and Iib- Vonwillebrand Disease, But Minimal in Variants with Aberrant Structure of Individual Oligomers (Type-Iic, Type-Iid, Type-Iie)." Journal of Clinical Investigation. 1986;77:

50 CHAPTER 1: General Introduction 126 Moake JL, Rudy CK, Troll JH et al. "Unusually large plasma factor VIII:von Willebrand factor multimers in chronic relapsing thrombotic thrombocytopenic purpura." N Engl J Med. 1982;307: Moschcowitz E. "Hyaline thrombosis of the terminal arterioles and capillaries: a hitherto undescribed disease." Proc N Y Pathol Soc. 1924; Gasser C, Gautier E, Steck A, Siebenmann R, Oechslin R. "Hämolytisch-urämische syndrome: bilaterale nierenrindennekrosen bei akuten erworbenen hämolytischen anämien Schweizerische." Med Wochenschr. 1955;85: Chopek MW, Girma JP, Fujikawa K, Davie EW, Titani K. "Human von Willebrand factor: a multivalent protein composed of identical subunits." Biochemistry. 1986;25: Tsai HM, Nagel RL, Hatcher VB, Sussman II. "Endothelial Cell-Derived High Molecular-Weight Vonwillebrand-Factor Is Converted Into the Plasma Multimer Pattern by Granulocyte Proteases." Biochemical and Biophysical Research Communications. 1989;158: Berkowitz SD, Nozaki H, Titani K et al. "Evidence That Calpains and Elastase do Not Produce the Vonwillebrand-Factor Fragments Present in Normal Plasma and Iia Vonwillebrand Disease." Blood. 1988;72: Tsai HM, Sussman II, Nagel RL. "The Native Conformation of Vwf Confers Resistance to Proteolysis by A Plasma Protease That Is Distinct from Plasmin Or Calpain." Blood. 1994;84:A Tsai HM. "Physiologic cleavage of von Willebrand factor by a plasma protease is dependent on its conformation and requires calcium ion." Blood. 1996;87: Furlan M, Robles R, Galbusera M et al. "Von Willebrand factor-cleaving protease in thrombotic thrombocytopenic purpura and the hemolytic-uremic syndrome." New England Journal of Medicine. 1998;339: Moake JL. "Thrombotic microangiopathies." N Engl J Med. 2002;347: Moake JL. "Thrombotic thrombocytopenic purpura: the systemic clumping "plague"." Annu Rev Med. 2002;53: Gerritsen HE, Robles R, Lammle B, Furlan M. "Partial amino acid sequence of purified von Willebrand factor-cleaving protease." Blood. 2001;98: Fujikawa K, Suzuki H, McMullen B, Chung D. "Purification of human von Willebrand factor-cleaving protease and its identification as a new member of the metalloproteinase family." Blood. 2001;98: Levy GG, Nichols WC, Lian EC et al. "Mutations in a member of the ADAMTS gene family cause thrombotic thrombocytopenic purpura." Nature. 2001;413: Kokame K, Nobe Y, Kokubo Y, Okayama A, Miyata T. "FRETS-VWF73, a first fluorogenic substrate for ADAMTS13 assay." Br J Haematol. 2005;129: Feys HB, Liu F, Dong N et al. "ADAMTS-13 plasma level determination uncovers antigen absence in acquired thrombotic thrombocytopenic purpura and ethnic differences." Journal of Thrombosis and Haemostasis. In press. 142 Dong JF, Moake JL, Nolasco L et al. "ADAMTS-13 rapidly cleaves newly secreted ultralarge von Willebrand factor multimers on the endothelial surface under flowing conditions." Blood. 2002;100: Zheng XL, Nishio K, Majerus EM, Sadler JE. "Cleavage of von Willebrand factor requires the spacer domain of the metalloprotease ADAMTS13." Journal of Biological Chemistry. 2003;278: Stone AL, Kroeger M, Sang QXA. "Structure-function analysis of the ADAM family of disintegrin-like and metalloproteinase-containing proteins (review)." Journal of Protein Chemistry. 1999;18: Gomis-Ruth FX. "Structural aspects of the metzincin clan of metalloendopeptidases." Molecular Biotechnology. 2003;24: Stocker W, Grams F, Baumann U et al. "The Metzincins - Topological and Sequential Relations Between the Astacins, Adamalysins, Serralysins, and Matrixins (Collagenases) Define A Superfamily of Zinc- Peptidases." Protein Science. 1995;4: Porter S, Clark IM, Kevorkian L, Edwards DR. "The ADAMTS metalloproteinases." Biochemical Journal. 2005;386: Kuno K, Kanada N, Nakashima E et al. "Molecular cloning of a gene encoding a new type of metalloproteinase- disintegrin family protein with thrombospondin motifs as an inflammation associated gene." J Biol Chem. 1997;272: Llamazares M, Cal S, Quesada V, Lopez-Otin C. "Identification and characterization of ADAMTS-20 defines a novel subfamily of metalloproteinases-disintegrins with multiple thrombospondin-1 repeats and a unique GON domain." Journal of Biological Chemistry. 2003;278: Colige A, Sieron AL, Li SW et al. "Human Ehlers-Danlos syndrome type VIIC and bovine dermatosparaxis are caused by mutations in the procollagen IN-proteinase gene." American Journal of Human Genetics. 1999;65:

51 CHAPTER 1: General Introduction 151 Clark ME, Kelner GS, Turbeville LA et al. "ADAMTS9, a novel member of the ADAM- TS/metallospondin gene family." Genomics. 2000;67: Blelloch R, Santa Anna-Arriola S, Gao DL et al. "The gon-1 gene is required for gonadal morphogenesis in Caenorhabditis elegans." Developmental Biology. 1999;216: Blelloch R, Kimble J. "Control of organ shape by a secreted metalloprotease in the nematode Caenorhabditis elegans." Nature. 1999;399: Liu CJ, Kong W, Ilalov K et al. "ADAMTS-7: a metalloproteinase that directly binds to and degrades cartilage oligomeric matrix protein." FASEB J Tang BL, Hong W. "ADAMTS: a novel family of proteases with an ADAM protease domain and thrombospondin 1 repeats." FEBS Lett. 1999;445: Tortorella MD, Burn TC, Pratta MA et al. "Purification and cloning of aggrecanase-1: A member of the ADAMTS family of proteins." Science. 1999;284: Somerville RPT, Longpre JM, Jungers KA et al. "Characterization of ADAMTS-9 and ADAMTS-20 as a distinct ADAMTS subfamily related to Caenorhabditis elegans GON-1." Journal of Biological Chemistry. 2003;278: Zheng X, Chung D, Takayama TK et al. "Structure of von Willebrand factor-cleaving protease (ADAMTS13), a metalloprotease involved in thrombotic thrombocytopenic purpura." J Biol Chem. 2001;276: Tang BL. "ADAMTS: a novel family of extracellular matrix proteases." Int J Biochem Cell Biol. 2001;33: Somerville RPT, Jungers KA, Apte SS. "Discovery and characterization of a novel, widely expressed metalloprotease, ADAMTS10, and its proteolytic activation." Journal of Biological Chemistry. 2004;279: Somerville RPT, Longpre JM, Apel ED et al. "ADAMTS7B, the full-length product of the ADAMTS7 gene, is a chondroitin sulfate proteoglycan containing a mucin domain." Journal of Biological Chemistry. 2004;279: Majerus EM, Zheng XL, Tuley EA, Sadler JE. "Cleavage of the ADAMTS13 propeptide is not required for protease activity." Journal of Biological Chemistry. 2003;278: Sadler JE. "A new name in thrombosis, ADAMTS13." Proc Natl Acad Sci U S A. 2002;99: Hurskainen TL, Hirohata S, Seldin MF, Apte SS. "ADAM-TS5, ADAM-TS6, and ADAM-TS7, novel members of a new family of zinc metalloproteases. General features and genomic distribution of the ADAM- TS family." J Biol Chem. 1999;274: Uemura M, Tatsumi K, Matsumoto M et al. "Localization of ADAMTS13 to the stellate cells of human liver." Blood. 2005;106: Shang D, Zheng XW, Niiya M, Zheng XL. "Apical sorting of ADAMTS13 in vascular endothelial cells and Madin-Darby canine kidney cells depends on the CUB domains and their association with lipid rafts." Blood Turner N, Nolasco L, Tao Z, Dong JF, Moake J. "Human endothelial cells synthesize and release ADAMTS-13." J Thromb Haemost. 2006;4: Suzuki M, Murata M, Matsubara Y et al. "Detection of von Willebrand factor-cleaving protease (ADAMTS-13) in human platelets." Biochemical and Biophysical Research Communications. 2004;313: Liu L, Choi H, Bernardo A et al. "Platelet-derived VWF-cleaving metalloprotease ADAMTS-13." J Thromb Haemost. 2005;3: Bergeron F, Leduc R, Day R. "Subtilase-like pro-protein convertases: from molecular specificity to therapeutic applications." Journal of Molecular Endocrinology. 2000;24: Anderson PJ, Kokame K, Sadler JE. "Zinc and calcium ions cooperatively modulate ADAMTS13 activity." Journal of Biological Chemistry. 2006;281: Bjarnason JB, Fox JW. "Hemorrhagic Metalloproteinases from Snake-Venoms." Pharmacology & Therapeutics. 1994;62: Bjarnason JB, Fox JW. "Metalloproteinases from Snake-Venoms (Reprolysins), Structure, Function, and Relationship to Mammalian Reproductive Proteins." Journal of Cellular Biochemistry. 1994; Calvete JJ, Marcinkiewicz C, Monleon D et al. "Snake venom disintegrins: evolution of structure and function." Toxicon. 2005;45: Jia LG, Wang XM, Shannon JD, Bjarnason JB, Fox JW. "Function of disintegrin-like/cysteine-rich domains of atrolysin A - Inhibition of platelet aggregation by recombinant protein and peptide antagonists." Journal of Biological Chemistry. 1997;272: Markland FS. "Snake venoms and the hemostatic system." Toxicon. 1998;36:

52 CHAPTER 1: General Introduction 177 Cal S, Obaya AJ, Llamazares M et al. "Cloning, expression analysis, and structural characterization of seven novel human ADAMTSs, a family of metalloproteinases with disintegrin and thrombospondin-1 domains." Gene. 2002;283: Schneppenheim R, Budde U, Hassenpflug W, Obser T. "Severe ADAMTS-13 deficiency in childhood." Seminars in Hematology. 2004;41: Hofsteenge J, Huwiler KG, Macek B et al. "C-mannosylation and O-fucosylation of the thrombospondin type 1 module." Journal of Biological Chemistry. 2001;276: Li WX, Howard RJ, Leung LLK. "Identification of Svtcg in Thrombospondin As the Conformation- Dependent, High-Affinity Binding-Site for Its Receptor, Cd36." Journal of Biological Chemistry. 1993;268: Tandon NN, Rock G, Jamieson GA. "Anti-Cd36 Antibodies in Thrombotic Thrombocytopenic Purpura." British Journal of Haematology. 1994;88: Schultz DR, Arnold PI, Jy W et al. "Anti-CD36 autoantibodies in thrombotic thrombocytopenic purpura and other thrombotic disorders: identification of an 85 kd form of CD36 as a target antigen." British Journal of Haematology. 1998;103: Levy GG, Motto DG, Ginsburg D. "Adamts13 Turns 3." Blood. 2005;106: Soejima K, Matsumoto M, Kokame K et al. "ADAMTS-13 cysteine-rich/spacer domains are functionally essential for von Willebrand factor cleavage." Blood. 2003;102: Smith KM, Gaultier A, Cousin H et al. "The cysteine-rich domain regulates ADAM protease function in vivo." J Cell Biol. 2002;159: Hashimoto G, Shimoda M, Okada Y. "ADAMTS4 (aggrecanase-1) interaction with the C-terminal domain of fibronectin inhibits proteolysis of aggrecan." Journal of Biological Chemistry. 2004;279: Gao G, Westling J, Thompson VP et al. "Activation of the proteolytic activity of ADAMTS4 (aggrecanase-1) by C- terminal truncation." J Biol Chem. 2002;277: Gao G, Plaas A, Thompson VP et al. "ADAMTS4 (aggrecanase-1) activation on the cell surface involves C-terminal cleavage by glycosylphosphatidyl inositol-anchored membrane type 4-matrix metalloproteinase and binding of the activated proteinase to chondroitin sulfate and heparan sulfate on syndecan-1." J Biol Chem. 2004;279: Rodriguez-Manzaneque JC, Milchanowski AB, Dufour EK, Leduc R, Iruela-Arispe ML. "Characterization of METH-1/ADAMTS1 processing reveals two distinct active forms." Journal of Biological Chemistry. 2000;275: Flannery CR, Zeng WL, Corcoran C et al. "Autocatalytic cleavage of ADAMTS-4 (Aggrecanase-1) reveals multiple glycosaminoglycan-binding sites." Journal of Biological Chemistry. 2002;277: Crawley JTB, Lam JK, Rance JB et al. "Proteolytic inactivation of ADAMTS13 by thrombin and plasmin." Blood. 2005;105: Plaimauer B, Scheiflinger F. "Expression and characterization of recombinant human ADAMTS-13." Seminars in Hematology. 2004;41: Bork P, Beckmann G. "The Cub Domain - A Widespread Module in Developmentally-Regulated Proteins." Journal of Molecular Biology. 1993;231: Veyradier A, Girma JP. "Assays of ADAMTS-13 activity." Seminars in Hematology. 2004;41: Bowen DJ, Collins PW. "An amino acid polymorphism in von Willebrand factor correlates with increased susceptibility to proteolysis by ADAMTS13." Blood. 2004;103: Mannucci PM, Capoferri C, Canciani MT. "Plasma levels of von Willebrand factor regulate ADAMTS- 13, its major cleaving protease." British Journal of Haematology. 2004;126: Jin M, Cataland S, Bissell M, Wu HM. "A rapid test for the diagnosis of thrombotic thrombocytopenic purpura using surface enhanced laser desorption/ionization time-of-flight (SELDI-TOF)-mass spectrometry." J Thromb Haemost. 2006;4: Wu JJ, Fujikawa K, Lian EC et al. "A rapid enzyme-linked assay for ADAMTS-13." J Thromb Haemost. 2006;4: Dong JF, Moake JL, Bernardo A et al. "ADAMTS-13 metalloprotease interacts with the endothelial cell-derived ultra-large von Willebrand factor." Journal of Biological Chemistry. 2003;278: Padilla A, Moake JL, Bernardo A et al. "P-selectin anchors newly released ultralarge von Willebrand factor multimers to the endothelial cell surface." Blood. 2004;103: Klaus C, Plaimauer B, Studt JD et al. "Epitope mapping of ADAMTS13 autoantibodies in acquired thrombotic thrombocytopenic purpura." Blood. 2004;103: Luken BM, Turenhout EA, Hulstein JJ et al. "The spacer domain of ADAMTS13 contains a major binding site for antibodies in patients with thrombotic thrombocytopenic purpura." Thromb Haemost. 2005;93:

53 CHAPTER 1: General Introduction 203 Gao W, Anderson P, Majerus E, Tuley E, and Sadler JE. The C-terminal alpha-helix of von Willebrand Factor Domain A2 Interacts with ADAMTS-13 C-terminal Domains to Regulate Substrate Cleavage [abstract]. Blood. 2005;106:123a. 204 Torok TJ, Holman RC, Chorba TL. "Increasing Mortality from Thrombotic Thrombocytopenic Purpura in the United-States - Analysis of National Mortality Data, " American Journal of Hematology. 1995;50: Lammle B, Hovinga JAK, Alberio L. "Thrombotic thrombocytopenic purpura." Journal of Thrombosis and Haemostasis. 2005;3: Allford SL, Hunt BJ, Rose P, Machin SJ. "Guidelines on the diagnosis and management of the thrombotic microangiopathic haemolytic anaemias." British Journal of Haematology. 2003;120: Amorosi EL, Ultmann JE. "Thrombotic Thrombocytopenic Purpura: report of 16 cases and review of the literature." Medicine (Baltimore). 1966;45: Tsai HM. "Current concepts in thrombotic thrombocytopenic purpura." Annual Review of Medicine. 2006;57: Upshaw JD. "Congenital Deficiency of A Factor in Normal Plasma That Reverses Micro-Angiopathic Hemolysis and Thrombocytopenia." New England Journal of Medicine. 1978;298: Schulman I, PIERCE M, LUKENS A, CURRIMBHOY Z. "Studies on thrombopoiesis. I. A factor in normal human plasma required for platelet production; chronic thrombocytopenia due to its deficiency." Blood. 1960;16: Feys HB, Liu F, Dong N et al. "ADAMTS-13 plasma level determination uncovers antigen absence in acquired thrombotic thrombocytopenic purpura and ethnic differences." Journal of Thrombosis and Haemostasis. In press. 212 Schriber JR, Herzig GP. "Transplantation-associated thrombotic thrombocytopenic purpura and hemolytic uremic syndrome." Seminars in Hematology. 1997;34: Bennett CL, Weinberg PD, Green D. "Ticlopidine-associated thrombotic thrombocytopenic purpura - In response." Annals of Internal Medicine. 1998;129: Leaf AN, Laubenstein LJ, Raphael B et al. "Thrombotic Thrombocytopenic Purpura Associated with Human Immunodeficiency Virus Type-1 (Hiv-1) Infection." Annals of Internal Medicine. 1988;109: Byrnes JJ, Khurana M. "Treatment of Thrombotic Thrombocytopenic Purpura with Plasma." New England Journal of Medicine. 1977;297: Moake JL, Chow TW. "Thrombotic thrombocytopenic purpura: Understanding a disease no longer rare." American Journal of the Medical Sciences. 1998;316: Zhou WH, Dong LL, Ginsburg D, Bouhassira EE, Tsai HM. "Enzymatically active ADAMTS13 variants are not inhibited by anti-adamts13 autoantibodies - A novel therapeutic strategy?" Journal of Biological Chemistry. 2005;280: Cauwenberghs N, Meiring M, Vauterin S et al. "Antithrombotic effect of platelet glycoprotein Ibblocking monoclonal antibody Fab fragments in nonhuman primates." Arterioscler Thromb Vasc Biol. 2000;20: Hovinga JAK, Studt JD, Biasiutti FD et al. "Splenectomy relapsing and plasma-refractory acquired thrombotic thrombocytopenic purpura." Haematologica. 2004;89: Bell WR, Braine HG, Ness PM, Kickler TS. "Improved Survival in Thrombotic Thrombocytopenic Purpura Hemolytic Uremic Syndrome - Clinical-Experience in 108 Patients." New England Journal of Medicine. 1991;325: Zheng XL, Pallera AM, Goodnough LT, Sadler JE, Blinder MA. "Remission of chronic thrombotic thrombocytopenic purpura after treatment with cyclophosphamide and rituximab." Annals of Internal Medicine. 2003;138: Shumak KH, Rock GA, Nair RC et al. "Late Relapses in Patients Successfully Treated for Thrombotic Thrombocytopenic Purpura." Annals of Internal Medicine. 1995;122: Sadler JE, Moake JL, Miyata T, George JN. "Recent advances in thrombotic thrombocytopenic purpura." Hematology (Am Soc Hematol Educ Program ). 2004; Furlan M, Lammle B. "Aetiology and pathogenesis of thrombotic thrombocytopenic purpura and haemolytic uraemic syndrome: the role of von Willebrand factor-cleaving protease." Best Practice & Research Clinical Haematology. 2001;14: Motto DG, Chauhan AK, Zhu G et al. "Shigatoxin triggers thrombotic thrombocytopenic purpura in genetically susceptible ADAMTS13-deficient mice." J Clin Invest. 2005;115: Banno F, Kokame K, Okuda T et al. "Complete deficiency in ADAMTS13 is prothrombotic, but it alone is not sufficient to cause thrombotic thrombocytopenic purpura." Blood Chauhan AK, Motto DG, Lamb CB et al. "Systemic antithrombotic effects of ADAMTS13." J Exp Med. 2006;203:

54 CHAPTER 1: General Introduction 228 Moschcowitz E. "An acute febrile pleiochromic anemia with hyaline thrombosis of the terminal arterioles and capillaries: An undescribed disease." Mount Sinai Journal of Medicine. 2003;70: Antoine G, Zimmermann K, Plaimauer B et al. "ADAMTS13 gene defects in two brothers with constitutional thrombotic thrombocytopenic purpura and normalization of von Willebrand factor-cleaving protease activity by recombinant human ADAMTS13." British Journal of Haematology. 2003;120: Uchida T, Wada H, Mizutani M et al. "Identification of novel mutations in ADAMTS13 in an adult patient with congenital thrombotic thrombocytopenic purpura." Blood. 2004;104: Veyradier A, Lavergne JM, Ribba AS et al. "Ten candidate ADAMTS13 mutations in six French families with congenital thrombotic thrombocytopenic purpura (Upshaw-Schulman syndrome)." Journal of Thrombosis and Haemostasis. 2004;2: Bestetti G, Stellari A, Lattuada A et al. "ADAMTS 13 genotype and vwf protease activity in an Italian family with TTP." Thrombosis and Haemostasis. 2003;90: Peyvandi F, Ferrari S, Lavoretano S, Canciani MT, Mannucci PM. "von Willebrand factor cleaving protease (ADAMTS-13) and ADAMTS-13 neutralizing autoantibodies in 100 patients with thrombotic thrombocytopenic purpura." British Journal of Haematology. 2004;127: Matsumoto M, Kokame K, Soejima K et al. "Molecular characterization of ADAMTS13 gene mutations in Japanese patients with Upshaw-Schulman syndrome." Blood. 2004;103: Studt JD, Hovinga JA, Radonic R et al. "Familial acquired thrombotic thrombocytopenic purpura: ADAMTS13 inhibitory autoantibodies in identical twins." Blood. 2004;103: Schneppenheim R, Budde U, Oyen F et al. "Von Willebrand factor cleaving protease and ADAMTS13 mutations in childhood TTP." Blood. 2003;101: Shibagaki Y, Matsumoto M, Kokame K et al. "Novel compound heterozygote mutations (H234Q/R1206X) of the ADAMTS13 gene in an adult patient with Upshaw-Schulman syndrome showing predominant episodes of repeated acute renal failure." Nephrol Dial Transplant Assink K, Schiphorst R, Allford S et al. "Mutation analysis and clinical implications of von Willebrand factor-cleaving protease deficiency." Kidney International. 2003;63: Kokame K, Matsumoto M, Soejima K et al. "Mutations and common polymorphisms in ADAMTS13 gene responsible for von Willebrand factor-cleaving protease activity." Proc Natl Acad Sci U S A. 2002;99: Tao Z, Nolasco L, Aubrey B et al. An in-frame deletion of six amino acids and a point mutation in the disintegrin domain of ADAMTS-13 associates with a case of congenital TTP [abstract]. Blood (ASH Annual meeting abstracts). 2004; Licht C, Stapenhorst L, Simon T et al. "Two novel ADAMTS13 gene mutations in thrombotic thrombocytopenic purpura/hemolytic-uremic syndrome (TTP/HUS)." Kidney International. 2004;66: Savasan S, Lee SK, Ginsburg D, Tsai HM. "ADAMTS13 gene mutation in congenital thrombotic thrombocytopenic purpura with previously reported normal VWF cleaving protease activity." Blood. 2003;101: Donadelli R, Banterla F, Capoferri C, Galbusera M, and Ruggeri M. Diverse Functional Implications of ADAMTS-13 Gene Mutations in Patients with TTP and congenital Deficiency [abstract]. Blood (ASH Annual meeting abstracts). 2004; Peyvandi F, Lavoretano S, Palla R et al. "Mechanisms of the interaction between two ADAMTS13 gene mutations leading to severe deficiency of enzymatic activity." Hum Mutat. 2006;27:

55

56

57 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies CHAPTER 2. DEVELOPMENT OF ANTI-HUMAN ADAMTS-13 ANTIBODIES Hendrik B Feys 1, Karen De Bruin 2, Nele Vandeputte 1, Stephan Vauterin 1, Inge Pareyn 1, Evan J Sadler 3, Hans Deckmyn 1 and Karen Vanhoorelbeke 1 1 Laboratory for Thrombosis Research, IRC, KU Leuven Campus Kortrijk, Kortrijk, Belgium 2 Department of Haematology and Cell Biology, University of the Free State, Bloemfontein, South Africa 3 Howard Hughes Medical Institute, Department of Medicine, Washington University School of Medicine, St Louis, Missouri, United States of America

58 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies 2.1 ABSTRACT A method to culture continuous cell lines producing antibodies from the same clone and hence with identical properties was first described in Since then, immunobiotechnology has boosted and its applications in basic as well as clinical research is vital for modern laboratories. The identification of ADAMTS-13 (A Disintegrin And Metalloprotease with ThromboSpondin-1 motifs) as the von Willebrand factor (VWF) cleaving protease was a major breakthrough in hemostasis research and the generation of anti-adamts-13 monoclonal antibodies (mabs) shall be indispensable in view of clinical research; e.g. by setting up an animal model of acquired thrombotic thrombocytopenic purpura (TTP) or new diagnostic kits. Monoclonal antibodies also contribute to gain basic insights; e.g. for elucidation of the structure-function relationship of ADAMTS-13 and the mode of action towards its substrate. We have constructed two mammalian expression vectors, containing ADAMTS-13 cdna; one for DNA immunization and one for in vitro expression of the enzyme. A screening assay was developed, using a polyclonal antiserum generated against recombinant C- terminal CUB2. This test indicated that our immunization protocol resulted in an appropriate humoral immune response. After fusing myelomas and spleen cells from immune-reactive mice, hybridomas were analyzed and cultured to produce mabs, in vitro. The mabs were further characterized in immunosorbent assays and in Western blot. They were mapped to their respective ADAMTS-13 domains, using truncated mutants of the antigen. One mab (3H9) could inhibit VWF cleavage, in vitro, with an IC 50 of 42.8 ± 0.9 nm. In conclusion, we have developed a specialized screening assay that was able to select anti-adamts-13 producing cell lines and we have generated high affinity specific mabs which will be useful in a broad range of applications. 58

59 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies 2.2 INTRODUCTION Monoclonal antibodies (mabs) are high affinity binding tools that are derived from the organism s intrinsic defensive response to foreign molecules. Exposing the murine organism to human antigens like ADAMTS-13 (A Disintegrin And Metalloprotease with ThromboSpondin-1 motifs) will result in a humoral response, involving clonal selection and maturation of B-lymphocytes, which then produce specific antibodies against secondary structures or amino acids that are not present in the ADAMTS-13 murine orthologue. Mature B- cells reside in the spleen and in the lymph nodes but will differentiate in antibody secreting and circulating plasma cells for as long as the organism is challenged by the foreign antigen 1. After a series of injections with the same antigen, the organism is sacrificed and the spleen cells are used for the production of continuous monoclonal cell lines, each producing a specific antibody, directed against a determined part (epitopes) of the injected antigen 2. Monoclonal antibodies have, ever since their discovery, contributed to the elucidation of structure-function relationships 3 of antigens, to the development of accurate diagnostic and titer determination assays 4 and to pharmacology in the broad sense 5,6. In that scope, the production and characterization of anti-adamts-13 antibodies will most definitely reveal new insights in the properties of the enzyme and aid for the experimental setup of an animal model for thrombotic thrombocytopenic purpura (TTP). The latter involves the generation of either a functionally inhibiting mab, providing a basis for in vivo blocking of a prospective cross-reactive animal ADAMTS-13 orthologue or a mab that rapidly clears the antigen from circulation. For regular immunization, designed for in vitro mab production, a minimal amount (approx µg) of antigen is needed to induce an appropriate response in the host 7. This responsiveness (immunogenicity) is depending on the nature of the antigen, the route of administration, the presence or absence of adjuvants and the species or strain being used 1. Moreover, this antigen should be near purity, so to avoid false positives when using the same lot for screening the antibody producing hybridomas. In the beginning of this project, ADAMTS-13 was only just described as the von Willebrand factor (VWF) cleaving protease (2001) 8-10 and no tools for the purification nor for the screening were readily available. Moreover, since the recent discovery of the whole ADAMTS-family (from 1997 on) 11, not many reports have focused on the immunogenic properties of these enzymes, leaving no clues on the properties of ADAMTS-13 as immunogen. Producing those substantial amounts of pure ADAMTS-13, e.g. by recombinant expression technology but especially by purification from extracts 8,10, is time-consuming and substantial yields are not guaranteed. These problems can be elegantly bypassed, so to no longer depend exclusively on protein only; by a technique called genetic immunization or DNA immunization 12 (review 13 ). The administration of a plasmid, encoding the cdna of interest, has been shown to be sufficient to generate a humoral response to the encoded protein 14. This finding was specifically of interest for clinical laboratories, which favored the (future) use of DNA, instead of attenuated viruses or heat-killed bacteria, as a novel long-term active vaccination strategy, also because the proposed pathway also involves cytotoxic cellular immunity on top of the humoral response 15. Its use as an effective research tool, i.e. for the production of mono and polyclonal antibodies, was already established in 1994 and subsequent papers have successfully reported the application Despite the finding that in vivo transfection results in an appropriate immune response, suitable for mab production, the focus of the technique nevertheless has been on vaccine development. 59

60 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies Moreover, DNA immunization protocols combine injections of plasmids with proteinaceous antigens, probably because most reports have shown that the efficacy of solely injecting DNA is significantly lower 20,21. We have combined genetic and classical immunization in mice, allowing for the development of high affinity anti-adamts-13 mabs. A specific screening assay was designed, so to discriminate positive hybridoma clones from non-specific ones. Antibody specificity was further tested in several ELISA setups and Western blot, allowing for the determination of apparent affinities and epitope-type, respectively. The interference with ADAMTS-13 function was assessed, all mabs were isotyped and most of them were domain-mapped. 60

61 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies 2.3 MATERIALS AND METHODS Cloning, Expression and Characterization of recombinant ADAMTS-13 (radamts-13) Cloning of ADAMTS-13 The human ADAMTS-13 cdna sequence was cloned in the pgene/v5/his vector (Invitrogen, Carslbad, CA, USA) using restriction endonucleases EcoRI NotI (New England Biolabs, Beverly, MA, USA) on both pnut_adamts-13 and the empty target vector. Digested fragments were eluted from 1.5% multi-purpose (MP) agarose gel (Roche Diagnostics, Mannheim, Germany) using the QiaQuick gel extraction kit (Qiagen, Venlo, The Netherlands), following the instructions of the provider. Next, sticky ligation with T4 DNA ligase (Roche), according to the instructions of the manufacturer, was performed. Chemically competent OneShot TOP10 E. coli cells (Invitrogen) were transformed with the ligation mixture and cultured at 37 C on Luria Ultrapure (USB corporation, Cleveland, OH, USA) agar-filled Petri dishes, supplemented with 50 µg ml -1 Ampicillin (Roche). Outgrown colonies were tested for the presence of plasmids containing the inserted sequence using the polymerase chain reaction (PCR) with primers 6351F and 6546R [5 - GAGTTGCCTGATGGTAACCG-3 and 5 -TGGAGGTCAGCACCAACACA-3, respectively] 22 and Platinum Pfx DNA proofreading polymerase (Invitrogen) [denaturation for 15 at 94 C, annealing for 30 at 57 C and extension at 68 C for 5 minutes]. Positive colonies were grown on an orbital shaker overnight at 37 C and 250 rounds per minute (rpm) in Luria Broth Base (LB) medium, supplemented with 50 µg ml -1 Ampicillin. Plasmid DNA was prepared using the QiaPrep miniprep kit (Qiagen) following the instructions of the provider. Restriction analysis using SrfI (Stratagene, La Jolla, CA, USA) confirmed cloning success. The ADAMTS-13 cdna was cloned in the pcdna3.1 (Invitrogen) vector following the exact same protocol, this vector was used for DNA immunization. Posterior to PCR and cloning, the nucleotide sequence was determined for completeness by Genomex (Grenoble, France) Expression of radamts-13 For expression of radamts-13, the inducible GeneSwitch system (Invitrogen) was used. This system, based on the mechanism described by Wang et al 23, is leakage-free and contains a promoter under the control of transcription factors which can in turn be induced by the steroid hormone; mifepristone. Chinese hamster ovary (CHO) cells, expressing the regulatory fusion protein that controls the promoter, which is upstream of the sequence of interest, were used. These cells were transfected with the pgene_adamts- 13/V5/His vector according to the following protocol; 2 x 10 5 cells were seeded and grown overnight in a 60 mm Petri dish in F-12 Nutrient Mixture (Ham) supplemented with 10% (v/v) foetal bovine serum (FBS), 100 units ml -1 of penicillin, 100 µg ml -1 of streptomycin and 250 µg ml -1 Hygromycin B (all from Invitrogen- Gibco). The next day, the vector (10 µg) was transfected using lipofectamin TM 2000 and Opti-MEM I Reduced-Serum medium, according to the provider s instructions (Invitrogen-Gibco). Control dishes underwent the same protocol with buffer containing no vector (mock condition). Two days later, the Ham- 61

62 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies medium was supplemented with 500 µg ml -1 of Zeocin TM (Invitrogen-Gibco), to select for cells that had incorporated the vector sequence of interest. Outgrown colonies were analyzed for their potency to express radamts-13 protein in the expression medium. Hereto, the cells were grown to confluency, then induced with 10 nmol L -1 or 100 nmol L -1 mifepristone in either complete medium (see above) or CHO-S-SFM II serum free medium (Invitrogen-Gibco) and incubated for 24h, 48h or 72h at 37 C and 5% CO 2. Expression medium was aspirated on protease inhibitors (phenylmethylsulphonylfluoride at 1 mmol L -1 and leupeptin at 5 µmol L -1 ) and analyzed on 7.5% SDS polyacrylamide gel electrophoresis (PAGE) in reducing sample buffer (350 mm Tris, 40% glycerol (v/v), 8% SDS (m/v), 5% β-mercaptoethanol (v/v), ph 6.8). Next, proteins were blotted semi-wet onto nitrocellulose (Shleicher & Schuell Biosciences, Dassel, Germany). After blocking the membrane in 3% (m/v) skimmed milk (SkM) (Nestlé, Vevey, Switzerland) in phosphate buffered saline (PBS, ph 7.4), it was washed with PBS % (v/v) Tween80 and incubated with HRP labeled anti-v5 antibody (anti-v5~hrp) (Invitrogen) at 1/5,000 in PBS + 0.3% SkM for one hour on a rocker at room temperature. After thoroughly washing, the blot was developed using the ECL kit (Amersham Biosciences, Uppsala, Sweden) and photosensitive film (Kodak, Rochester, NY, USA). A pre-stained internal standard was taken as reference (precision plus all blue from Biorad, Hercules, CA, USA). Finally, cells that were found positive for recombinant expression of ADAMTS-13, were subcloned to obtain single cell colonies Purification and Concentration Determination of recombinant ADAMTS-13 Recombinant ADAMTS-13 medium was concentrated ten-fold on a QuixStand TM benchtop hollow-fiber concentrator (Amersham). This sample was then purified on a HisTrap TM FF column (Amersham) according to the instructions of the manufacturer, in the presence of 1 mg ml -1 broad spectrum protease inhibitor; Pefabloc SC (Roche). Concentrations were determined according to Zheng et al 24. In brief, protein was Western blotted and detected with anti-v5-hrp. The luminograms were scanned and concentration was determined by standardization with the identically tagged Positope TM reference protein (Invitrogen) using NIH IMAGE 1.62 freeware windows XP analog, developed by Scion Corporation 6 ( Activity Assays for ADAMTS-13 ADAMTS-13 activity was assessed in the assay according to Furlan et al 25 with the adjustments of Gerritsen et al 26. A mixture of VWF/FVIII concentrate (Red Cross, Belgium) at a VWF antigen concentration of 30 µg ml -1, 10 mmol L -1 BaCl 2, 1.0 mmol L -1 CaCl 2, 1.0 µmol L -1 ZnCl 2, 0.3% (m/v) milk proteins, 0.5 mg ml -1 Pefabloc SC, and ADAMTS-13 (concentration is depending on the experiment) is dialyzed against digestion buffer (50 mmol L -1 Tris, 1.0 mol L -1 urea, ph 8.0) at 37 C for 24h in QuixSep dialysis cassettes (Orange Scientific, Braine-l Alleud, Belgium). Next, the proteolytic degradation is quenched with 10 mmol L -1 ethylene diamine tetraacetic acid (EDTA). The samples are then ready for analysis using residual VWF multimer binding to collagen (VWF:CBA) 26 or 1.5% SDS-agarose gel electrophoresis 25. Digestion mixtures already containing EDTA, were included as negative control. 62

63 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies - When performing VWF:CBA, 10 µg ml -1 human collagen type III (Sigma, St Louis, MO) is coated to a microtiter plate in PBS and kept overnight at 4 C. After blocking for two hours with an excess volume of 3% SkM in PBS, the samples are serially diluted ½ in PBS + 0.3% SkM and incubated at 37 C. Unbound multimers were washed off and peroxidase labeled anti-vwf (Dako Denmark A/S, Glostrup, Denmark) was incubated diluted 1/3,000 in PBS + 0.3% SkM. Colorimetric development was with o-phenylenediamine dihydrochloride (OPD) (Sigma) in 50 mmol L -1 phosphate-citrate buffer supplemented with 0.1% (v/v) H 2 O 2, ph 5.0, for 15 min. Reactions were stopped in 1.0 mol L -1 sulfuric acid, and the absorbance at 490 nm was determined using an automated ELISA reader. All incubations were performed at room temperature for 1h, unless stated otherwise. In between steps, at least three washes with PBS + 0.1% (v/v) Tween20 were performed. In parallel with this assay, VWF antigen (VWF:Ag) is determined so to exclude concentration bias in the collagen binding assay. This assay is performed exactly the same as the CBA, but instead of coating collagen, an unlabeled polyclonal anti-vwf antiserum (Dako) is coated to the plate, diluted 1/1000 in PBS. As a final parameter, the VWF:CBA over VWF:Ag is used which is a corrected measure for residual multimer binding to collagen. - For SDS agarose multimer analysis, 1.5% isoelectric focusing (IEF) agarose (GE Healthcare, Waukesha, WI) is multimerized between two glass plates on the hydrophilic surface of a GelBond (Cambrex, Rockland, ME) foil. Plasma is dissolved in 4 mol L -1 urea and 5% (m/v) SDS in 10 mmol L -1 Tris and 1 mmol L -1 ethylene diaminetetraacetic acid (EDTA) ph 8.0 and incubated on 60 C for 30 minutes. Samples are then run in a multiphor II apparatus (GE Healthcare) at constant 150 V. The foil is then vigorously washed in distilled water and dried under cooled air to adhere the gel material in the GelBond polymer. The GelBond is then blocked in 6% skimmed milk in PBS for 1h at room temperature. Next, a 1/750 dilution of in-house alkaline phosphatase-labeled anti-vwf antibody (Dako Cytomation, Glostrup, Denmark) in PBS + 0.3% skimmed milk is incubated overnight at room temperature. After thorough washing bound antibodies are revealed with the Amplified Alkaline Phosphatase Immun-blot kit (Bio-Rad, Hercules, CA). For the determination of the inhibitory potency of the anti-adamts-13 mabs, the activity was also assessed in the assay according to Tsai 27. In this assay, purified VWF/FVIII concentrate is diluted in treatment buffer (50 mmol L -1 HEPES, 150 mmol L -1 NaCl, 1.23 mol L -1 GuHCl, 1 mg ml -1 bovine serum albumin, ph 7.4) and incubated at 37 C for half an hour. Next, treated VWF/FVIII is diluted 1/10 in assay buffer (50 mmol L -1 HEPES, 150 mmol L -1 NaCl, 1 µmol L -1 ZnCl 2, 5 mmol L -1 CaCl 2, 1 mg ml -1 bovine serum albumin, ph 7.4) in which radamts-13 or plasma is added to the desired active concentration and where indicated antibodies were added to a final concentration of 100 nmol L -1. This mixture is incubated at 37 C for another 30 minutes and the enzymatic reaction is stopped by adding EDTA to a final concentration of 50 mmol L -1. The sample is then subjected to 4% SDS-polyacrylamide gel electrophoresis in non-reducing conditions and western blotted onto nitrocellulose. The VWF bands are visualized using a commercial HRP labeled anti-vwf antiserum (Dako) at 1/3,000 in PBS + 0.3% SkM. Luminographic development was as mentioned in

64 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies Cloning and Expression of recombinant CUB2 Domain Cloning of recombinant CUB2 Domain The coding sequence of the uttermost C-terminal ADAMTS-13 domain, designated CUB2, was amplified by PCR, using proofreading Platinum Pfx DNA polymerase and site specific primers [CUB2Fp 5 - GCGGAATTCATGTGACATGCAGCTCTTTGG-3 and CUB2Rp 5 - ATGCTCGAGGGTTCCTTCCTTTCCCTTCC] [denaturation for 15 at 94 C, annealing for 30 at 58 C and extension at 68 C for 1 minute]. These primers also introduced 5 and 3 endonuclease sites EcoRI and XhoI, which are compatible with those in the multiple cloning site of the target vector pet-26b(+) (Novagen, EMD Biosciences, Darmstadt, Germany). This vector is designed for T7 RNA polymerase-mediated transcription and has an inducible lac-promoter, requiring β-d-isopropylthiogalactoside (IPTG) (Roche) to initiate transcription. After restriction cleavage with the suitable enzymes (New England Biolabs) and purification from 1.5% MP agarose gel, the fragment was ligated in the open vector using T4 DNA ligase, according to the instructions of the manufacturer. Chemically competent OneShot TOP10 E. coli cells were transformed with the ligation mixture and cultured at 37 C on Luria Ultrapure agar-filled Petri dishes, supplemented with 50 µg ml -1 kanamycin (Roche). Outgrown colonies were tested in PCR with primers CUB2Fp (hybridizing in the insert) and T7 terminator primer (hybridizing in the vector) and subsequent analysis on MP agarose gel. Positive colonies were inoculated in LB medium, supplemented with 50 µg ml -1 kanamycin and grown overnight at 37 C for the subsequent preparation of plasmid DNA, using the QiaPrep miniprep kit. Purified plasmid pet_cub2 was used for transformation of chemically competent OneShot BL21 Star TM (DE3) prokaryotes (Invitrogen), containing T7 polymerase. Transformants were grown and analyzed in the same way as the TOP10 cells, as mentioned above Expression of recombinant CUB2 Domain The expression of the recombinant CUB2 polypeptide (rcub2) was induced by the addition of IPTG (Roche) at the exponential growth phase of a BL21 Star TM (DE3) culture (Invitrogen). In brief, cells were grown in three expanding steps in LB medium, supplemented with 50 µg ml -1 kanamycin, until the optical density at a wavelength of 600 nm (OD 600nm ) of the culture reached between 0.5 and 1.0, as determined by spectrophotometry on an Ultrospec 1000 UV/visible Spectrophotometer (Amersham). Prior to induction, cultures were split into two fractions, one served as a control and in the other, ITPG was added to a final concentration of 1 mmol L -1 for induction of the lac-promoter. Both were continuously incubated at 37 C with shaking in baffled Erlenmeyers for 3 h. Medium, periplasm and cytoplasm were analyzed for the presence of the desired protein, in soluble or as inclusion bodies (insoluble form), using SDS PAGE with subsequent coomassie brilliant blue staining. Inclusion bodies, containing rcub2, were first washed with PBS and then denatured in 8 mol L -1 urea, dissolved in PBS. Stepwise dialysis against less denaturing PBS buffers was performed next, from 6 mol L -1 64

65 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies > 4 mol L -1 > 2 mol L -1 > 0 mol L -1 urea in PBS. Most of the recombinant protein was refolded after the last dialysis step, remaining insoluble fragments were removed by centrifugation at 5,000 g. The purity and concentration of rcub2 was assessed by SDS PAGE with coomassie brilliant blue staining as mentioned previously and spectrophotometric analysis using the calculated extinction coefficient (32290 L mol -1 cm 280 nm), respectively. Calculations of molar masses and extinction coefficients used freeware, available at Finally, large quantities of rcub2 were dialyzed against a volatile buffer (10 mmol L -1 NH 4 HCO 3, ph 7.5) and the samples were lyophilized using an FD3 HETO lyophilizator (Heto-Holten A/S, Allerǿd, Denmark) Generation and Characterization of polyclonal anti-cub2 Antiserum Generation of polyclonal anti-cub2 Antiserum Lyophilized rcub2 was reconstituted in PBS at a final concentration of 1.0 mg ml -1. Next, an emulsion of complete Freund s adjuvants (Sigma) and rcub2 of ratio 1:1 (v/v) was made by multiple passages through a 24 Gauge needle using a 1 ml syringe. A total of 0.75 mg rcub2 was administered intradermal to Wistar rabbits, in six different loci on their dorsal side. Six weeks later, booster injections of the same amount, but emulsified in incomplete Freund s adjuvants (Sigma), were performed. Another three weeks later, rabbits were bled from an exposed ear vein and serum was prepared in glass recipients at 37 C with regular stirring and subsequent overnight incubation at 4 C for clot retraction. Centrifugation at 2,500 g resulted in a clear serum fraction that was aliquoted and stored at -20 C. The immunoglobulin (Ig) fraction was purified on a protein A sepharose Fast Flow column (Amersham) according to the instructions of the manufacturer. Subsequent booster injections were analogous to the first one Characterization of polyclonal anti-cub2 Antiserum Binding to rcub2 was assessed in an enzyme-linked immunosorbent assay (ELISA). In brief, the anti-cub2 Ig fraction was coated to a 96-well microtiter plate (Greiner, Frickenhausen, Germany) at 4 µg ml -1 in PBS, overnight at 4 C (100% humidity). The plate was blocked with 3% SkM in PBS for 2h. Next, a serial ½ dilution of rcub2 in PBS (+ 0.3% SkM) was incubated, applying 2 µg ml -1 as highest concentration, followed by an incubation of biotinylated anti-cub2 Ig at 1 µg ml -1. Bound antibodies were detected using a 1/15,000 dilution of horse radish peroxidase (HRP) labeled streptavidin (Roche). Colorimetric development was with o- phenylenediamine dihydrochloride (OPD) (Sigma) in 50 mmol L -1 phosphate-citrate buffer supplemented with 0.1% (v/v) H 2 O 2, ph 5.0, for 15 min. Reactions were stopped in 1.0 mol L -1 sulfuric acid, and the absorbance at 490 nm was determined using an automated ELISA reader. All incubations were performed at room temperature for 1h, unless stated otherwise. In between steps, at least three washes with PBS + 0.1% (v/v) Tween20 were performed. Binding of the antibodies to rcub2 was also assessed by means of SDS PAGE, followed by Western blotting. In brief, rcub2 was subjected to SDS PAGE in a discontinuous gel system, employing a 4% stacking gel and 15% running gel (Biorad). Proteins were transferred onto nitrocellulose using semi-wet 65

66 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies blotting. Blots were blocked in 3% SkM in PBS for 1h. Next, the membrane was incubated with 1 µg ml -1 biotinylated anti-cub2 Ig in PBS + 0.3% SkM on a rocker at RT. After washing, the blot was incubated with a 1/15,000 dilution of HRP labeled streptavidin in PBS + 0.3% SkM for 1h at RT on a rocker. Blots were developed by ECL and photosensitive film, according to the manufacturer s instructions Anti-ADAMTS-13 screening ELISA Polyclonal anti-rcub2 purified immunoglobulins in PBS, ph 7.4, were coated to a 96-well microtiter plate overnight at 4 C. Wells were blocked for 2h with 3% SkM in PBS. Next, purified radamts-13 was added at 10 nmol L -1 for 1 h (37 C) and after washing, hybridoma media (or serum) were incubated for 1h. Secondary antibodies were HRP labeled anti-mouse-igg, Fc-specific (GAM~HRP) and an equally labeled anti-mousewhole molecule antiserum (Sigma) (1/12,000 in PBS, 0.3% SkM). Colorimetric development, washing and readout was analogous to ELISA to immobilize radamts-13 Purified mabs were coated to an ELISA plate at 4 µg ml -1 in PBS overnight at 4 C. After blocking the plate with 3% SkM PBS, radamts-13 was added at 25 nmol L -1 in PBS + 0.3% SkM and serially diluted ½ in the same buffer. Next, wells were incubated with anti-v5~hrp (1/5,000 in PBS + 0.3% SkM). Colorimetric development, washing and readout was analogous to Immunization Protocol ADAMTS-13 cdna was cloned in pcdna3.1 (Invitrogen) via EcoRI and NotI restriction sites as mentioned in and prepared to high concentrations with the QIAprep Megaprep kit (Qiagen). On day 0 of the immunization protocol, eight female Balb/c mice were injected intraperitoneally with 50 µg of pcdna3.1-adamts-13 in 50 µl of 10 mmol L -1 Tris-HCl, ph 8.5. On day 20 the mice underwent a second injection with the same batch of expression vector. Control mice were treated similarly with buffer only. Ten days after the second injection (day 30), mice were bled from the exposed tail vein and serum was screened for the presence of anti-adamts-13 antibodies. At day 40, extra plasmid injections were performed and on day 50, seven days prior to fusion, the mice were boosted intraperitoneal with 4 µg of radamts-13 in incomplete Freunds adjuvants Immunoprecipitation for Domain mapping of mabs Mutant radamts-13 serum-free medium is mixed with 1.5 µg ml -1 of mab and 3.0 µg ml -1 of goat-antimouse Fc specific antibody in a reaction volume of 100 µl. The latter is added to assure that IgG 1 are immobilized to protein A, since this protein is known to interact only weakly with that class of murine immunoglobulin. The mixture is gently rocked at 4 C for 2h. Next, 50 µl of protein A Sepharose CL4B (Amersham) in PBS is added to a final concentration of % (m/v) and again the mixture is gently rocked 66

67 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies at 4 C overnight. The next day, the beads are washed five times with chilled PBS, supplemented with 0.05 % (v/v) Tween80 using centrifugation at 500 g for 1 minute. As a final step, the buffer is aspirated completely and 30 µl of non-reducing sample buffer for SDS PAGE is used for resuspension of precipitate. Next, the sample is heated to 100 C for 5 minutes and then centrifuged again. The sample is then applied to an appropriate polyacrylamide gel (depending on the molecular weight of the investigated mutant radamts-13) using a Hamilton syringe, which prevents aspiration of turbid fragments resulting from the breakdown of Sepharose. After gel electrophoresis, the samples are western blotted and developed using anti-v5~hrp as mentioned above. To each sample and each buffer, including the washing buffer, Pefabloc SC (Roche) was added to a final concentration of 0.5 mg ml Other - Monoclonal antibodies were isotyped using the Zymed Mouse MonoAb SCREEN/ID kit from Invitrogen. - Biotinylation of antibodies was with EZ-Link Sulfo-NHS-LC-Biotin (Sulfosuccinimidyl-6-(biotinamido) hexanoate) and performed according to the instructions of manufacturer (Perbio Science AB, Stockholm, Sweden). 67

68 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies 2.4 RESULTS Recombinant ADAMTS-13 is an active VWF cleaving Protease For the expression of the enzyme, an inducible expression system was used (GeneSwitch, Invitrogen) because initial attempts in a regular system, both stable and transient, failed to yield recombinant protein. Since practically no reports regarding this issue were published at that time, we hypothesized that continuous expression of radamts-13 in heterologous cells is toxic, maybe because of its reported intracellular activity 28. Though both systems (regular and inducible) were not compared back-to-back, the regulatory method seemed successful, as recombinant enzyme was detected in the expression medium and not in mock transfected cells (Figure 12 left). Recombinant ADAMTS-13 migrates as a ~190 kda band when disulphide bridges are reduced, in agreement with previous reports 8. Optimal expression yield was established using 100 nmol L -1 mifepristone TM (steroid inductor) and a three-day incubation, as was assessed in Western blot using anti-v5~hrp as a detecting antibody (not shown). Figure 12: radamts-13 is expressed in CHO cells. Media of transfected (Med) and mock transfected (MOCK) cells were aspirated and analyzed by reducing SDS PAGE Western blot (left panel). Proteins were detected by means of anti-v5~hrp. The relative molecular weight is depicted on the left in kda, as determined by an internal pre-stained marker. After concentration and purification, purity was assessed on SDS PAGE with Coomassie blue staining (middle and right). The upper two bands represent ADAMTS-13 (see addendum). In the early stage, serum was added to the media (+), in a later stage serum-free media were used (-). After concentrating the medium ~ten fold, the recombinant protein was purified using Ni 2+ -chelating chromatography exploiting the C-terminal His-tag. This procedure resulted in a semi-pure protein mixture with major contaminants (Figure 12 middle). At first it was thought that the lowest of the two highest band was also derived from the serum component, but later blotting analysis showed that this band is another ADAMTS-13 variant form (see addendum). The use of serum free medium resulted in the loss of major contaminating bands between 120 kda and 130 kda (Figure 12 right). The remaining contaminating bands between 50 kda and 75 kda did not disappear, indicating they might be derived from the cellular expression system itself. They may have been less dominant when serum was omitted, but staining intensities should 68

69 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies not be compared on the presented figure. No evidence was obtained from further Western blotting experiments that these bands would be derived from ADAMTS-13. Next, activity towards a purified VWF/FVIII concentrate (purified VWF) was assessed according to the method of Furlan et al 25. Recombinant ADAMTS-13 containing medium could indeed completely cleave VWF as opposed to medium of mock transfected cells or when quenched with EDTA (Figure 13). The ability to block the reaction with EDTA implies metal ion dependency, which proves specificity of the recombinantly expressed enzyme. The fully cleaved VWF fragment is too small for resolution on SDS agarose, therefore no band can be observed in the positive lane. Figure 13: radamts-13 is active towards a purified VWF/FVIII concentrate. Expression medium (+) was used as a source of cleaving protease in the activity assay according to Furlan et al 25, requiring semidenaturing conditions and addition of Ba 2+ ions. The reaction could be inhibited by addition of 10 mmol L -1 EDTA, indicating a metalloprotease dependent process (EDTA). Supernatant medium of mock transfected cells didn t contain VWF cleaving activity (mock), indicating specificity of the recombinantly expressed protein Development of an ADAMTS-13 specific screening Assay One of the bottlenecks encountered when producing mabs against a new protein is the lack of an efficient screening assay; an assay that discriminates positive hybridomas, hence producing anti-adamts-13 antibodies, from negative ones, which result from a fusion of non-specific B-cells with the myelomas. Especially in the initial phase, right after the discovery of a new protein, no tools to efficiently purify or produce the antigen are available, hampering the straightforward development of a screening assay. Moreover, the original radamts-13 crude extract, which was used for the booster injections, could not be deployed as immobilized antigen in a direct ELISA because the contaminating (bovine serum derived) proteins could have induced minor immunologic reactions in the recipient mice, hence potentially accounting for a false positive signal. Therefore a specific anti-adamts-13 serum was needed to capture radamts-13 from the crude extract, hence indirectly immobilizing the antigen and allowing to wash away contaminants. Hereto, a part of ADAMTS-13 was recombinantly expressed and used as an immunogen for the generation of a polyclonal antiserum in rabbits. 69

70 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies Expression of recombinant CUB2 Domain The coding sequence for the uttermost C-terminal domain of ADAMTS-13, i.c. CUB2, was cloned and expressed in E. coli. The protein was insoluble and located in inclusion bodies. After washing these with PBS and stepwise renaturation containing each time less denaturant, rcub2 was found pure in the supernatant of the sample. The calculated mass of rcub2 is 14.1 kda and could be detected as a single band of around ~16kDa on 15% SDS PAGE with subsequent coomassie brilliant blue staining (Figure 14). N-terminal amino acid sequence determination (Toplab, Giessen, Germany) confirmed that the expressed band was the CUB2 domain, revealing the following sequence MDIGINSDPNS(C)DMQLFG with the highlighted (bold) segment corresponding to the CUB2 sequence (GenBank accession no. AC002325) 29. The sequence upstream represents the signal sequence (encoded by the vector) that should have directed the protein to the periplasm. Despite its presence, no protein was detected in that compartment (not shown). Figure 14: rcub2 is found pure and soluble after renaturation of the washed insoluble fraction. Medium of cultured E. coli contained no rcub2 (lane 1). After stepwise renaturation of the washed insoluble inclusion body fraction, rcub2 could be detected as a pure ~16 kda band (lane 2). The total cell protein fraction (lane 3) shows a high abundance of the protein of interest. (M) is the marker with molecular weights from top to bottom in kda being Generation of a polyclonal anti-cub2 Antiserum Recombinant CUB2 domain was used to evoke an immune response in rabbits, in order to generate a polyclonal antiserum that could eventually be used in an ADAMTS-13 specific screening assay. After a first booster injection, the serum contained anti-cub2 antibodies as was detected in Western blot, using the rcub2 as antigen. After purification of the Ig fraction, the antibodies could also specifically detect full length ADAMTS-13 in reduced SDS PAGE followed by Western blotting.(figure 15 right panel). Both the serum and the purified Ig fraction could readily detect the immobilized antigen in ELISA (Figure 15 left panel). The purification resulted in a four-fold loss of apparent affinity, but less background binding was noted. Subsequent boosts raised the concentration of specific antibodies and eventually, the rabbit was sacrificed and bled. 70

71 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies Figure 15: Polyclonal antiserum detects both rcub2 and radamts-13. (left) Both antiserum ( ) and purified Ig fraction ( ) bound to immobilized rcub2 in a dose-dependent way, as opposed to a pre-immune rabbit serum ( ). The optical density at wavelength 490 nm (OD 490 nm) as a function of the dilution series of the antiserum is depicted. (right) The purified anti-cub2 Ig fraction could detect both rcub2 (right lane) and the full length radamts-13 (middle lane) in reducing Western blot. Detection with anti-v5~hrp (left lane) is depicted as a positive control for the detection of radamts Setting up a specific anti-adamts-13 screening Assay Our newly developed polyclonal Ig fraction could capture radamts-13 from the partially purified sample in a dose-dependent manner and provided hence the basis for a specific screening assay (Figure 16). In the assay, hybridoma culture medium can be added to the secondarily immobilized antigen, allowing in vitro produced immunoglobulins to interact with it. A murine specific secondary labeled antiserum is then used for the detection of bound antibody. Figure 16: Screening assay for anti-adamts-13 producing hybridomas. Recombinant ADAMTS-13 can be captured from solution by the immobilized anti-cub2 Ig fraction in a dose-dependent manner. In this case, detection was with anti-v5~hrp. The optical density at wavelength 490 nm (OD 490 nm) as a function of the radamts-13 concentration is depicted. The depicted figure is the result of three independent experiments and the error bars represent the standard deviation. 71

72 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies Development of mabs, combining genetic and classical Immunization Methods Most reports on genetic immunization deal with intramuscular or intradermal injections, the latter employing a gene gun; a device to introduce DNA-labeled gold particles in the epidermis 30,31. Directly targeting the spleen has been shown to be an effective method to generate a response after a single injection 20. Our initial attempts were based on this report and involved the injection of 50 µg of plasmid DNA in the spleen, with no surgical intervention, whatsoever. Most of these attempts were (most probably) unsuccessful in terms of intrasplenic delivery, because the samples appeared to be injected intraperitoneally as could be visualized by rapid fading of the bromophenol blue indicator added to mock samples. Nonetheless, it was decided to carry on with this approach since plasmid delivery in the vicinity of the spleen or partially in the spleen might exert an analogous effect as reported. Eventually two out of eight mice responded positively to this procedure, as anti-adamts-13 antibodies were detected in plasma 10 days after a second injection with plasmid DNA (Figure 17, black bars). Control mice were injected with the same buffer and their plasma did not react with immobilized radamts-13. Seven days prior to fusion, 4 µg of semi-purified radamts-13, emulsified in incomplete Freund s adjuvant, was administered in the peritoneal cavity. This resulted in an outspoken immune response in all treated mice (Figure 17, grey bars). The low amount of proteinaceous antigen caused a significant response, indicating the value of pre-immunizing the recipient mice with plasmid DNA 7. The mice that reacted positive, both prior and posterior to the protein booster, were sacrificed and their spleen was used for cellular fusion according to the method of Köhler and Millstein 2. Figure 17 : DNA immunization results in a positive response in two out of eight injected mice. The presence of anti-adamts-13 antibodies was evaluated in the radamts-13 screening ELISA in which sera were added to immobilized radamts-13. After two plasmid DNA injections (black bars), two out of eight sera ( ) reacted positively. After four plasmid injections and one booster injection with purified radamts-13, all mice responded positively (grey bars). Control mice (C1 and C2) were injected with buffer, containing neither DNA nor protein. Anti-V5 (a-v5) was used as a control for the validation of the screening assay. These data are representative for three independent analogous experiments. 72

73 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies Initial Characterization of mabs Hybridoma media were further screened in the above mentioned assay for the presence of anti-adamts-13 antibodies. Positive colonies were split and grown in culture flasks, till confluency was reached. For each clone, one mouse could be injected to produce ascites fluid (exemption of prohibition by the FOD Volksgezondheid, Veiligheid van de Voedselketen & Leefmilieu no. ASC 04/2005). Ascites were affinity purified and the mabs were again assessed in the radamts-13 screening ELISA (when antigen is immobilized on anti-rcub2). The next passage was used for subcloning or cell stock preparation, depending on the nature of the clone. Table 3: Basic characteristics of the anti-adamts-13 mabs. Three fusions were successful, resulting in a total of 25 mabs. Antibodies exerting a very weak affinity in immobilizing the antigen showed no maximum and the EC 50 could therefore not be determined (no max). Some mabs reacted weakly with the antigen (weak) in WB and some were not yet analyzed in the respective setup (empty cells). The isotype was determined using a commercial kit. mab 3H9 (*) is the only mab that inhibits ADAMTS-13 function, in vitro. recombinant ADAMTS-13 normal plasma Fusion no. mab EC 50 WB (nonreducing) (reducing) reducing) WB WB (non- (nmol L -1 ) isotype I 13F yes weak IgG 2a, κ 8C yes weak IgG 2a, κ II 2G yes no IgG 1, κ 7F no no IgG 2a, κ 10D no IgG 1, κ 15A4 no max no IgG 1, κ 15B11 no max IgG 2a, κ 18E10 no max yes IgG 1, κ 20D no IgG 1, κ 20H IgG 1, κ III 1H no no IgG 2a, κ 3H9* 2.60 yes no IgG 1, κ 5C yes no no IgG 2a, κ 7C yes weak yes IgG 1, κ 11D weak no yes IgG 1, κ 11E yes no yes IgG 1, κ 12D yes no IgG 1, κ 12H yes no IgG 1, κ 14D yes yes IgG 1, κ 17B yes no yes IgG 1, κ 18G yes no IgG 1, κ 19H yes no no IgG 1, κ 20A yes no yes IgG 1, κ 20B no no IgG 2a, κ 20G yes no IgG 1, κ 73

74 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies In another ELISA setup, the purified mabs were coated and radamts-13 was incubated to analyze their potential of capturing the antigen from solution. Moreover, this assay was used for EC 50 determination, which is an indicative measure for the apparent affinity of mabs (Table 3) Intact Disulphide Bridges are important for Recognition of most Epitopes All mabs were assessed for their ability to recognize denatured epitopes in Western blot on reduced and non-reduced radamts-13 (Table 3). In general, the intrinsic quality to detect blotted antigen varies strongly among different mabs and mainly depends on the linearity of the recognized sequence. Rather unexpected, almost no mabs were able to recognize reduced radamts-13, indicating the importance of disulphide bridges in maintaining the epitopes of these mabs, even after denaturation with SDS. For this analysis, we focused on the mabs that resulted from the third fusion, since these had the highest apparent affinities. Nonetheless, many mabs could be used for western blot detection, recognizing denatured radamts-13 in the absence of reducing agents. Longer incubation of the luminescing blots and the photographic film also resulted in clear western blots of plasma ADAMTS-13 for certain mabs Domain mapping of mabs using Immunoprecipitation Domain mapping to truncated radamts-13 mutants is not so straightforward, as blotted recombinant mutants apparently no longer reacted with mabs previously recognizing full length radamts-13 in Western blot. Immunosorbent assays neither resulted in significant binding, again despite their ability to bind full length radamts-13 from solution. The conformation of the epitopes in the truncated mutants may have been challenged due to the lack of potentially stabilizing C-terminal domains. Our observation that in many cases the disulphide bridges are necessary for maintaining the antibody epitope add to this. In the literature, this problem was also recognized and immunoprecipitation was shown as the only feasible (i.c. most sensitive) solution to investigate binding to truncated mutants 32,33. Using this technique, many of the mabs could be mapped to a certain region (i.e. domain mapping) within the ADAMTS-13 molecule. A typical example of an immunoprecipitation result is shown (Figure 18 bottom left) next to all the mutants used for this study (Figure 18 bottom right) and a schematic overview of the mapped mabs (Figure 18 top). 74

75 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies Figure 18 : Domain mapping of anti-adamts-13 mabs. (top) A schematic overview of the mabs that could be mapped to their respective domains. (bottom left) Mapping of mabs 1H12, 7C4 and 20B6 to mutant (TS 2-5) spanning from 75A to 894H. Unlabeled anti-v5 antibody was used as a positive control, isotype IgG 1 was used a negative control. Blotted mutant was detected using anti-v5~hrp. (bottom right) Mutants that were used to map the mabs, the apparent molecular weight is indicated on the right and the spanned region is indicated in the middle. All mutants contained a C-terminal V5 tag for western blot detection mab 3H9 inhibits ADAMTS-13 Function The domain mapping revealed one mab (3H9) directed to the metalloprotease domain, 3H9 could furthermore block ADAMTS-13 function in both the assay according to Gerritsen et al 26 and the assay developed by Tsai 27, using either recombinant or plasma-derived enzyme. In the Gerritsen assay, the ratio of VWF:CBA and VWF:Ag is depicted in function of the inhibitor titer (Figure 19 left panel). The VWF:Ag is measured in parallel to correct for concentration effects in the collagen binding test. This type of ADAMTS-13 activity analysis allows determination of an IC 50, which for 3H9 was calculated to be 42.8 ± 0.9 nm using statistical software (Origin, OriginLab, Northampton, MA). The Tsai assay is believed to be more physiologic in that it reduces the amount of denaturant to negligible levels and no non-physiologic salt (BaCl 2 ) is needed, adding to the relevance of the result. In accordance with Anderson et al 34, we focused on the appearance of the (176 kda) 2 band, which is a dimer of two digested VWF monomers, still linked at their C-terminus (Figure 19 right panel). Monoclonal anti-gpibα antibody 6B4 was included as a nonsense antibody. Buffer was used as a negative control. No cleaved VWF dimer appeared in the condition where 3H9 was added, indicating its inhibitory potential. The other mabs, all reacting with other domains, could not inhibit VWF from being cleaved by plasma ADAMTS-13, at least in the setting that requires denaturants (not shown). More thorough analysis in physiologic assays must be performed in the future, so to exclude the possibility of interference of the denaturant with the potential inhibition reaction. 75

76 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies Figure 19: 3H9 is a functionally inhibiting antibody. (Left panel) Following cleavage according to a Furlan, residual collagen binding activity (VWF:CBA) was assessed in parallel with VWF:Ag determination. The ratio CBA:Ag in function of the 3H9 concentration is depicted. Χ2 and x0 parameters are depicted as inset and were determined using statistical software. (Right panel) The assay according to Tsai is qualitative and evaluates the appearance of a 176 kda-dimer band (176 kda)2 when GuHCl-digested VWF is western blotted. 6B4 is used as nonsense mab (anti-gpibα) and buffer was used as control ( ). All depicted data are the result of activity tests with radamts-13, the same result is obtained when plasma is used as a source of enzyme. 76

77 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies 2.5 DISCUSSION Building a strategy for the production of mabs depends much on the availability of two main tools, indispensable to perform this kind of experiment; (i) pure antigen and (ii) a trustable screening assay or the means to build one. Both were not readily available soon, after the discovery of the VWF cleaving protease as the thirteenth member of the ADAMTS-family. Therefore, a number of preparations needed to be done in order to efficiently induce a humoral immune response and to successfully select positive hybridomas. Since no accessible source of ADAMTS-13 antigen, nor antibodies were available, we produced both and set up a successful series of experiments. To obtain ADAMTS-13 antigen, either purification from plasma or in vitro expression needed to be performed. The latter was preferred because of the laborious procedure and the low yields of purification from plasma or VWF/FVIII concentrate 8,10. Stable expression of radamts-13, employing widely used and well-characterized systems, seemed not straightforward. Efficient transient expression had been reported in mammalian cell lines: HEK293, CHO, HeLa, COS and BHK cells, with no obvious differences in expression between these distinct cell types. Notwithstanding that, stable expression in e.g. COS-7, CHO and BHK significantly reduced the overall yield, indicating potential disadvantageous effects of continuous radamts- 13 expression 24,35. We also observed this phenomenon (in BHK cells, not presented) and decided to clone the cdna into an inducible vector, suitable for expression in the patented CHO-GeneSwitch system from Invitrogen. This system is leakage-free, assuring no expression of the potentially toxic enzyme, when a suitable agonist is absent. Indeed, inducible expression was successful and comparable to what has been reported later by Anderson et al. 34. The expression medium contained radamts-13, as the C-terminal V5-tag could be detected in Western blot. The protein could be easily purified over a Ni 2+ -chelating column after concentrating the medium using ultrafiltration. In the initial phase, the CHO cells were not adapted to produce the antigen in serum-free medium, therefore no near-pure radamts-13 was available, although samples were pure enough to perform ELISAs, Western blots and immunizations. In a later stage of the project, radamts-13 could be produced in specialized media containing no serum and subsequent concentration and purification resulted in purer radamts-13 preparations. Expression medium (and purified radamts-13 preparations) also contained VWF cleaving activity in contrast to medium of mock transfected cells, as was assessed in a urea-based activity assay with subsequent analysis using SDS agarose gel electrophoresis with immunologic in-gel staining of VWF. To set up a reliable and specific screening assay, (r)adamts-13 needed to be immobilized to a microtiter plate as a matrix for potential immunoglobulin interactors from media, sera or ascites fluid. However, the semi-purified radamts-13 preparation could not be directly coated because of impending interference of the contaminating proteins with the analysis. Therefore, an initial anti-adamts-13 specific antiserum was vital, to allow to wash away non-specific proteins. To achieve this goal, the C-terminal CUB2 fragment of ADAMTS-13 was expressed in a prokaryotic expression system. Recombinant CUB2 was found in high levels, but as insoluble fraction in inclusion 77

78 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies bodies. Washing, stepwise renaturation and lyophilization resulted in a pure prep of high concentration, that was emulsified next with complete Freund s adjuvants and injected in rabbits. Three weeks after a booster injection with incomplete Freund s adjuvants, serum was prepared and analyzed for its reactivity towards the antigen. The antiserum and the purified immunoglobulin fraction reacted with both full length radamts-13 and with the original rcub2 in Western blot. Next, the Ig fraction was shown to immobilize radamts-13, either from concentrated/purified medium, or directly from regular, non-manipulated expression medium. This could be assessed using the anti-v5 antibody, which furthermore is a murine IgG 1 and is therefore a good indicator for the following experiments using hybridoma medium instead. Hence, we succeeded in setting up a screening tool that could specifically select radamts-13 binding antibodies. To bypass the need for substantial amounts of pure antigen, gene-based immunization (so-called DNA immunization), was performed. Intrasplenic injection has been shown to be effective after one single injection and therefore this technique was applied. Without surgical intervention, plasmid DNA, encoding ADAMTS-13 under the control of a strong viral promoter, was injected in/near the spleen. Bromophenol blue indicator, added to mock samples, each time showed fast delocalization of the injected sample, probably indicative for intraperitoneal delivery using this technique. Nevertheless, this procedure resulted in a successful humoral immune response in two out of eight mice, on average (three independent experiments). Seven days prior to fusion, an intraperitoneal booster injection, containing a mere 4 µg of radamts-13, resulted in an ample increase of the immune response in all treated mice compared to control. This was assessed the day before cell fusion in the above mentioned screening ELISA. The outgrowth of hybridoma cells increased by each performed fusion (a total of seven, of which three successful), most likely because the technique was mastered better. The average yield of anti-adamts-13 positives after a first screening procedure increased concordantly, but stayed quite low as compared to the result of regular immunization procedures (own experience) 36. This might be due to the low amount of booster antigen that was injected, for that may have not allowed for thorough maturation of the selected B- cell population of the immune system. Moreover, the overall challenge, using DNA immunization combined with the minor booster, is not as stringent as when antigen is continuously administered. On the other hand, if this procedure indeed caused too little B-cell maturation, more IgM than IgG should be produced, since IgM are typical for immature B-cells, coming from a primary response. Antibody characterization revealed complete absence of the IgM isotype, indicating sufficient maturation of the B-cells and validation of the technique. The low yield of positive hybridomas may be due to poor immunogenicity of the ADAMTS-13 protein, although one would expect immune reaction to at least some specific antigenic sites, since acquired TTP patients suffer from auto-antibodies against well-defined regions in the protein sequence 32,33. Whether in this case the human body is disoriented and hence selects antibodies against autologous antigens or if these auto-antibodies are just cross-reacting molecules, originally targeted to foreign molecules is still debated 37. The observed low yields may also be depending on the screening assay, which, despite its reliability, sometimes presented with a significant background level that may have covered up low responders. 78

79 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies A total of 24 mice were immunized in three independent but analogous immunization experiments. Seven fusion experiments were performed with only three successful ones and an overall yield of 25 anti-adamts- 13 mabs, all listed in Table 3. Isotyping experiments revealed that all antibodies were of the IgG isotype with seven of subclass IgG 2a (28%) and the rest of IgG 1, each bearing the κ light chain as was to be expected (95% of murine Ig have κ light chains 1 ). The fact that no IgM isotypes were found, indicates that a secondary response must have allowed for maturation of selected B-cells. This shows that three DNA immunizations, followed by a low-amount antigen administration indeed suffices for an outspoken humoral response. On top of the selection in the original screening assay, all mabs were tested for their ability to catch radamts-13 from solution. This assay was taken as secondary criterion for ADAMTS-13 specificity, on top of the initial screening assay. The capture assay was also used to determine the apparent affinities (characterized by the EC 50, expressed in nmol L -1 ), that was interpolated from the hyperbolic binding curve. Three mabs exhibited extremely low binding affinities (i.e. catching abilities) and couldn t reach a maximum, even with the highest possible concentration of radamts-13 (~40 µg ml -1 ) at that time. Hence, these mabs can only be used for detecting the antigen and are not suited to catch it. The lowest EC 50 s (highest apparent affinities) were noted for mabs 2G3 and 20A5, indeed capable of catching ADAMTS-13 from both expression medium and from plasma (see chapter 3). Most mabs from fusion II and all mabs from fusion I & III were analyzed for their ability to detect denatured antigen in SDS PAGE Western blot. Surprisingly, practically all of them were able to do so, providing that disulphide bridges were left intact. This indicated the relative importance of this structural feature for maintaining the epitope of these newly developed mabs. Most probably, disulphide bridges will also be indispensable in vivo, since many conserved cysteines are present in the enzyme, alluding to a complex secondary structural make-up 29. Detection of plasma ADAMTS-13 in Western blot is not straightforward, almost certainly because of the intrinsic difficulty to subject plasma to efficient electrophoresis, above all when samples may not be reduced. Moreover, the absolute titer of ADAMTS-13 in plasma has been estimated to be quite low 38, adding to the above mentioned practical intricacy. Nevertheless, the batch of mabs allows for a wide application for detection and catching the antigen, either from expression media or from plasma. Using immunoprecipitation and a series of C-terminal truncated mutants, we could map most of the presented mabs to their respective domains. Regular western blotting or ELISA experiments with the truncated antigens failed, despite the ease at which they could be used to detect the wild-type molecule. This could imply that the C-terminus of ADAMTS-13 holds together the overall conformation of the molecule. On the other hand, ELISA (to some extent) and western blotting (in particular) are experimental setups that challenge conformations of proteins and therefore could influence the structure of the epitopes in the truncated mutant, especially since the mabs do recognize the epitope in solution, allowing for immunoprecipitation. Apparently many mabs bind to the 686 W- 894 H region (TSP 2 to TSP 4), which hence could provide evidence for a strong immunogenic region, at least in mice, since auto-antibodies of TTP patients have predominantly been mapped to the disintegrin/spacer area 33,39. Klaus et al showed that in only 28% of investigated acquired TTP plasmas, immunoglobulins against the above mentioned region were present. Hence, immunoreactivity 79

80 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies in this autoimmune disease cannot directly be extrapolated to immunoreactivity in recipient mice. On the other hand, presentation of the antigen using the anti-rcub2 antiserum in the screening ELISA may have favored a certain region, selection of a specific group of mabs, explaining the observed skew in epitope distribution. No other screening assay was available, so it is unclear whether indeed the screening assay or the immunogenicity is responsible for the observed data. The domain mapping revealed one mab (3H9) binding to the metalloprotease domain. This domain contains both the stabilizing Ca 2+ binding site and the catalytic Zn 2+ chelating pocket (see Chapter 1). Using the ureabased assay 25, we found that 3H9 could dose-dependently inhibit both radamts-13 and plasma ADAMTS- 13 activity towards a purified VWF/FVIII concentrate. Also, the assay originally developed by Tsai 27, which represents a more physiologic approach, revealed the same inhibitory activity. This mab can be useful for the development of an animal model of acquired TTP 40 and it may also be used to gain insight in the basic mechanism by which ADAMTS-13 cleaves its substrate. In conclusion, we have designed a successful strategy for the development of mabs to an antigen that was not readily available at the time, bypassing the need for substantial amounts of pure antigen by means of DNA immunization. The generation of a polyclonal antiserum and the subsequent development of a screening ELISA, allowed for the selection of immune-reactive mice and in a later stage, positive hybridomas. Twenty-five mabs were generated, presenting distinct features that will be of general use in diverse biochemical experimental setups and of specific use in elucidating ADAMTS-13 structure-function relationship and its role in disease (TTP and potentially others). 80

81 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies 2.6 ADDENDUM In the early stage of the project, radamts-13 was expressed using medium that was supplemented with 10% fetal bovine serum. After concentrating and purifying the sample, several bands appeared on coomassie stained SDS polyacrylamide gel (Figure 12). But even when the cells were adapted to serum free medium, the two top bands persisted after purification and concentration, suggesting it was derived from the expression of the cells itself (Figure 12). This statement was strengthened by the fact that only the uppermost reacted with C-terminal anti-v5~hrp in western blotting experiments (Figure 20). In a later stage, once our anti-adamts-13 mabs were developed, the same sample was analyzed again in western blot. This time, a biotinylated mab (14D2) that binds to the center of the molecule was used, with HRP labeled streptavidin as secondary reagent. Strikingly, both top bands reacted, providing evidence for the lower band also being radamst-13 (Figure 20). Of note, control blots using only streptavidin gave no signal whatsoever. Figure 20: Recombinant wild-type ADAMTS-13 has two forms. Coomassie staining of purified and concentrated radamts-13 reveals several bands between 50 kda and 75 kda and two upper bands of 170 kda and 200 kda (left). When detecting the same sample with anti-v5~hrp, directed against a C-terminal fusion tag, the uppermost band is detected (middle). When a pool of biotinylated mabs (14D2, 20A5 and 5C11), directed to the center of ADAMTS-13 is used, both top bands react (left). The molecular difference between the two forms is unknown, but the fact that the lower one is not detected using anti-v5~hrp suggests it is a C-terminally truncated variant. This study was performed in reducing conditions; hence disulphide bridges keeping the C-terminus linked to the upstream part of the molecule shall be reduced, disconnecting any such existing bond. An intriguing detail is that the intensity of the lowest band increased with time as the protein was stored at 4 C, even in the presence of broad spectrum protease inhibitors (Pefabloc SC without EDTA) (not shown). Still, the lowest band was never absent, even in freshly prepared samples. These observations could imply that traces of metalloproteases from the medium or the expressing cells cleave the recombinant protein or that auto-proteolysis is also a trait of this ADAMTS member, as has been reported for ADAMTS More 81

82 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies detailed study is necessary to evaluate the exact cause and the molecular background of this migration pattern, but it is clear that ADAMTS-13 can exist in several forms, whether it be in plasma or as recombinant molecule

83 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies 2.7 ACKNOWLEDGEMENTS We thank Wim Noppe for purification of recombinant ADAMTS-13 and for his scientific support on this matter. 2.8 CONTRIBUTIONS HBF performed most of the experimental work, wrote the paper and designed the study. KDB performed experimental work with the CUB2 domains in the scope of a thesis for the degree of Master of Science. NV, SV and IP are members of the technical staff and have mainly performed experimental work. EJS provided the cdna of ADAMTS-13. HD and KV supervised and designed the study, they also carefully read and adjusted the manuscript. KV also performed experimental work. 83

84 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies 2.9 REFERENCES 1 Goldsby R, Kindt TJ, Osborne BA. "Kuby, Immunology." 4 ed. New York: WH Freeman and Company; ISBN: Kohler G, Milstein C. "Continuous cultures of fused cells secreting antibody of predefined specificity." Nature. 1975;256: Cauwenberghs N, Vanhoorelbeke K, Vauterin S et al. "Epitope mapping of inhibitory antibodies against platelet glycoprotein Ibalpha reveals interaction between the leucine-rich repeat N-terminal and C-terminal flanking domains of glycoprotein Ibalpha." Blood. 2001;98: Vanhoorelbeke K, Cauwenberghs N, Vandecasteele G, Vauterin S, Deckmyn H. "A Reliable von Willebrand factor: ristocetin cofactor enzyme-linked immunosorbent assay to differentiate between type 1 and type 2 von Willebrand disease." Semin Thromb Hemost. 2002;28: Cauwenberghs N, Meiring M, Vauterin S et al. "Antithrombotic effect of platelet glycoprotein Ib-blocking monoclonal antibody Fab fragments in nonhuman primates." Arterioscler Thromb Vasc Biol. 2000;20: Staelens S, Desmet J, Ngo TH et al. "Humanization by variable domain resurfacing and grafting on a human IgG(4), using a new approach for determination of non-human like surface accessible framework residues based on homology modelling of variable domains." Mol Immunol Harlow E, Lane D. "Antibodies, A Laboratory Manual." 3 ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratories; ISBN: Fujikawa K, Suzuki H, McMullen B, Chung D. "Purification of human von Willebrand factor-cleaving protease and its identification as a new member of the metalloproteinase family." Blood. 2001;98: Levy GG, Nichols WC, Lian EC et al. "Mutations in a member of the ADAMTS gene family cause thrombotic thrombocytopenic purpura." Nature. 2001;413: Gerritsen HE, Robles R, Lammle B, Furlan M. "Partial amino acid sequence of purified von Willebrand factor-cleaving protease." Blood. 2001;98: Kuno K, Kanada N, Nakashima E et al. "Molecular cloning of a gene encoding a new type of metalloproteinase- disintegrin family protein with thrombospondin motifs as an inflammation associated gene." J Biol Chem. 1997;272: Tang DC, Devit M, Johnston SA. "Genetic Immunization Is A Simple Method for Eliciting An Immune- Response." Nature. 1992;356: Davis HL. "Plasmid DNA expression systems for the purpose of immunization." Current Opinion in Biotechnology. 1997;8: Davis HL, Michel ML, Whalen RG. "Dna-Based Immunization Induces Continuous Secretion of Hepatitis- B Surface-Antigen and High-Levels of Circulating Antibody." Human Molecular Genetics. 1993;2: Srivastava IK, Liu MA. "Gene vaccines." Annals of Internal Medicine. 2003;138: Barry MA, Barry ME, Johnston SA. "Production of monoclonal antibodies by genetic immunization." Biotechniques. 1994;16:616-8, Costagliola S, Rodien P, Many MC, Ludgate M, Vassart G. "Genetic immunization against the human thyrotropin receptor causes thyroiditis and allows production of monoclonal antibodies recognizing the native receptor." Journal of Immunology. 1998;160: Krasemann S, Jurgens T, Bodemer W. "Generation of monoclonal antibodies against prion proteins with an unconventional nucleic acid-based immunization strategy." Journal of Biotechnology. 1999;73: Ni Y, Ma K, Ni J et al. "A rapid and simple approach to preparation of monoclonal antibody based on DNA immunization." Cell Mol Immunol. 2004;1: Kasinrerk W, Moonsom S, Chawansuntati K. "Production of antibodies by single DNA immunization: Comparison of various immunization routes." Hybridoma and Hybridomics. 2002;21: Leinonen J, Niemela P, Lovgren J et al. "Characterization of monoclonal antibodies against prostate specific antigen produced by genetic immunization." Journal of Immunological Methods. 2004;289: Plaimauer B, Zimmermann K, Volkel D et al. "Cloning, expression, and functional characterization of the von Willebrand factor-cleaving protease (ADAMTS13)." Blood. 2002;100: Wang YL, Omalley BW, Tsai SY, Omalley BW. "A Regulatory System for Use in Gene-Transfer." Proceedings of the National Academy of Sciences of the United States of America. 1994;91: Zheng XL, Nishio K, Majerus EM, Sadler JE. "Cleavage of von Willebrand factor requires the spacer domain of the metalloprotease ADAMTS13." Journal of Biological Chemistry. 2003;278: Furlan M, Robles R, Lamie B. "Partial purification and characterization of a protease from human plasma cleaving von Willebrand factor to fragments produced by in vivo proteolysis." Blood. 1996;87:

85 CHAPTER 2: Development of Anti-Human ADAMTS-13 Antibodies 26 Gerritsen HE, Turecek PL, Schwarz HP, Lammle B, Furlan M. "Assay of von Willebrand factor (vwf)- cleaving protease based on decreased collagen binding affinity of degraded vwf - A tool for the diagnosis of thrombotic thrombocytopenic purpura (TTP)." Thrombosis and Haemostasis. 1999;82: Tsai HM. "Physiologic cleavage of von Willebrand factor by a plasma protease is dependent on its conformation and requires calcium ion." Blood. 1996;87: Majerus EM, Zheng XL, Tuley EA, Sadler JE. "Cleavage of the ADAMTS13 propeptide is not required for protease activity." Journal of Biological Chemistry. 2003;278: Zheng X, Chung D, Takayama TK et al. "Structure of von Willebrand factor-cleaving protease (ADAMTS13), a metalloprotease involved in thrombotic thrombocytopenic purpura." J Biol Chem. 2001;276: Koch-Nolte F, Glowacki G, Bannas P et al. "Use of genetic immunization to raise antibodies recognizing toxin-related cell surface ADP-ribosyltransferases in native conformation." Cell Immunol. 2005;236: Schunk MK, Macallum GE. "Applications and optimization of immunization procedures." ILAR J. 2005;46: Zhou WH, Dong LL, Ginsburg D, Bouhassira EE, Tsai HM. "Enzymatically active ADAMTS13 variants are not inhibited by anti-adamts13 autoantibodies - A novel therapeutic strategy?" Journal of Biological Chemistry. 2005;280: Luken BM, Turenhout EA, Hulstein JJ et al. "The spacer domain of ADAMTS13 contains a major binding site for antibodies in patients with thrombotic thrombocytopenic purpura." Thromb Haemost. 2005;93: Anderson PJ, Kokame K, Sadler JE. "Zinc and calcium ions cooperatively modulate ADAMTS13 activity." Journal of Biological Chemistry. 2006;281: Plaimauer B, Scheiflinger F. "Expression and characterization of recombinant human ADAMTS-13." Seminars in Hematology. 2004;41: Cauwenberghs N. Study of the interaction of blood platelet receptor glycoprotein Ib with von Willebrand fcator. Laboratory for Thrombosis Research, KULeuven Campus Kortrijk, IRC, 2000.PhD Thesis 37 Tsai HM. "Current concepts in thrombotic thrombocytopenic purpura." Annual Review of Medicine. 2006;57: Majerus EM, Anderson PJ, Sadler JE. "Binding of ADAMTS13 to von Willebrand factor." Journal of Biological Chemistry. 2005;280: Klaus C, Plaimauer B, Studt JD et al. "Epitope mapping of ADAMTS13 autoantibodies in acquired thrombotic thrombocytopenic purpura." Blood. 2004;103: Chauhan AK, Motto DG, Lamb CB et al. "Systemic antithrombotic effects of ADAMTS13." J Exp Med. 2006;203: Flannery CR, Zeng WL, Corcoran C et al. "Autocatalytic cleavage of ADAMTS-4 (Aggrecanase-1) reveals multiple glycosaminoglycan-binding sites." Journal of Biological Chemistry. 2002;277:

86

87 CHAPTER 3 ADAMTS-13 PLASMA LEVEL DETERMINATION UNCOVERS ANTIGEN ABSENCE IN ACQUIRED THROMBOTIC THROMBOCYTOPENIC PURPURA AND ETHNIC DIFFERENCES* Hendrik B Feys 1, Fang Liu 2, Ningzheng Dong 2, Inge Pareyn 1, Stephan Vauterin 1, Nele Vandeputte 1, Wim Noppe 1, Changgeng Ruan 2 ; Hans Deckmyn 1 and Karen Vanhoorelbeke 1 1 Laboratory for Thrombosis Research, IRC, KU Leuven Campus Kortrijk, Kortrijk, Belgium 2 JiangSu Institute of Hematology, First affiliated Hospital of Soochow University, Suzhou, P.R. China * Published in Journal of Thrombosis and Haemostasis, 2006 (4) In Focus with a commentary by Dr. Lämmle B. and Dr. Kremer-Hovinga J.A (same issue pp ). This publication was awarded the 2006 Prize for the Best Article by Young Investigators by the editorial board of the Journal of Thrombosis and Haemostasis.

88 CHAPTER 3: ADAMTS-13 Plasma Level Determination uncovers Antigen Absence in TTP 3.1 ABSTRACT BACKGROUND The recently discovered plasma enzyme ADAMTS-13 cleaves the A2-domain of von Willebrand factor (VWF). A defective cleaving protease results in unusually large VWF multimers which cause thrombotic thrombocytopenic purpura (TTP). OBJECTIVE Analysis of the ADAMTS-13 antigen levels in TTP patients compared to normal donors METHODS An antigen ELISA test was built, based on high affinity anti-adamts-13 monoclonal antibodies, which were generated using genetic immunization. RESULTS Specificity of the ADAMTS-13 antigen test was confirmed, as (i) plasma from a patient with acquired TTP but presenting without inhibitor, did not contain antigen and (ii) the binding of recombinant ADAMTS-13 was inhibited by increasing amounts of normal plasma. The assay is sensitive as it can detect antigen levels as low as 1.6% of normal. The concentration in normal pooled human plasma was determined (1.03 ± 0.15 µg ml -1 ) and arbitrarily set to 1 U ml -1. The antigen levels in congenital TTP samples (34 ± 21 mu ml -1, n=2), as well as in samples from patients with acquired TTP (231 ± 287 mu ml -1, n=11), were clearly reduced when compared to normal Caucasian donors (951 ± 206 mu ml -1, n=16). Remarkably, normal Chinese donors have a significantly lower antigen titer (601 ± 129 mu ml -1, n=15), when compared to normal Caucasians. CONCLUSIONS Our results show that acquired TTP patients suffer mainly from ADAMTS-13 antigen depletion, thereby indicating the importance of ADAMTS-13 antigen determination in diagnosis and patient follow-up. 88

89 CHAPTER 3: ADAMTS-13 Plasma Level Determination uncovers Antigen Absence in TTP 3.2 INTRODUCTION Von Willebrand factor (VWF) 1, a multimeric plasma glycoprotein, plays an important role in primary hemostasis by binding to platelets and collagen. Its multimeric length determines its avidity and hence the larger multimers will more readily bind to exposed subendothelium. The complex multimeric composition of circulating VWF is the result of many posttranslational processing steps 2 among which is the proteolysis by the recently described ADAMTS-13 3,4, also called VWF cleaving protease (VWF-CP). Since its discovery, research on ADAMTS-13 has been intensive in view of its role in thrombotic thrombocytopenic purpura (TTP), a rather uncommon but often lethal disease 5. The rare genetic variant is characterized by a homozygotic or compound heterozygotic mutation in the ADAMTS-13 gene 6, resulting in non-functional or absent enzyme. The more common form of TTP is acquired, in which anti-adamts-13 auto-antibodies 7 block enzymatic function, again resulting in a deficient VWF-CP. This malfunction gives rise to unusually large VWF multimers (UL-VWF), which spontaneously bind platelets, leading to uncontrolled agglutination. The suspended aggregates hamper normal blood flow in the microcirculation, causing local ischemia and symptoms including fever, renal impairment, neurological dysfunction and mild to severe thrombocytopenia 8. To date, TTP is treated by means of plasma exchange (PE) or plasma infusion 9. ADAMTS-13 activity is still mostly measured according to Furlan et al 10, or recent variations of it 11. These tests are time-consuming and need to be performed in highly specialized labs. Furthermore, although these tests discriminate well between severe deficiency and normal levels, they are less reliable when it comes to detecting differences between intermediate levels and normal values of ADAMTS-13 activity 12. A recently developed, substrate-based activity assay, developed by Kokame et al. 13, employs a recombinant VWF fragment and measures fast the generation of breakdown product by means of fluorescence resonance energy transfer (FRETS-VWF73). At the moment of manuscript submission, some abstracts mentioned ELISA based assays that determine absolute plasma titers of ADAMTS-13, however only so by using polyclonal antibodies. Thus far, no assay, based exclusively on the use of monoclonal antibodies (mabs), has been published. Using genetic immunization and a specific screening assay, we succeeded in isolating high affinity anti-adamts-13 monoclonal antibodies (see Chapter 2). With these antibodies, we ve developed a sensitive and reproducible ADAMTS-13 antigen assay which (i) discriminates not only absence or presence of the enzyme but also can delineate subtle differences in ADAMTS-13 titer, (ii) can be used in the analysis of diverse donor plasmas and (iii) could eventually be used in diagnosis of TTP. The assay not only opens doors toward better understanding of the correlation between ADAMTS-13 titers and disease, but also it furthermore can be useful in the classification of TTP and variant diseases. 89

90 CHAPTER 3: ADAMTS-13 Plasma Level Determination uncovers Antigen Absence in TTP 3.3 MATERIALS AND METHODS Production of polyclonal antiserum against recombinant CUB2 (also see Chapter 2) The uttermost C-terminal CUB domain DNA (CUB2) was amplified by means of polymerase chain reaction (PCR) using Platinum Pfx polymerase (Invitrogen, Carlsbad, CA, USA), specific primers that add 5 EcoRI and 3 XhoI endonuclease recognition sites [forward 5 -GCGGAATTCATGTGACATGCAGCTCTTTGG-3 and reverse 5 -ATGCTCGAGGGTTCCTTCCTTTCCCTTCC 3 ] and ADAMTS-13 cdna containing plasmid (a gift from Dr JE Sadler). Next, the PCR fragment was cloned into the prokaryotic expression vector pet26b (Novagen, EMD Biosciences, Darmstadt, Germany) using T4 DNA ligase (Roche Diagnostics, Mannheim, Germany). One Shot BL21 Star (DE3) chemically competent cells (Invitrogen) were transformed with this vector according to the manufacturers instructions. After expression, renaturation and purification, the N- terminal sequence was determined (TopLab, Martinsried, Germany) and was identical to the published C- terminal ADAMTS-13 sequence (accession no. AAL11095). rcub2 was emulsified (final 0.5 mg ml -1 ) in complete and incomplete Freunds adjuvants (Sigma-Aldrich, St Louis, MO, USA) for first and booster injections, respectively. Rabbit serum contained anti-rcub2 antibodies after the first immunization series. The rabbit was bled three weeks after the second boost and the immunoglobulin fraction was purified on rprotein A Sepharose fast flow (Amersham Biosciences, Freiburg, Germany) Production of recombinant ADAMTS-13 (also see Chapter 2) ADAMTS-13 was expressed as a fusion protein, containing a C-terminal 6xHis tag and V5 recognition epitope. The inducible GeneSwitch mammalian expression system was used according to the instructions of the manufacturer (Invitrogen). In brief, ADAMTS-13 cdna was cloned in the pgene expression vector and stably transfected in a Chinese hamster ovary (CHO) cell line. When confluency was reached, medium was supplemented with 100 nmol L -1 of steroid inductor (mifepristone) and incubated for 72 h. Expression medium was concentrated seven-fold by ultrafiltration and purified on a HisTrap column (Amersham). radamts-13 had the correct molecular weight on western blot analysis and was active as determined by means of a urea based VWF cleaving assay SDS-PAGE and western Blot. radamts-13 and plasma samples were blotted semi-wet onto nitrocellulose membranes (Schleier & Schuell Biosciences, Dassel, Germany) in transferbuffer (50 mmol L -1 Tris, 40 mmol L -1 glycine, 20% (v/v) methanol, ph 8.6). Membranes were blocked with 3% (w/v) skimmed milk (Nestlé, Vevey, Switzerland) in phosphate buffered saline (PBS) and subsequently washed with PBS % (v/v) Tween80 (PBS-T80). Biotinylated anti-adamts-13 mabs (1 µg ml -1 ) were incubated for 1 h on a horizontal shaker. Secondary, horse radish peroxidase (HRP) labeled, streptavidin (Roche) (1/15,000 in PBS, 0.3% milk) was then incubated for 1 h. After washing, proteins were visualized using the enhanced chemiluminescence (ECL)-kit (Amersham). 90

91 CHAPTER 3: ADAMTS-13 Plasma Level Determination uncovers Antigen Absence in TTP Concentration of radamts-13 was determined according to Zheng et al 17. In brief, protein was blotted and detected with the peroxidase labeled monoclonal anti-v5 antibody (anti-v5-hrp). The luminograms were scanned and concentration was determined by standardization with the identically tagged Positope TM reference protein (Invitrogen) using NIH Image 1.62 software windows XP analog, developed by Scion Corporation ( MD, USA) DNA Immunization ADAMTS-13 cdna was cloned in pcdna3.1 (Invitrogen) via EcoRI and NotI restriction sites and prepared to high concentrations with the QIAprep Megaprep kit (Qiagen, Venlo, the Netherlands). On day 0 of the immunization protocol, eight female Balb/c mice were injected subcutaneously with 50 µg of pcdna3.1-adamts-13 in 50 µl of 10 mmol L -1 Tris-HCl, ph 8.5. On day 20 the mice underwent a second injection with the same batch of expression vector. Control mice were treated similarly with buffer only. Ten days after the second injection (day 30), mice were bled and the serum was screened for the presence of anti-adamts-13 antibodies. At day 40 extra plasmid injections were performed and on day 50, seven days prior to fusion, the mice were boosted intraperitoneal with 4 µg of radamts-13 in incomplete Freunds adjuvants Fusion and Screening of hybridomas Spleen cells were fused with SP2/0 myeloma cells according to the method of Köhler and Millstein 18. Polyclonal anti-rcub2 purified immunoglobulins in PBS, ph 7.4, were coated onto a 96-well microtiter plate (Greiner, Frickenhausen, Germany) overnight at 4 C. Wells were blocked for 2 h with 3% milk in PBS. Next, purified radamts-13 was added at 10 nmol L -1 for 1 h (37 C) and after washing, hybridoma media were incubated for 1h. Secondary antibodies were HRP labeled anti-mouse-igg, Fc-specific (GAM-HRP) and a anti-mouse-whole molecule antiserum (Sigma) (1/12,000 in PBS, 0.3% milk); colorimetric development was with o-phenylenediamine dihydrochloride (OPD) (Sigma-Aldrich) in 50 mmol L -1 phosphate-citrate buffer containing H 2 O 2, ph 5.0, for 15 min. Reactions were stopped with 1.5 mol L -1 sulfuric acid, and the absorbance at 490 nm was determined. As a positive control, anti-v5-hrp (Invitrogen) was used. Wells were washed with PBS, 0.1% (v/v) Tween20 (PBS-T) three times after coating and blocking and six times elsewhere Immunosorbent and inhibition assays with radamts-13 To determine the apparent affinity of the new mabs, 96-well microtiter plates were coated with 4 µg ml -1 monoclonal anti-adamts-13 antibody solution in PBS (ph 7.4) at 4 C and blocked with 3% milk in PBS. Next, a serial dilution (in PBS, 0.3% milk) of radamts-13 (100 µl/well) at a start concentration of 12.5 nmol L -1, was incubated for 1h (37 C). Bound antigen was detected with anti-v5-hrp (1/5,000 in PBS, 0.3% milk). To study inhibition, plasma was added in a serial dilution (in PBS, 0.3% milk) to the antibody coated plates for 30 min (37 C). Without washing, radamts-13 (EC 50 concentration) was mixed with the plasma solution 91

92 CHAPTER 3: ADAMTS-13 Plasma Level Determination uncovers Antigen Absence in TTP and allowed to interact for 30 more minutes (37 C). After washing, residually bound radamts-13 was detected with anti-v5-hrp (1/5,000 dilution in PBS, 0.3% milk). In both ELISAs washing and colorimetric development was as described above. To assess whether TTP plasma auto-antibodies competed with the binding of ADAMTS-13 to coated 2G3 antibody, a serial dilution of radamts-13, with starting concentration of 16.5 nmol L -1, was incubated on immobilized 2G3 in the presence of excess TTP plasma or NHP. After washing, residually bound radamts- 13 was detected with anti-v5-hrp (1/5,000 in PBS, 0.3% milk). Vice versa, these mixtures were incubated on coated anti-v5 (4 µg ml -1, overnight, 4 C) and bound radamts-13 was detected with biotinylated 2G3 antibody (1 µg ml -1 in PBS, 0.3% milk) and streptavidin (1/15,000 in PBS, 0.3% milk) to compensate for those plasmas containing endogenous ADAMTS ADAMTS-13 antigen assay. Monoclonal anti-adamts-13 antibody 2G3 was coated (4 µg ml -1 ) to a 96-well microtiter plate overnight at 4 C in PBS. A dilution series (in PBS, 0.3% milk) of pooled normal human (Caucasian) plasma (NHP) (n = 20) was applied as a standard. Next 25 µl of donor plasma was added, diluted 1/8, 1/16 and 1/32 (PBS 0.3% milk) in duplicate and incubated for 1h (37 C). Bound antigen was detected using a mix of biotinylated anti-adamts-13 antibodies 8C10 and 13F7 (1 µg ml -1 in PBS, 0.3% milk) and HRP labeled streptavidin (1/15,000 dilution in PBS, 0.3% milk). Washing and colorimetric development was as described above. A linear standard curve was obtained from which an equation and a confidence (P > 0.95) interval were determined by re-editing standard values in the equation. Optical density measurements outside this interval were discarded and the mean value from each sample was calculated (Figure 21). ADAMTS-13 activity was determined according to the method developed by Gerritsen et al 19, using NHP as a standard. Figure 21 : Reference curve. A serial dilution of NHP was incubated on coated 2G3 and bound ADAMTS13 was detected by a mixture of biotinylated antibodies 8C10 and 13F7. After washing HRP labeled streptavidin was used for detection with OPD. The optical density at 490nm in function of the ADAMTS13 amount in NHP dilutions is depicted. The corresponding equation and the R² is shown as inset. This curve is exemplary for every ADAMTS13 antigen ELISA performed using this setup. 92

93 CHAPTER 3: ADAMTS-13 Plasma Level Determination uncovers Antigen Absence in TTP 3.4 RESULTS Generation of mabs against ADAMTS-13. The need for pure and large amounts of antigen was bypassed using genetic immunization complemented with one boost of radamts-13 antigen at the end of the immunization series Ten days after the second plasmid injection, the mice were bled and serum was tested: one out of eight mice sera responded positive at this stage of the immunization. Seven days prior to fusion, the mice were boosted with radamts-13 and 1 day before the fusion, were bled again and their serum was tested for the presence of antibodies. Now, all eight sera responded positively, while the sera from control mice were still negative (see Chapter 2). After fusion and initial screening, twenty clones were selected for further analysis. Figure 22: Binding of radamts13 to the mabs. mabs were coated, radamts13 added and detected using anti-v5-hrp. Data are expressed as the optical density (OD) at 490 nm of one data point (25 ng radamts13) out of a serial dilution. A nonsense mouse monoclonal antibody (18F12) was coated as negative control indicated by (-). Error bars represent the SD of at least three experiments Binding of anti-adamts-13 mabs to radamts-13. Anti-ADAMTS-13 antibodies were coated and allowed to interact with radamts-13 in ELISA. Six out of twenty antibodies were positive in this experiment and hence selected as ADAMTS-13 specific (Figure 22 shows four of them). Dose-response binding curves revealed apparent affinities ranging from 0.7 nmol L -1 to 13.7 nmol L -1. Later fusion experiments resulted in more mabs as outlined in the previous chapter. To further confirm antibody specificity, mabs were tested for their interaction with radamts-13 in nonreducing western blot conditions. All, but one, antibodies detected the enzyme in these conditions, as could the anti-v5 control, in contrast to the control mab 18F12 (Figure 23). None of the antibodies, except for the anti-v5 control, bound to reduced radamts-13. Western blot detection of plasma ADAMTS-13 was not so straightforward because of the much lower concentration in plasma, which furthermore needs to be diluted in order to obtain a good electrophoretic 93

94 CHAPTER 3: ADAMTS-13 Plasma Level Determination uncovers Antigen Absence in TTP migration. The best detection of ADAMTS-13 in blotted NHP was obtained with biotinylated mabs 13F7 and 20D2, of which one is depicted in Figure 23. Figure 23: Detection of ADAMTS13 in western blot. 40 ng of radamts13 (left lanes) or a dilution of NHP (right lane) was separated on 7.5% SDS-PAGE and western blotted under non reducing conditions. Detection was with the biotinylated mabs as indicated, followed by HRP labeled streptavidin and ECL. Anti- V5 and the irrelevant 18F12 were used as a positive and negative control, respectively Sandwich ELISA for detection of plasma ADAMTS-13 In order to optimize an antigen test in terms of sensitivity, background and reproducibility, we screened for a capturing mab with high affinity and analyzed different combinations and sets of antibodies for detection in sandwich assays. The antibody combination that fulfilled the criteria consisted of microtiter plate coating with mab 2G3, bearing the highest affinity and detection with a mix of biotinylated mabs 8C10 and 13F7 (Figure 24 upper graph). We found that binding was specific, as neither plasma from an acquired TTP patient presenting without inhibitor (tested in mixing studies), nor from a congenital TTP patient, resulted in a signal. Binding specificity was further proven by showing that increasing amounts of NHP dose-dependently inhibited radamts-13 binding to coated mab 2G3 (Figure 24 lower graph) Properties of the ADAMTS-13 antigen ELISA and choice of standard The concentration of radamts-13, determined by luminography as outlined in Materials and methods, was 7.9 ± 0.3 µg ml -1 (mean ± SD) (n = 3). The absolute ADAMTS-13 concentration in NHP was 1.03 ± 0.15 µg ml -1 (n = 3) using radamts-13 as a reference. Using NHP as a standard, arbitrarily set to contain 1 U ml -1 of ADAMTS-13, we determined the lower detection limit of the assay to be 16 ± 1.0 mu ml -1 (n = 6). This implies that the test can detect ADAMTS-13 titers as low as 1.6 % of the NHP level. 94

95 CHAPTER 3: ADAMTS-13 Plasma Level Determination uncovers Antigen Absence in TTP ADAMTS-13 antigen levels in a Chinese pedigree with TTP Using NHP as standard, we found an ADAMTS-13 level of 951 ± 206 mu ml -1 in 16 normal Caucasian donors. Strikingly, there was a significant difference (p < 4.5x10-6 ) between the Caucasian and the Chinese normal plasma levels, found to be 601 ± 129 mu ml -1 (n = 15) (Figure 25). Figure 24: ADAMTS13 Antigen Assay and specificity determination. (top) mab 2G3 was coated to a microtiter plate surface. Different dilutions of NHP ( ), acquired TTP plasma ( ) and congenital TTP plasma ( ) were incubated at 37 C. Bound antigen was detected with biotinylated mabs 13F7 and 8C10 and HRP labeled streptavidin. (Bottom) Binding of radamts13 (EC 50 = 0.7 nmol L -1 ) to coated mab 2G3 was inhibited by increasing amounts of NHP. Detection was with anti-v5-hrp. Percentage binding in function of increasing amounts of plasma, expressed as a dilution factor, is depicted. Error bars represent the SD of four experiments. Twenty relatives from a Chinese TTP patient suffering from congenital TTP were genotyped (LF and CGR, manuscript in preparation) and classified as carrying the mutation (carrier) or not (non carrier). We found that the patient had undetectable antigen. However, the family members, heterozygous for the mutation (341 ± 125 mu ml -1, n = 9), had half the antigen levels (p < ) of those members not carrying the mutation (668 ± 208 mu ml -1, n = 11) (Figure 25). The mean activity level in non carriers was 76 ± 18%, relative to the activity in NHP, which is significantly different from the activity in mutation carrying family members (42 ± 14%, p < ).There was no statistical difference (p = 0.32) between normal Chinese donors and family members carrying no mutation in the ADAMTS-13 gene. 95

96 CHAPTER 3: ADAMTS-13 Plasma Level Determination uncovers Antigen Absence in TTP Figure 25: ADAMTS13 antigen distribution in Caucasian normals versus Chinese normals and family members of a TTP patient. ADAMTS13 antigen levels were determined in normal Caucasian [Cau] and Chinese [Chin] donors and in plasma samples from a genotyped family of a congenital TTP patient (n=21: 1 homozygous [cttp], 9 carriers [car], 11 non carriers [non-car]). Values were determined using NHP (n=25, all Caucasian) as a standard, arbitrarily set to contain 1 U ml -1 ADAMTS ADAMTS-13 antigen levels in TTP patients We tested ADAMTS-13 titers in eleven patients suffering from acquired TTP. Discrimination between acquired and congenital TTP was made according to Allford et al. 24. Plasma samples were analyzed before (pre-pe) and after (post-pe) plasma exchange. A significant difference (p < 0.02) between the antigen levels in normal donors and in samples from both congenital (34 ± 21 mu ml -1, n = 2) as well as acquired TTP patients, before (231 ± 287 mu ml -1, n = 11) and after PE (513 ± 223 mu ml -1, n = 11), was found (Figure 26). Figure 26: ADAMTS13 antigen levels in TTP patients compared to normal donors. Plasma from patients (n=11) suffering from acquired TTP (attp) was analyzed, before the patients were treated (pre-pe) and after (post-pe). A straight line connects data from the same patient. Two congenital TTP (cttp) plasmas were also analyzed. These data were compared to the distribution of ADAMTS13 antigen levels in normal donors (n=16). The mean value of each population is indicated by ( ). Data are expressed in mu ml -1 with 1 U ml -1 being the ADAMTS13 titer in NHP (n=25), which is used as a standard. 96

97 CHAPTER 3: ADAMTS-13 Plasma Level Determination uncovers Antigen Absence in TTP Moreover; 82% of the investigated acquired TTP plasmas (pre-pe) contained less ADAMTS-13 antigen than the average value in this group. This indicated that only two (18%) out of eleven patients suffered from a persistent inhibition of enzyme function, as was confirmed in mixing activity assays (data not shown). The remaining nine patients may have had ADAMTS-13 inhibitors in plasma (mixing activity assays were not performed on these samples), their antigen occupancy resulted in clearance and hence diminished ADAMTS-13 function. Activity in all samples pre-pe was lower than 16%, with only three samples containing more activity than 5%, being the detection limit of the performed activity assay. After PE, the activity levels were higher in all patients, but one, who still suffered from severe activity loss. To rule out the plausible bias caused by auto-antibodies interfering with the 2G3 epitope or sterical environment, fourteen different, autoantibody-containing, TTP plasmas were mixed with radamts-13 and specific binding to 2G3 was assessed by anti-v5 detection. Neither binding to coated 2G3, nor binding of biotinylated 2G3 to anti-v5 immobilized radamts-13, was abolished or influenced when compared to the binding in the presence of excess NHP Optimization A new fusion experiment resulted in the isolation of a mab (20A5) with evenly high apparent affinity as 2G3 (see Chapter 2). It had indeed the same quality of immobilizing ADAMTS-13 from plasma, indicating that affinity is a determining parameter for the catching of the antigen from solution, at least in this kind of experiment. Statistical analysis and comparison with the 2G3-based assay showed no discrepancies and since 20A5 has higher in vitro production yields, it was chosen to perform future antigen determination experiments with (Martin K et al. and Peyvandi F et al, manuscripts in preparation). The same fusion experiment also resulted in the characterization of an efficient detecting mab (5C11) that will be a suitable replacement for the currently used 8C F7 combination. This mab not only has a higher apparent affinity than 8C10 or 13F7, the hybridoma clone is more efficiently cultured in vitro and protein yields are higher (not shown). 97

98 CHAPTER 3: ADAMTS-13 Plasma Level Determination uncovers Antigen Absence in TTP 3.5 DISCUSSION The production of monoclonal antibodies is often hampered by the lack of sufficient quantities of purified material or recombinant antigen. To circumvent this problem we used genetic immunization followed by a single boost with radamts-13, of which only 4 µg was needed to get a sufficient immune response. To be able to detect murine anti-adamts-13 antibodies, rabbit polyclonal antibodies were raised against the recombinant C-terminal CUB-domain, that could catch radamts-13 in an ELISA based screening assay. After three plasmid injections and the boost with radamts-13, all sera contained anti-adamts-13 antibodies and fusion could be performed. The final hybridoma yield (approximately 10 clones per fusion) however was quite low, as compared with previous immunizations with other antigens, conducted by our group, which resulted in higher hybridoma yields 25,26. This could be because of (i) the stringent selection criteria we used, (ii) the fact that not classical, but genetic immunization was performed or (iii) it could be that ADAMTS-13 has low antigenic properties. Nevertheless, our method revealed at least six highly specific anti-adamts-13 mabs, able to both detect immobilized ADAMTS-13 as well as catch the antigen from solution. All, but one, of the selected antibodies bound to radamts-13 in western blot, but only in non-reducing conditions. This implies that, at least for this group of antibodies, disulfide bridges are necessary for epitope recognition. It could also indicate the importance of disulfide bridging for maintaining ADAMTS-13 structure. Western blot detection of ADAMTS- 13 in plasma was not so straightforward, as the concentration in plasma is at least approximately seven fold lower than in our recombinant samples. Furthermore, plasma needs to be diluted to assure proper electrophoretic migration and avoid matrix interference. Despite this, biotinylated mab 13F7 and 20D2 could detect western blotted plasma ADAMTS-13. An antigen assay for the titer determination of ADAMTS-13 in human plasma requires high affinity antibodies, because (i) ADAMTS-13 has a low concentration and/or (ii) potentially, complexes with other circulating plasma proteins are formed 27-29, which may interfere with antibody-antigen interactions. We found that the combination of coated mab 2G3 with a mixture of mabs, 13F7 and 8C10, as detectors, could be used to measure plasma ADAMTS-13 antigen titers. Plasma from a patient who suffered from acquired TTP, but presenting without inhibitor, contained no antigen, nor did plasma from a congenital TTP patient. Increasing amounts of plasma could inhibit the binding of recombinant ADAMTS-13 to coated mab 2G3, proving antigen specificity. Furthermore, with radamts-13 as a standard, we determined that 1.03 ± 0.15 µg ml -1 ADAMTS-13 was present in NHP (n=20), which is in line with previous reports 30. This NHP concentration was arbitrarily set equal to 1 U ml -1. The sensitivity of the test was 16 mu ml -1 or 1.6 % of normal level. As expected, the mean of the levels in 16 normal Caucasian donors was close to 1 U ml -1. However, plasma levels in randomly selected normal Chinese donors (n= non-carriers) were significantly lower than in the Caucasian normal population. The consequences of our findings at the molecular level are very much unclear and moreover, larger surveys are needed to confirm these data. Certain antigen levels (C-reactive protein, tissue plasminogen activator) may vary among different ethnicities 31,32, whereas for other thrombogenic plasma factors, data are scarce. It is known that the Chinese population is less prone to 98

99 CHAPTER 3: ADAMTS-13 Plasma Level Determination uncovers Antigen Absence in TTP myocardial infarction and that mortality rates because of cardiovascular diseases are lower 33. On the other hand, one would expect people with lower ADAMTS-13 levels to be more prone to arterial thrombosis. Plasma from eleven patients suffering from acquired TTP was analyzed before and after PE therapy. There was a significant difference between the ADAMTS-13 titers in samples from patients and from normal donors, before and after PE. Strikingly, almost all patients (82%) had severely reduced (below 25%) antigen levels. In acquired TTP, patients suffer from inhibitory antibodies 34-36, but it is not clear whether these antibodies inhibited the protease by occupying functionally relevant epitopes and/or whether the antibody- ADAMTS-13 complexes were also cleared from the circulation. Our present results suggest that most of the acquired TTP plasmas barely contain ADAMTS-13 enzyme, most likely as a consequence of antigen clearance. Fourteen acquired TTP plasmas were tested for interference with the 2G3 epitope and none did so. It cannot be ruled out, however, that certain patient auto-antibodies would sterically hamper antibodyantigen binding, when the former are present in the same sterical environment as 2G3. These series of experiments have proven that not only inhibition of the enzyme is responsible for the pathogenesis of acquired TTP, but also antigen clearance and hence reduced plasma levels. These results could, to some extent, be expected, in view of the polyclonal nature of the auto-antibodies in acquired TTP plasmas 37. Nevertheless, we obtained also evidence for a few cases where plasma levels were near normal, with severely reduced activities. Obviously, such antibodies may prove extremely useful in unraveling the structure-function relationship of the ADAMTS-13 domains. Although there was a significant increase in ADAMTS-13 levels after PE, most of the patients (82%) did not reach the average normal ADAMTS-13 titer. It has been stated earlier that undetectable ADAMTS-13 activity is specific for TTP 38,39, and hence a substantial, but still reduced, amount of working enzyme would suffice to bring the patient in remission. The further course of the ADAMTS-13 antigen levels in the herein investigated patients is not known, so it remains unclear whether patients should receive PE until the ADAMTS-13 levels are back to normal or only until activity is raised to reasonable levels. Hence further investigation needs to point out whether patients would remain free of relapse when getting excess antigen until normal levels are reached. We finally investigated the antigen levels in a Chinese pedigree of which the members are all related to a patient suffering from congenital TTP. We found that the homozygous patient had levels below detection limit and that family members, heterozygous for the mutation, had lowered (0.34 U ml -1 ) whereas non carriers had normal Chinese levels (0.67 U ml -1 ). This proves not only the specificity of our antigen ELISA again; it also shows its reproducibility, sensitivity and applicability. In summary, we have generated a series of monoclonal anti-adamts-13 antibodies that were used to set up a sensitive, specific and reproducible screening assay. The test revealed that patients with acquired TTP suffer from severe ADAMTS-13 antigen depletion, probably because of clearance out of plasma after autoantibody occupation. It furthermore preliminary revealed an ADAMTS-13 antigen level difference between the Chinese and the Caucasian normal population. The assay not only opens doors towards better understanding of correlation between ADAMTS-13 titers and disease, it could also be of help in diagnosis and classification of TTP and variant disorders. 99

100 CHAPTER 3: ADAMTS-13 Plasma Level Determination uncovers Antigen Absence in TTP 3.6 CONTRIBUTIONS HBF wrote the paper; HBF, LF, KV and HD designed the study; LF, ND and CGR provided essential donor material; LF, HBF, KV, WN, NV, IP, ND, and SV performed experiments essential to the study; HD, KV and CGR supervised and critically analyzed data and experiments, they also revised the manuscript. 100

101 CHAPTER 3: ADAMTS-13 Plasma Level Determination uncovers Antigen Absence in TTP 3.7 REFERENCES 1 Sadler JE. "Biochemistry and genetics of von Willebrand factor." Annu Rev Biochem. 1998;67: Pimanda J, Hogg P. "Control of von Willebrand factor multimer size and implications for disease." Blood Rev. 2002;16: Levy GG, Nichols WC, Lian EC et al. "Mutations in a member of the ADAMTS gene family cause thrombotic thrombocytopenic purpura." Nature. 2001;413: Zheng X, Chung D, Takayama TK et al. "Structure of von Willebrand factor-cleaving protease (ADAMTS13), a metalloprotease involved in thrombotic thrombocytopenic purpura." J Biol Chem. 2001;276: Moake JL. "Von Willebrand factor, ADAMTS-13, and thrombotic thrombocytopenic purpura." Seminars in Hematology. 2004;41: Kokame K, Miyata T. "Genetic defects leading to hereditary thrombotic thrombocytopenic purpura." Seminars in Hematology. 2004;41: Ruggenenti P, Remuzzi G. "The pathophysiology and management of thrombotic thrombocytopenic purpura." European Journal of Haematology. 1996;56: Moake JL. "Thrombotic microangiopathies." N Engl J Med. 2002;347: van der Straaten M, Jamart S, Wens R et al. "Treatment of thrombotic thrombocytopenic purpura." Intensive Care Medicine. 2005;31: Furlan M, Robles R, Lammle B. "Partial purification and characterization of a protease from human plasma cleaving von Willebrand factor to fragments produced by in vivo proteolysis." Blood. 1996;87: Veyradier A, Girma JP. "Assays of ADAMTS-13 activity." Seminars in Hematology. 2004;41: Tripodi A, Chantarangkul V, Bohm M et al. "Measurement of von Willebrand factor cleaving protease (ADAMTS-13): results of an international collaborative study involving 11 methods testing the same set of coded plasmas." Journal of Thrombosis and Haemostasis. 2004;2: Kokame K, Nobe Y, Kokubo Y, Okayama A, Miyata T. "FRETS-VWF73, a first fluorogenic substrate for ADAMTS13 assay." Br J Haematol. 2005;129: Vetr H, Colle S, Geiter S et al. TECHNOZYM ADAMTS 13 Assays For Analyzing The vwf Cleaving Protease ADAMTS 13 [abstract]. J Thromb Haemost. 2005;3 Supplement 1 August: P Hideo Yagi Masanori, Masanori Matsumoto, Taka-aki Iwamoto et al. Heightened Proteolysis of Plasma ADAMTS13 Antigen in Patients with Thrombotic Thrombocytopenic Purpura [abstract]. Blood (ASH Annual meeting abstracts) Rieger M, Ferrari S, Herzog A et al. Quantification of ADAMTS13 Antigen Levels in Healthy Donors and Patients with Thrombotic Microangiopathies by a Newly Developed Sandwich ELISA. [abstract]. Blood (ASH Annual meeting abstracts). 2004;104; Zheng XL, Nishio K, Majerus EM, Sadler JE. "Cleavage of von Willebrand factor requires the spacer domain of the metalloprotease ADAMTS13." Journal of Biological Chemistry. 2003;278: Kohler G, Milstein C. "Continuous cultures of fused cells secreting antibody of predefined specificity." Nature. 1975;256: Gerritsen HE, Turecek PL, Schwarz HP, Lammle B, Furlan M. "Assay of von Willebrand factor (vwf)- cleaving protease based on decreased collagen binding affinity of degraded vwf - A tool for the diagnosis of thrombotic thrombocytopenic purpura (TTP)." Thrombosis and Haemostasis. 1999;82: Kasinrerk W, Moonsom S, Chawansuntati K. "Production of antibodies by single DNA immunization: Comparison of various immunization routes." Hybridoma and Hybridomics. 2002;21: Henke A. "DNA immunization - a new chance in vaccine research?" Medical Microbiology and Immunology. 2002;191: Anderson R, Gao XM, Papakonstantinopoulou A, Roberts M, Dougan G. "Immune response in mice following immunization with DNA encoding fragment C of tetanus toxin." Infection and Immunity. 1996;64: Moonsom S, Khunkeawla P, Kasinrerk W. "Production of polyclonal and monoclonal antibodies against CD54 molecules by intrasplenic immunization of plasmid DNA encoding CD54 protein." Immunol Lett. 2001;76: Allford SL, Hunt BJ, Rose P, Machin SJ. "Guidelines on the diagnosis and management of the thrombotic microangiopathic haemolytic anaemias." British Journal of Haematology. 2003;120: Cauwenberghs N, Vanhoorelbeke K, Vauterin S et al. "Epitope mapping of inhibitory antibodies against platelet glycoprotein Ibalpha reveals interaction between the leucine-rich repeat N-terminal and C-terminal flanking domains of glycoprotein Ibalpha." Blood. 2001;98:

102 CHAPTER 3: ADAMTS-13 Plasma Level Determination uncovers Antigen Absence in TTP 26 Cauwenberghs N, Meiring M, Vauterin S et al. "Antithrombotic effect of platelet glycoprotein Ib-blocking monoclonal antibody Fab fragments in nonhuman primates." Arterioscler Thromb Vasc Biol. 2000;20: Gerritsen HE, Robles R, Lammle B, Furlan M. "Partial amino acid sequence of purified von Willebrand factor-cleaving protease." Blood. 2001;98: Furlan M, Robles R, Lamie B. "Partial purification and characterization of a protease from human plasma cleaving von Willebrand factor to fragments produced by in vivo proteolysis." Blood. 1996;87: Tsai HM. "Physiologic cleavage of von Willebrand factor by a plasma protease is dependent on its conformation and requires calcium ion." Blood. 1996;87: Majerus EM, Anderson PJ, Sadler JE. "Binding of ADAMTS13 to von Willebrand factor." Journal of Biological Chemistry. 2005;280: Anand SS, Razak F, Yi Q et al. "C-reactive protein as a screening test for cardiovascular risk in a multiethnic population." Arterioscler Thromb Vasc Biol. 2004;24: Forouhi NG, Rumley A, Lowe GD, McKeigue P, Sattar N. "Specific elevation in plasma tissue plasminogen activator antigen concentrations in South Asians relative to Europeans." Blood Coagul Fibrinolysis. 2003;14: Sheth T, Nair C, Nargundkar M, Anand S, Yusuf S. "Cardiovascular and cancer mortality among Canadians of European, south Asian and Chinese origin from 1979 to 1993: an analysis of 1.2 million deaths." CMAJ. 1999;161: Yarranton H, Machin SJ. "An update on the pathogenesis and management of acquired thrombotic thrombocytopenic purpura." Curr Opin Neurol. 2003;16: Studt JD, Hovinga JA, Radonic R et al. "Familial acquired thrombotic thrombocytopenic purpura: ADAMTS13 inhibitory autoantibodies in identical twins." Blood. 2004;103: Ashida A, Nakamura H, Yoden A et al. "Successful treatment of a young infant who developed high-titer inhibitors against VWF-cleaving protease (ADAMTS-13): important discrimination from Upshaw-Schulman syndrome." Am J Hematol. 2002;71: Klaus C, Plaimauer B, Studt JD et al. "Epitope mapping of ADAMTS13 autoantibodies in acquired thrombotic thrombocytopenic purpura." Blood. 2004;103: Bianchi V, Robles R, Alberio L, Furlan M, Lammle B. "Von Willebrand factor-cleaving protease (ADAMTS13) in thrombocytopenic disorders: a severely deficient activity is specific for thrombotic thrombocytopenic purpura." Blood. 2002;100: Tsai HM, Lian EC. "Antibodies to von Willebrand factor-cleaving protease in acute thrombotic thrombocytopenic purpura." N Engl J Med. 1998;339:

103

104

105 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease CHAPTER 4. ADAMTS-13 PLASMA ANTIGEN TITER CHANGES IN HEALTH AND DISEASE Hendrik B Feys 1, Piermannuccio Mannucci 2, Flora Peyvandi 2, Maria Teresia Canciani 2, Dominique Baruch 3, Kenneth Martin 3, Hans Deckmyn 1 and Karen Vanhoorelbeke 1 1 Laboratory for Thrombosis Research, IRC, KULeuven Campus Kortrijk, Kortrijk, Belgium 2 Angelo Bianchi Bonomi Hemophilia and Thrombosis Center, Department of Internal Medicine and Medical Specialties, University of Milan, Milan, Italy 3 Inserm U765, Le Kremlin-Bicêtre, Paris, France

106 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease 4.1 ABSTRACT The plasma metalloprotease ADAMTS-13 cleaves pro-thrombotic ultra large von Willebrand factor (UL-VWF) into less prothrombotic multimers that mediate normal wound healing in injured blood vessels. Spontaneous aggregation of blood platelets, mediated by circulating UL-VWF, occurs when the enzyme is dysfunctional or absent, causing thrombotic thrombocytopenic purpura (TTP), a rare but life-threatening illness. The disease can be idiopathic or secondary to a certain physiologic or pathological condition. In 2001, ADAMTS-13 activity was determined in a large number of samples from donors that were in a physiologic or pathological condition that previously had been linked with TTP or ADAMTS-13 activity changes, which showed that ADAMTS-13 activity may be well below the level of normal controls without triggering TTP. The current study investigates the ADAMTS-13 antigen levels in an analogous set of plasma samples using our previously developed ADAMTS-13 antigen assay. Certain pathologic conditions; liver cirrhosis (n=90), inflammatory bowel disease (n=46), operative state (n=30) and severe sepsis (n=30) were investigated. Other conditions were non-pathologic; normal controls (n=128), pregnancy (n=43), neonatal state (n=40), oral contraceptives (n=33) and umbilical cord blood (n=11). Of these conditions only severe sepsis and some liver cirrhosis patients presented with severely reduced ADAMTS-13 antigen levels (< 10 %). Other conditions had significant but mild ADAMTS-13 antigen decrease, confirming the results with ADAMTS-13 activity measurements that lowered levels do not involve hematologic events per se. 106

107 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease 4.2 INTRODUCTION The congenital form of TTP is extremely rare and involves ADAMTS-13 gene mutations that are responsible for impaired secretion or dysfunctional protein (see also chapter 5) 1. Acquired idiopathic TTP is the form in which no well-defined underlying condition or congenital cause precipitates the illness. Most of these cases have been linked with low to absent ADAMTS-13 activity levels 2. In secondary TTP, a preceding condition causes the illness to set in and in many cases ADAMTS-13 activity levels have been reported not to be extremely low 2,3. Why and how TTP arises secondary to pregnancy, cancer, bone marrow transplantation and other clinical conditions is yet unknown. Sometimes it is even debated whether the diagnosis of secondary TTP can be categorized as TTP at all and hence whether TTP in general should not be limited to the strict criterion of severe ADAMTS-13 deficiency. The identification of ADAMTS-13 has undoubtedly led to major new insights and has paved the way for a better understanding of TTP. Nevertheless some questions remain as to how exactly the disease is triggered, since there are reports on donors with extremely low ADAMTS-13 values that do not exhibit the classical TTP features and vice versa 4,5. Therefore new insights in ADAMTS-13 plasma levels and its consequences are required prior to their application as reliable markers for specified diseased states. In 2001, Mannucci et al investigated the VWF cleaving activity in a broad series of plasmas from donors in well-defined physiologic or pathological states 6. At that time no tools were available to measure the absolute protein levels in the plasmas from these donors because the identity of the enzyme was not yet known. The results showed that non-diseased conditions (pregnant women in the second and third trimester and neonates) as well as diseased ones could be related with significantly reduced ADAMTS-13 activity levels, in the absence of any thrombotic event. In the previous two chapters the development of a new assay for the determination of ADAMTS-13 concentrations in plasma was presented. This novel assay allows us to re-investigate donors who previously were shown to carry low levels of enzymatic activity 6. A discrepancy between ADAMTS-13 antigen and activity could mean that inhibitors or activators of yet unknown identity are present in given circumstances. A good correlation between both will indicate that regulatory mechanisms of expression and/or protein clearance are in control. In this study ADAMTS-13 antigen titers in plasma from healthy individuals is compared with that from donors in several conditions, pathologic or not. Pregnancy, oral contraceptive intake, liver cirrhosis, severe sepsis, inflammatory bowel disease, neonatal state, operative state and umbilical cord were included. 107

108 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease 4.3 MATERIALS AND METHODS Blood collection and normal pool Blood was collected from the antecubital vein on citrate and centrifuged twice at 1500 g. Plasma was aspirated and frozen at -80 C in aliquots until analysis. Pooled normal plasma was from 50 healthy men and women, not pregnant and not taking oral contraceptives and was prepared analogously as mentioned above. The normal pool was set to contain 100% of ADAMTS-13 antigen, which roughly corresponds to 1 µg ml -1 as reported previously 7,8. Control subjects contributing to the reference pool were different from those participating in the normal control subjects group. The choice of conditions in both the physiologic and pathologic groups was based on the observations made previously 6. All donor samples were collected at the Angelo Bianchi Bonomi Hemophilia and Thrombosis Center, University of Milan, except for the samples in the study of severe sepsis which were collected at the INSERM U765, University of Paris Physiological conditions 132 normal healthy individuals, not taking oral contraceptives and not pregnant at the time of sampling, were equally divided in age categories from years (n=33), years (n=35), years (n=32) and older than 65 years (n=32). They were ostensibly healthy and were chosen among those used as controls for other laboratory measurements at the Hemophilia and Thrombosis Center, usually spouses or friends of patients referred for investigation of thrombotic and bleeding disorders. We also investigated 42 women in the third trimester of regular pregnancy, who attended routine clinical visits at the hospital. 41 full-term healthy neonates of both sexes were included in this study of which blood was sampled within 4 days of birth. Healthy women (n=33) taking oral contraceptives were also included to investigate influences of hormonal additives on ADAMTS13 properties. Fetal plasma was prepared from umbilical cord blood as mentioned above Pathologic conditions In parallel with the study performed in 2001, we chose to investigate three clinical conditions associated with multiorgan involvement and acute phase. The group of liver cirrhosis patients was divided according to Child score 9,10 containing 33 Child A, 32 Child B and 25 Child C cirrhosis patients. Patients suffering from inflammatory bowel disease were classified according to the level of C-reactive protein as a measure for acute inflammation. A threshold of 1 mg dl -1 was taken and this divided the group in 12 patients with and 32 without acute inflammatory disease. The group consisted of 27 patients with Crohn s disease and 17 with ulcerative colitis. Plasma from 30 patients undergoing open-heart surgery was sampled prior to surgery, during the operation and four days later corresponding to T0, T1 and T4 as published previously 11. Samples 108

109 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease from patients suffering from severe sepsis (n=30) and organ failure (n=30) were provided by the European Hospital Georges Pompidou, Paris, France. For completion; all donor samples included were different from the ones analyzed in 2001, except for those in the cardiac surgery study ADAMTS-13 antigen ELISA ADAMTS-13 levels were measured as reported previously with slight modifications (Chapter 3). Monoclonal antibody 20A5 was coated to an ELISA plate at 5 µg ml -1 and incubated overnight at 4 C. After blocking with 3% (m/v) skimmed milk in phosphate buffered saline (PBS), plasmas from donors and the reference pool were serially diluted in PBS + 0.3% skimmed milk; reference pooled plasma diluted at a ratio 1.5/2.5, starting from 15% (v/v) on. This procedure results in less dilution per well and hence allows for more data in the reference curve. Each donor plasma was diluted 1/2 in a dilutions series, for four consecutive dilutions, with as highest plasma concentration 7.5% (v/v). Samples were incubated for 1h at 37 C. Next, a pool of biotinylated monoclonal antibodies (13F7 and 5C11) were incubated at 1 µg ml -1 in PBS + 0.3% skimmed milk for 1h at room temperature. Finally, a 1h incubation of horse radish peroxidase labeled streptavidin (Roche Applied Science, Mannheim, Germany) at 1/15,000 in PBS + 0.3% skimmed milk was performed. Colorimetric development was with o-phenylenediamine dihydrochloride (OPD) (Sigma, Saint Louis, MO) in 50 mmol L -1 phosphate-citrate buffer supplemented with 0.03% (m/v) H 2 O 2, ph 5.0, for 15 min. Reactions were stopped in 1.0 mol L -1 sulfuric acid, and the absorbance at 490 nm was determined using an automated ELISA reader. All incubations were performed at room temperature for 1h, unless stated otherwise. In between steps, at least three washes with PBS + 0.1% (v/v) Tween20 were performed. The detection limit of this assay is maximally 6% and has been set as lower confidence limit Multimer analysis and densitometric scanning 1.5% SDS Agarose gel electrophoresis is performed, generally as previously described. 1.5% isoelectric focusing (IEF) agarose (GE Healthcare, Waukesha, WI) is multimerized between two glass plates on the hydrophilic surface of a GelBond (Cambrex, Rockland, ME) foil. Plasma is dissolved in 4 mol L -1 urea and 5% (m/v) SDS in 10 mmol L -1 Tris and 1 mmol L -1 ethylene diaminetetraacetic acid (EDTA) ph 8.0 and incubated on 60 C for 30 minutes. Samples are then run in a multiphor II apparatus (GE Healthcare) at constant 150 V. The foil is then vigorously washed in distilled water and dried under cooled air to adhere the gel material in the GelBond polymer. The GelBond is then blocked in 6% skimmed milk in PBS for 1h at room temperature. Next, a 1/750 dilution of in-house alkaline phosphatase-labeled anti-vwf antibody (Dako Cytomation, Glostrup, Denmark) in PBS + 0.3% skimmed milk is incubated overnight at room temperature. After thorough washing bound antibodies are revealed with the Amplified Alkaline Phosphatase Immun-blot kit (Bio-Rad, Hercules, CA). Densitometric analysis used freeware from NIH adapted for Windows by Scion Corporation (Scion Corp, Frederick, MD). The software analyses images that were scanned directly from the gel by a regular computer 109

110 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease driven system. The surface area below the tracing is calculated using an integration macro which is part of the above mentioned software (Figure 27). Figure 27: Determination of relative amounts of VWF in each multimer subcategory using densitometry and integration software. Normal human pooled plasma (NHP) and plasma from a TTP patient (TTP) are separated on a 1.5% SDS agarose gel with subsequent immunologic staining for VWF (left). Using densitometric and integration software, the relative amount of VWF in arbitrarily defined subclasses of multimers can be determined, next (right). Arbitrary subclasses are UL or above > 10 countable bands, between bands 7-10, between bands 4-6 and between bands C-reactive protein measurements Measurement of C-reactive protein was performed at the Angelo Bianchi Bonomi Hemophilia and Thrombosis Center Statistical analysis All data were analyzed for normality using Shapiro-Wilk calculation. Means were compared using the Student s t-test for parametric data and Mann-Whitney U-test for non-parametric data. Correlation measurements used Pearson s r. A probability of < 0.05 was taken as significant for rejection of null hypotheses, unless stated otherwise. All statistical applications used Origin v7.5 software (OriginLab, Northampton, MA). Asterisk symbols in figures refer to: ( ) P < 0.05 ( ) P < 0.01 ( ) P <

111 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease 4.4 RESULTS Physiologic Conditions ADAMTS-13 antigen levels decrease in elderly The group of normal control individuals contained 128 donors of which 66 female and 62 male subjects. No statistical difference in plasma ADAMTS-13 titers between both sexes was noted. The whole group was divided according to age in four subsets of (i) younger than 35 years (ii) between 36 and 50 (iii) between 51 and 65 (iv) older than 65. All data in the age categories had a normal distribution, except for the group of elderly (> 65 years). No relevant difference in ADAMTS-13 antigen level was noted when all subset data below 65 years were compared with each other, but the elderly had a markedly lower mean enzyme titer (89.2% ± 14.6%, P < 0.001) (mean ± SD) than younger individuals ( Figure 28). A slight but significant (P < 0.01) linear decline of ADAMTS-13 plasma titer by increasing age was observed (r = -0.28) ( Figure 28). Figure 28: Elderly have markedly lower ADAMTS-13 antigen levels. (Left) Linear regression of the antigen titer change, expressed as percentage of normal pooled plasma, by increasing age. (Right) The graph shows the distribution of the ADAMTS-13 antigen data per age category of normal individuals. Data are presented as both diamonds per individual ( ) and as a summarizing statistical box plot. The box represents the interquartile range with the standard deviation as error bars, it is divided by the median and the mean is depicted by the open square ( ) ADAMTS-13 is low in neonates and very low in the umbilical cord In 1996, before the identification of ADAMTS-13 as the VWF cleaving protease (VWF-CP), two novel assays, based on mild substrate denaturation were developed 12,13. In the coming years, many donor groups were assayed and one of the most remarkable findings was that neonates had reduced VWF-CP activity 111

112 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease compared to normal controls 6. To assess whether this difference is a consequence of lower antigen titers or because of a lowered inherent activity, plasma from 40 newborns and 11 umbilical cords was analyzed and compared to that from normal healthy donors in the category <35 year of age (age range 17y 35y). The mean ADAMTS-13 antigen level in plasma from umbilical cords (n = 11) was very low (47.1% ± 23.1%) and differed statistically from both the mean neonate and mean normal control level (P < 0.05) (Figure 29, left). Plasma titers in plasma from full-term neonates, defined as between day 1 and 3 after birth, was significantly lower (73.4% ± 9.4%, P < 0.001) than in normal controls (< 35 years of age, n = 31; 106.9% ± 15.9%), but higher than in umbilical cords. For 40 neonatal plasma samples, another monoclonal antibody combination was used and compared to the commonly used set. 12H6 was used as a catching antibody and a combination of biotinylated 5C11 and 17B10 was used for detection. 12H6 is binding more upstream (Figure 19) and if some ADAMTS-13 would be hydrolysed N-terminal to the 20A5 epitope, this alternative assay would not corroborate with the regular one. The data correlated significantly albeit with a relatively low coefficient (R = 0.45, P < 0.005). The relatively low correlation coefficient could be the result of interassay variability or because the 12H6 assay was not optimized. Four randomly chosen umbilical cord plasma samples and an equal amount of normal controls were furthermore analyzed in low resolution 1.5% SDS agarose VWF multimer analysis. A densitometric scan was executed and the VWF bands were divided into four subclasses; (i) ultra large multimers or higher than 10 countable bands (ii) between 7 and 10 bands (iii) between 4 and 6 bands and (iv) between 1 and 3 bands (Figure 27). No statistical difference in multimer distribution between normal controls and umbilical cord plasmas were found using this method (Figure 29, right). Still, 2 of the umbilical cord plasmas did contain UL- VWF, represented by a higher standard deviation and a mean that didn t statistically differ from that of acute phase TTP patients. The latter obviously presented with a high amount of UL-VWF in their plasma, as reported previously 14. Figure 29: Blood from umbilical cords and neonates has significantly reduced ADAMTS-13 antigen levels but normal multimer distribution. (left) The graph shows the distribution of the ADAMTS-13 antigen in plasma from umbilical cord (UC), neonates (NB), and normal controls below 35 years of age (< 35 y). Data are presented as percentage of normal pool as both diamonds per individual ( ) and as a statistical box plot. (right) Bars represent the relative amount of VWF multimers in arbitrarily defined classes as lined out in Figure 27. Black bars represent the mean result of normal individuals (n = 4), open bars represent that of 112

113 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease umbilical cord plasmas (n = 4), grey filled bars represent results from TTP plasmas in acute phase (n = 4). Error bars indicate the standard deviation. Newborns were also categorized in three birth weight groups; (i) < 3kg (ii) kg (iii) > 3.5 kg. No difference between these groups was found. Neither was there a difference when the data were sorted according to Apgar score 15, nor according to sex. All neonates were from full-term pregnancies, no premature nor babies with below threshold Apgar were investigated in the present study ADAMTS-13 antigen levels in women on oral contraceptives and in pregnancy Pregnancy has been related to TTP as a precipitating factor for women who are already at an elevated thrombotic risk 16. In the peri- or postpartum period, chances of developing thrombotic events are always higher, this especially accounts for TTP, which usually sets in around the partum period. It has been previously shown that VWF-CP activity levels decrease during pregnancy 6,17. Whether the enzyme release is slower than the consumption or whether inhibition of function takes place is unknown. We ve measured antigen levels in 43 women with normal pregnancies (at the end of the third trimester), in 33 women on oral contraceptives and a matched control group of 30 women, the latter not taking contraceptives nor being pregnant at the time of sampling. A statistical significance between the means was noted when pregnant women (92.3% ± 13.4%, P < 0.01) were compared with matched controls (102.7% ± 17.8%), although the decrease is not dramatic and even not significant for pregnant women versus the oral contraceptive intake group (P = 0.34) (Figure 30). The observed statistical difference can be attributed to the absence of plasmas in the higher range (> 114%), while 24% of oral contraceptives samples and 27% of control samples presented with levels in this range. In the lower range, no such difference could be noted. Figure 30: ADAMTS-13 antigen levels in pregnant women and women on oral contraceptives. Pregnant women were in the last trimester of pregnancy and were compared with matched controls (ctr) and donors on oral contraceptives (oc). Control women were not taking oral contraceptives and were not pregnant at the moment of blood sampling. Data are presented as percentage of normal pool as both diamonds per individual ( ) and as a statistical box plot. 113

114 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease Despite some reports on TTP associated with oral contraceptive intake 18,19, no clear association between lowered VWF-CP activity levels and oral contraceptives has been published so far. Also in the present study no apparent difference in antigen levels points towards a correlation between specific hormone administration and (reduced) enzyme levels Pathologic conditions Post operative state To investigate the levels of ADAMTS-13 in patients undergoing surgery, blood was taken at three fixed timepoints of patients undergoing open-heart surgery; (T 0 ) prior to operation, (T 1 ) at the end of open-heart surgery and (T 2 ) at remission (Figure 31). There was no difference (P = 0.21) between normal healthy controls (99.7% ± 19.0%, n = 97) and patients prior to cardiac surgery at T 0 (95.0% ± 14.5%, n = 30). But at the time of surgery T 1, a drastic decrease in ADAMTS-13 antigen (54.5% ± 11.7%, P < 0.001) was observed, which was not fully recovered at the time of clinical remission T 2 (71.5% ± 14.3%, P < 0.001). These data are in line with the previously published ADAMTS-13 activity levels 11. Figure 31: ADAMTS-13 antigen levels in cardiac surgery. Blood from 30 patients undergoing open-heart surgery was sampled at three different time-points and ADAMTS-13 antigen was measured in these plasmas. Time points are; prior to operation (T 0 ), at the end of cardiac surgery (T 1 ) and at remission (T 2 ). The control group (ctr) includes 97 healthy donors between 36 and 85 years of age. Data are presented as both diamonds per individual ( ) and as a statistical box plot Inflammatory bowel disease (IBD) Approximately 23% to 42% of patients with IBD develop extra-intestinal manifestations, but immune hematologic illnesses are rare One case report has measured ADAMTS-13 activity levels in TTP 114

115 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease associated with IBD and found extremely low enzyme activity during acute TTP bouts, despite recent findings that non-idiopathic TTP seldom corresponds with extremely low levels of ADAMTS-13 2,23. Plasmas from 46 IBD patients was analyzed in the ADAMTS-13 antigen assay and compared to normal. No donors presented with antigen levels below 50% of normal (range [50% %]). And although the mean value was significantly lower when compared to all normal donors (93.4% ± 17.8 vs % ± 18.5%, P = 0.011), again no drastically reduced mean antigen titer was found. However, the mean ADAMTS-13 titer in IBD patients with C-reactive protein (CRP) levels above 1 mg dl -1 was significantly lower (81.7% ± 20.1%, P < 0.05) when compared with those having normal CRP levels (96.7% ± 15.3%) (Figure 32). C-reactive protein is used as a measure for acute-phase inflammation severity. Figure 32: Degree of acute inflammation as measured by C-reactive protein inversely influences ADAMTS-13 levels. ADAMTS-13 mean antigen in plasma from patients with severe acute inflammation (CRP > 1 mg dl -1 ), as measured by CRP titers, is significantly lower than in those patients with CRP levels below the critical threshold (CRP > 1 mg dl -1 ). The control group included all normal donors (n = 128) (ctr). Data are presented as both diamonds ( ) and as a statistical box plot Severe sepsis Sepsis is a severe illness caused by overwhelming infection of the bloodstream by toxin-producing bacteria. It hence has diverse effects making it hard to select an appropriate control group. In this study 30 healthy subjects, 30 patients with severe sepsis and 29 control patients with sepsis-unrelated (multiple) organ failure were included. Patients in the latter group had the following diagnoses upon admission in the intensive care unit: cardiac insufficiency, heat stroke, pulmonary embolism, exacerbation of chronic obstructive pulmonary disease, cardiac arrest, mesenteric infarction and tumoral lysis syndrome. 115

116 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease Figure 33: ADAMTS-13 antigen in severe sepsis and sepsis-unrelated organ failure. Sepsis-unrelated organ failure (organ failure control) was a diverse group of patients with (multiple) organ failure that was not related to infection. Data are presented as both diamonds per individual ( ) and as a statistical box plot. It was obvious from these data that patients with severe sepsis had significantly lower levels (34.2% ± 23.1%, P < 0.001, range 9.6% %) than those in both control groups (Figure 33). None of the donors presented with levels below the detection limit of 6.6%. In this study a significant correlation between ADAMTS-13 antigen and activity was found (data not shown; Martin et al in preparation). A drop in ADAMTS-13 antigen was not specific for severe sepsis state, as single or multiple organ failure also caused ADAMTS-13 plasma titers to drop to lower levels (55.4% ± 20.6%, P < 0.001). Still, the decrease was definitely more outspoken in the severe sepsis group ADAMTS-13 antigen in liver cirrhosis Liver cirrhosis is a fibrotic disease that can be divided in three degrees of severity (A < B < C) depending on scores related to serum bilirubin titers, albumin titers, qualitative ascites measurements, encephalopathy and prothrombin time. This classification was first described by Child et al 9 and modified by Pugh et al 10 and is therefore called Child-Pugh score. The investigated liver cirrhosis group exists of 90 donors (33 Child A; 32 Child B and 25 Child C). All normal controls (n = 128) were included in this part of the study. ADAMTS-13 levels in patients with the least severe liver cirrhosis form (Child A, 94.4% ± 34.8%; P = 0.12) did not differ statistically from normal control levels (101.4% ± 18.5%). The enzyme titer is significantly decreased in both Child B (89.7% ± 32.3%; P < 0.01) and Child C liver cirrhosis (62.8% ± 35.1%; P < 0.001) when compared to normal controls. The mean ADAMTS- 13 titer in plasma decreases with disease severity, with hence the highest thrombotic risk at end-stage (Figure 34). 116

117 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease Figure 34: ADAMTS-13 antigen levels in liver cirrhosis patients, classified according to Child-Pugh score. Liver cirrhosis severity is generally classified according to Child(-Pugh) score with A < B < C order. The control group (ctr) exists of 128 healthy donors. Data are presented as both diamonds per individual ( ) and as a statistical box plot. Taking all cirrhosis data together, a significant skew in the data distribution is observed including patients with obvious enzyme titer increase and patients with severely decreased levels. The broad physiologic effects of cirrhosis are hence translated in the ADAMTS-13 titer and more thorough analysis is necessary to investigate the underlying cause of the observed skew. 117

118 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease 4.5 DISCUSSION In 2001 a large series of plasmas was included in a study on the changes in VWF cleaving activity 6. At that time the identity of the metalloprotease was just about to be discovered. The most important finding was that lowered activity is present in well-defined physiologic and pathological conditions with no signs of thrombotic events whatsoever. The development of an ADAMTS-13 antigen assay allows for a more thorough study of a series of conditions that might or might not be involved in TTP. Enzyme activity in plasma can be altered because of many potential reasons; the enzyme can be inhibited or cleared from solution, it can be inactivated by proteolysis leaving fragments behind or there may be something wrong with the regulation of expression. The presented work can hence be considered an extension to the work published by Mannucci et al in One of their most remarkable observations was the lowered ADAMTS-13 activity in plasma from elderly (> 65 years) when compared with younger individuals. Our data correspond perfectly with this as also the ADAMTS-13 antigen titer is lower in this subgroup. Moreover, a gradual significant linear decrease (r = , P < 0.01) of ADAMTS-13 antigen level with age was found. Hence, normal healthy subjects can have decreased ADAMTS-13 (both activity and antigen) levels with no outspoken clinical phenotype. On the other hand the consequences of a merely lowered ADAMTS-13 titer are not well known but as a regulator of VWF multimeric size, it may well play an important role. Hypothetically, a lowered metalloprotease antigen level could hence be one of the contributing factors to the increased risk for cardiovascular disease in seniors. Results on ADAMTS-13 activity in umbilical cords and newborns have been conflicting ever since Two reports claim that ADAMTS-13 activity is lowered in the neonate 6,24, but the most recent report found normal activities in these subjects 25. The latter authors did find lowered ADAMTS-13 activity in umbilical cords, though not statistically significant. The UL-VWF data are even more conflicting, Schmugge et al report UL-VWF in neonates but not in umbilical cords while Tsai et al found UL-VWF in umbilical cord plasma combined with normal VWF cleaving activity 25,26. The latter authors attribute the presence of the prothrombotic VWF forms to the lowered shear spectrum in the fetal state, even though others have proven existing ADAMTS-13 activity at low shear 27. Analysis of SDS agarose gels for the presence of UL-VWF is prone to high variability and interpretation differences which may cause the discrepancies between these groups. In the present study, umbilical cord plasma contained really few ADAMTS-13 antigen when compared to normal pooled plasma (as sampled from healthy subjects < 35 y). The neonates clearly present with higher enzyme levels, but still significantly lower than those in healthy controls. These findings indicate a rapid rise in ADAMTS-13 antigen levels, immediately after birth of the infant. Moreover, the lowest level in umbilical cord (34.1%) and in neonates (49.8%) was far below 2 SD of the normal control group. Four randomly chosen umbilical cord plasmas were subjected to low resolution 1.5% SDS agarose multimer analysis with subsequent densitometric analysis and no increase in the mean relative amount of UL-VWF was noted when compared to an equal number of randomly chosen healthy adults. On the other hand, 2 out of 4 umbilical cord plasmas did contain significant UL-VWF and therefore a higher standard deviation was noted, giving no statistical difference with the mean UL-VWF level in acute phase TTP patient plasmas. SDS 118

119 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease Agarose gel electrophoresis is the only reliable method to detect UL-VWF, but it is unfortunately prone to high variability and interpretation differences. Densitometric scanning with integration of the surface coverage allows for mathematical calculation but the inherent variability of the assay is not overcome. If full length ADAMTS-13 would be subjected to C-terminal proteolysis by circulating enzymes 28, there might be a chance that 20A5 no longer finds its epitope. This could then account for the observed decrease in certain plasma samples (e.g. neonates). We hypothesized that if an ELISA with 12H6 is not discrepant from the one employing 20A5, then no such fragmentation could be the cause for the observed ADAMTS-13 antigen decrease. 12H6 binds to the proximal thrombospondin-1 module and should bind to shorter forms of ADAMTS-13. We ve analyzed 40 neonates and found a significant linear relationship between the assay with 12H6 and the one with 20A5, excluding proteolytic degradation as a cause for the observed decrease in neonates. Moreover, It is a well-known fact that the levels of coagulation factors II XIII (not VIII), fibrinogen, antithrombin III, Protein C and heparin cofactor II are also decreased in neonates 29 which even causes prolonged prothrombin times (PT) and partial thromboplastin times (aptt). The lower prothrombin concentration in neonatal plasma will also give rise to less thrombin and hence less ADAMTS-13 proteolysis % to 78% of all TTP cases occur in females, of which 12%-25% are associated with pregnancy 16. The ADAMTS-13 activity gradually decreases in the course of pregnancy, to be lowest in weeks and the early puerperium 17. Since pregnancy is known to precipitate TTP, the abnormally low ADAMTS-13 activity levels may provide one clue for its etiology, but others are still lacking. Interestingly, the significant drop in ADAMTS-13 activity observed in third-trimester pregnancies is not translated in the enzyme s antigen distribution. Sànchez-Luceros et al 17 report mean activity levels of 61.5% ± 14.5% (n = 71) and Mannucci et al 6 report mean levels of 64% ± 15% (n = 32) in third-trimester pregnancies, while on average ADAMTS-13 antigen in this period is near normal (92.3% ± 13.4%). Hence a preliminary discrepancy between activity and antigen is found and therefore activity data of these specific plasma samples are necessary. The ratio ADAMTS-13 activity over antigen will confirm or refute the observed preliminary findings. In 2004 Mannucci et al report that cardiac surgery drastically influences ADAMTS-13 activity and VWF levels 11. Right after cardiac surgery (T 1 ) the enzyme s activity dropped to a mean level of approximately 50%. Four days later a dramatic increase in both VWF antigen and VWF collagen binding was observed, while ADAMTS-13 activity was slightly increasing again, but still stayed below normal levels. At day 30, both plasma protein titers were back to normal. Clearly, the ADAMTS-13 antigen data presented here follow the observations made by the above mentioned group although no information on VWF antigen and collagen binding is available at this time for these specific samples. Acute inflammation causes the VWF cleaving activity to drop significantly 6. The mechanism controlling this phenomenon is unclear and it is also currently not known whether the ADAMTS-13 antigen follows the activity observations. The present study investigated a number of patients suffering from inflammatory bowel disease (including both ulcerative colitis and Crohn s disease). No overall drastic decrease in ADAMTS-13 antigen could be observed, but again no data on the activity levels in these particular patients are available, yet. On the other hand, classification into two groups on the basis of C-reactive protein (CRP) titers, which are a standard measure of acute inflammation, revealed that ADAMTS-13 is decreased in severe 119

120 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease inflammation (CRP > 1 mg dl -1 ) when compared to regular inflammation with normal CRP levels (CRP < 1 mg dl -1 ). Inflammation causes endothelial cells to activate and to release UL-VWF in the blood lumen. If the endothelium is constantly releasing its organelle content, sustained exposure to the UL-VWF substrate may cause the enzyme to be consumed rendering the patient at risk for microangiopathy. An inverse relationship between VWF antigen and ADAMTS-13 activity was already reported in patients having undergone cardiac surgery, but this relationship may well be constant in other conditions that give rise to VWF release 30. Moreover, the normal relationship between ADAMTS-13 and UL-VWF may be challenged by the presence of inflammatory cytokines 31, negatively influencing the cleaving capacity of the enzyme, contributing even more to the above mentioned prothrombotic state. One of these highly inflammatory states is observed in patients suffering from severe sepsis. Ono et al reported in 2006 that patients with sepsis-induced disseminated intravascular coagulation (DIC) presented with mean ADAMTS-13 antigen below 50% of normal (n = 109) and with even lower and hence discrepant ADAMTS-13 mean activity 32. Moreover, a subgroup of 16.5% of investigated patients presented with undetectable (< 5%) VWF cleaving potential. The present study shows that the lowered ADAMTS-13 antigen levels may not be linked with the DIC, but rather with sepsis itself as the patients from our survey had evenly low mean levels of 34.2% ± 23.1%. On the other hand, the reported discrepancy between ADAMTS-13 activity and antigen may well be a hallmark of intravascular coagulation as in our patients a good correlation between both parameters was found. Other than in the Ono et al study, no patients had ADAMTS-13 antigen below the detection limit of 6.6%, but 40% of investigated severe sepsis samples (n = 30) had levels under 20%, while non of the organ failure control group did (n = 29). ADAMTS-13 is expressed in many organs, but it is believed that the liver is a major site of synthesis 33. Hence, illnesses involving the liver may well alter the ADAMTS-13 titer in plasma rendering patients with liver diseases more prone to thrombotic events. Lisman et al recently reported that ADAMTS-13 activity and antigen levels are not significantly altered in all three subclasses of liver cirrhosis (n = 54) 34. They did report a major skew in the data, with some patients having over 300% of normal ADAMTS-13 levels and others presenting with extremely low values. Our study involved 90 donors and although the skew could be confirmed, none of the patients presented with antigen levels above 200%. Moreover, a significant enzyme titer decrease in both Child B and Child C classes was found with a major decrease in the latter. Damaged liver tissue may hence on average result in markedly lower enzyme synthesis displaying the lower levels found in Child C cirrhosis. The conflicting data may be attributed to the use of a different antigen assay for Lisman et al employed a commercial kit that is based on polyclonal anti-adamts-13 antibodies (American Diagnostica, Stamford, CT). In conclusion this study follows the report of Mannucci et al, since it confirms that lower levels of ADAMTS-13 may well be present in physiologic and pathological conditions with no clear clinical proof of thrombotic event. It also extends to the authors findings since our data can expose discrepancies between antigen and activity levels which may subsequently inform us on the behavior of the enzyme in certain conditions. For example it is obvious that in this group of third-trimester pregnancy cases the mean ADAMTS-13 antigen titer didn t follow the activity data published in Moreover it was shown that antigen levels in umbilical cords and in neonates are lower than in control subjects. The presented antigen 120

121 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease assay is therefore not meant as a replacement tool for activity measurements, but rather as an extension of ADAMTS-13 activity assays, so to depict the latter mentioned discrepancies. 121

122 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease 4.6 CONTRIBUTIONS HBF wrote the chapter, designed the study and performed most of the experimental work. PMM, FP carefully selected and provided the samples. They both designed the study as an extention to their earlier work in MTC performed experimental work. DB and KM were involved in the sepsis study, providing samples, performing experiments and setting up the study. HD and KV supervised the study, carefully read and adjusted the manuscript. 122

123 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease 4.7 REFERENCES 1 Kokame K, Matsumoto M, Soejima K et al. "Mutations and common polymorphisms in ADAMTS13 gene responsible for von Willebrand factor-cleaving protease activity." Proc Natl Acad Sci U S A. 2002;99: Shelat SG, Smith P, Ai J, Zheng XL. "Inhibitory autoantibodies against ADAMTS-13 in patients with thrombotic thrombocytopenic purpura bind ADAMTS-13 protease and may accelerate its clearance in vivo." Journal of Thrombosis and Haemostasis. 2006;4: Peyvandi F, Siboni SM, Deliliers DL et al. "Prospective study on the behaviour of the metalloprotease ADAMTS13 and of von Willebrand factor after bone marrow transplantation." British Journal of Haematology. 2006;134: Vesely SK, George JN, Lammle B et al. "ADAMTS13 activity in thrombotic thrombocytopenic purpurahemolytic uremic syndrome: relation to presenting features and clinical outcomes in a prospective cohort of 142 patients." Blood. 2003;102: Veyradier A, Lavergne JM, Ribba AS et al. "Ten candidate ADAMTS13 mutations in six French families with congenital thrombotic thrombocytopenic purpura (Upshaw-Schulman syndrome)." Journal of Thrombosis and Haemostasis. 2004;2: Mannucci PM, Canciani MT, Forza I et al. "Changes in health and disease of the metalloprotease that cleaves von Willebrand factor." Blood. 2001;98: Feys HB, Liu F, Dong N et al. "ADAMTS-13 plasma level determination uncovers antigen absence in acquired thrombotic thrombocytopenic purpura and ethnic differences." Journal of Thrombosis and Haemostasis. 2006;4: Majerus EM, Anderson PJ, Sadler JE. "Binding of ADAMTS13 to von Willebrand factor." Journal of Biological Chemistry. 2005;280: Child C, Turcotte J. "surgery and portal hypertension." In: Child C, ed. The liver and portal hypertension. Philadelphia: saunders; 1964: Pugh RN, Murray-Lyon IM, Dawson JL, Pietroni MC, Williams R. "Transection of the oesophagus for bleeding oesophageal varices." Br J Surg. 1973;60: Mannucci PM, Parolari A, Canciani MT, Alemanni F, Camera M. "Opposite changes of ADAMTS-13 and von Willebrand factor after cardiac surgery." J Thromb Haemost. 2005;3: Tsai HM. "Physiologic cleavage of von Willebrand factor by a plasma protease is dependent on its conformation and requires calcium ion." Blood. 1996;87: Furlan M, Robles R, Lamie B. "Partial purification and characterization of a protease from human plasma cleaving von Willebrand factor to fragments produced by in vivo proteolysis." Blood. 1996;87: Moake JL, Rudy CK, Troll JH et al. "Unusually large plasma factor VIII:von Willebrand factor multimers in chronic relapsing thrombotic thrombocytopenic purpura." N Engl J Med. 1982;307: APGAR V. "A proposal for a new method of evaluation of the newborn infant." Curr Res Anesth Analg. 1953;32: George JN. "The association of pregnancy with thrombotic thrombocytopenic purpura-hemolytic uremic syndrome." Curr Opin Hematol. 2003;10: Sanchez-Luceros A, Farias CE, Amaral MM et al. "von Willebrand factor-cleaving protease (ADAMTS13) activity in normal non-pregnant women, pregnant and post-delivery women." Thromb Haemost. 2004;92: Vesconi S, Langer M, Rossi E et al. "Thrombotic thrombocytopoenic purpura during oral contraceptive treatment." Thromb Haemost. 1979;40: Holdrinet RS, de Pauw BE, Haanen C. "Hormonal dependent thrombotic thrombocytopenic purpura (TTP)." Scand J Haematol. 1983;30: Baron BW, Jeon HR, Glunz C et al. "First two patients with ulcerative colitis who developed classical thrombotic thrombocytopenic purpura successfully treated with medical therapy and plasma exchange." J Clin Apher. 2002;17: Greenstein AJ, Janowitz HD, Sachar DB. "The extra-intestinal complications of Crohn's disease and ulcerative colitis: a study of 700 patients." Medicine (Baltimore). 1976;55: Zlatanic J, Korelitz BI, Wisch N et al. "Inflammatory bowel disease and immune thrombocytopenic purpura: is there a correlation?" Am J Gastroenterol. 1997;92: Ahmed S, Siddiqui AK, Chandrasekaran V. "Correlation of thrombotic thrombocytopenic purpura disease activity with von Willibrand factor-cleaving protease level in ulcerative colitis." Am J Med. 2004;116: takahashi y, kawaguchi c, hanesaka y, fujimura y, and yoshioka a. Plasma von Willebrand factor-cleaving protease is low in the newborns [abstract]. Thrombosis and Haemostasis. 2001;89:

124 CHAPTER 4: ADAMTS-13 Plasma Antigen Titer Changes in Health and Disease 25 Schmugge M, Dunn MS, Amankwah KS et al. "The activity of the von Willebrand factor cleaving protease ADAMTS-13 in newborn infants." J Thromb Haemost. 2004;2: Tsai HM, Sarode R, Downes KA. "Ultralarge von Willebrand factor multimers and normal ADAMTS13 activity in the umbilical cord blood." Thromb Res. 2002;108: Dong JF, Moake JL, Nolasco L et al. "ADAMTS-13 rapidly cleaves newly secreted ultralarge von Willebrand factor multimers on the endothelial surface under flowing conditions." Blood. 2002;100: Crawley JTB, Lam JK, Rance JB et al. "Proteolytic inactivation of ADAMTS13 by thrombin and plasmin." Blood. 2005;105: Schneider DM, Tempelhoff GFV, Herrle B, Heilmann L. "Maternal and cord blood hemostasis at delivery." Journal of Perinatal Medicine. 1997;25: Reiter RA, Mayr F, Blazicek H et al. "Desmopressin antagonizes the in vitro platelet dysfunction induced by GPIIb/IIIa inhibitors and aspirin." Blood. 2003;102: Bernardo A, Ball C, Nolasco L, Moake JF, Dong JF. "Effects of inflammatory cytokines on the release and cleavage of the endothelial cell-derived ultralarge von Willebrand factor multimers under flow." Blood. 2004;104: Ono T, Mimuro J, Madoiwa S et al. "Severe secondary deficiency of von Willebrand factor-cleaving protease (ADAMTS13) in patients with sepsis-induced disseminated intravascular coagulation: its correlation with development of renal failure." Blood. 2006;107: Uemura M, Tatsumi K, Matsumoto M et al. "Localization of ADAMTS13 to the stellate cells of human liver." Blood. 2005;106: Lisman T, Bongers TN, Adelmeijer J et al. "Elevated levels of von Willebrand Factor in cirrhosis support platelet adhesion despite reduced functional capacity." Hepatology. 2006;44:

125

126

127 CHAPTER 5. IN VITRO STUDY OF THE NOVEL R1095W ADAMTS-13 MUTATION Hendrik B Feys 1*, Fang Liu 2*, Ningzheng Dong 2, Nele Vandeputte 1, Stephan Vauterin 1, Hans Deckmyn 1, Karen Vanhoorelbeke 1, Changgeng Ruan 2 * Contributed equally 1 Laboratory for Thrombosis Research, KU Leuven Campus Kortrijk, Kortrijk, Belgium 2 JiangSu Institute of Hematology, First affiliated Hospital of Soochow University, Suzhou, P.R. China

128 CHAPTER 5: In vitro characterization of a novel ADAMTS-13 mutation 5.1 ABSTRACT Upshaw-Schulman syndrome (USS) is the congenital form of thrombotic thrombocytopenic purpura (TTP) and is caused by homozygous or compound heterozygous mutations in the ADAMTS-13 gene. A Chinese USS patient was genotyped and a novel missense mutation in the eighth thrombospondin-1 repeat (R1095W) was identified on both alleles. Further upstream and also present on both alleles, another missense mutation (S903L) was identified, though previously reported as a single nucleotide polymorphism in the Japanese population. R1095W was cloned in an expression vector and transfected in a heterologous cell line. In vitro secretion of R1095W radamts-13 was completely blocked as no protein could be detected in the cell medium using western blot and immunosorbent techniques. Accordingly, using an urea-based activity assay, no activity towards VWF could be detected in the R1095W expression medium. On the other hand, the mutant protein was detected in the cell cytoplasm by western blot and immunofluorescent staining. The TTP phenotype of this USS patient can hence be definitely attributed to the R1095W single point mutation on both alleles.

129 CHAPTER 5: In vitro characterization of a novel ADAMTS-13 mutation 5.2 INTRODUCTION During hemostasis, circulating multimeric von Willebrand factor (VWF) binds to the exposed deeper layers of subendothelial collagen, thereby providing a matrix for platelets to adhere on. Efficiency of this process is very much depending on the availability of large VWF multimers, as exemplified by von Willebrand s disease type 2 in which high molecular weight multimers are absent, causing a bleeding phenotype as a consequence of impaired collagen-vwf-platelet interactions 1. On the other side of the spectrum, as mentioned in the introduction, unusually large VWF multimers (UL-VWF) may cause spontaneous platelet agglutination, probably even in the absence of vessel injury, leading to thrombotic thrombocytopenic purpura (TTP), a life-threatening but rare disorder. Both a familial (congenital) and an acquired form have been described, the latter being much more abundant 2. Mutations in the gene of ADAMTS-13 may lead to new insights in the molecular mechanism of VWF proteolysis. Since the discovery of ADAMTS-13, around sixty mutations, including missense, splice-site and frameshift, have been reported to be causative for Upshaw-Schulman syndrome (USS), the congenital form of TTP (most recent review 3 ). All reported mutations are evenly spread in the ADAMTS-13 amino acid sequence with no clear delineation of a hot-spot area, indicating a substantial contribution of each domain in ADAMTS- 13 function. On the other hand, several in vitro studies with truncated mutants, using both static and dynamic assays, showed that the C-terminal portion of ADAMTS-13, where many known TTP-causing mutations reside, may not be essential for VWF proteolysis 4,5. This apparent contradiction may be explained by the molecular effect that most of the investigated mutations bring about; in vitro expression studies in heterologous cell cultures showed hampered exocytosis of most mutant ADAMTS-13 forms and in many cases protein release was even completely blocked 6-8. Hypothetically, missense mutations, especially when residing C-terminally, might well have resulted in (semi-)active protein if expression wasn t countered. We describe an USS patient who was shown to be homozygous for a mutation at amino acid position 1095, but also for a previously described polymorphism at position 903. We previously analyzed plasma samples (prior to infusion therapy) of the patient for the presence of ADAMTS-13 antigen but none was found 9. Genotyped family members carrying the diseased allele had exactly half the levels of family members carrying two wild-type alleles. The effect of the mutation at position 1095 was studied in vitro in view of its role in the patient s phenotype. 129

130 CHAPTER 5: In vitro characterization of a novel ADAMTS-13 mutation 5.3 MATERIALS AND METHODS Genotyping Genomic DNA was extracted from whole blood using a commercial extraction kit (Qiagen, Venlo, The Netherlands). This DNA was used to perform polymerase chain reactions (PCR) with primer couples which hybridize so to amplify all ADAMTS-13 exon(s) and exon-intron boundaries. Primer couples were as mentioned previously 10 and PCR reactions were adjusted slightly, changing MgCl 2 concentrations and/or annealing temperatures to reveal optimal yields Mutagenesis The point mutation was introduced separately in the inducible expression plasmid that is used for expression of wild-type ADAMTS-13 as mentioned previously 9. The QuickChange XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) was used according to the instructions of the manufacturer. The wild-type base-pair at position 1095 was successfully substituted using the following primer couple; (5 - GGATGGCATCCAGCGCTGGCGTGACACCTG-3 & 5 -CAGGTGTCACGCCAGCGCTGGATGCCATCC-3 ), and 50 ng of wild-type DNA template [mutated residues are highlighted]. The complete insert of the mutant expression plasmid was sequenced (Genomex, Grenoble, France) and showed no other mutations than the one of interest Expression of ADAMTS-13 variants The mutant expression plasmid was stably transfected in GeneSwitch TM Chinese Hamster Ovary (CHO) cells using lipofectamine TM 2000 transfection reagent as described in chapter 2. Cells having incorporated the mutant plasmid were selected in DMEM:F-12 medium supplemented with 10% Foetal Bovine Serum and 500 µg ml -1 Zeocin TM and 250 µg ml -1 Hygromycin B. Positive cells were grown to confluency and expression was subsequently induced using 100 nmol L -1 mifepristone, steroid inductor. Medium was harvested three days later and cells were discarded, unless these were used for cell lysate analysis (All reagents, cells, media and supplements were from Invitrogen Corp., Carlsbad, CA, USA) Activity measurements ADAMTS-13 activity was assessed in the assay according to Gerritsen et al 11. In brief, a mixture of VWF/FVIII concentrate (Red Cross, Belgium) at a VWF concentration of 30 µg ml -1, 10 mmol L -1 BaCl 2 and radamts-13 (or plasma) is dialyzed against digestion buffer (50 mmol L -1 Tris, 1.0 mol L -1 urea, ph 8.0) at 37 C for 24h. The digestion reaction is quenched with 10 mmol L -1 ethylene diamine tetraacetic acid (EDTA). All reactions are performed in the presence of 2 mmol L -1 Pefabloc SC (Roche, Mannheim, Germany). Residual VWF multimer length is analyzed in VWF collagen binding assay (VWF:CBA) using human collagen type III (Sigma type X) as immobilized protein. In parallel, a VWF antigen (VWF:Ag) measurement 130

131 CHAPTER 5: In vitro characterization of a novel ADAMTS-13 mutation is performed so to correct for concentration effects potentially biasing VWF:CBA data. Mixtures containing EDTA on beforehand were used as negative controls Antigen measurements ADAMTS-13 antigen levels were measured as mentioned previously with minor adjustments. In brief, monoclonal antibody 20A5 is coated to a microtiter plate at 5 µg ml -1. After blocking, plasma or medium samples are diluted in dilution buffer (PBS % (m/v) skimmed milk) and incubated at 37 C for 1h. Bound ADAMTS-13 is detected using a mixture of biotinylated monoclonal anti-adamts-13 antibodies (at 6.7 nmol L -1 in dilution buffer) and peroxidase labeled streptavidin (at 1/15,000 in dilution buffer)(roche). Colorimetric development was with o-phenylenediamine dihydrochloride (OPD) (Sigma, Saint Louis, MO) in 50 mmol L -1 phosphate-citrate buffer supplemented with 0.03% (m/v) H 2 O 2, ph 5.0, for 15 min. Reactions were stopped in 1.0 mol L -1 sulfuric acid, and the absorbance at 490 nm was determined using an automated ELISA reader. In between steps, at least three washes with PBS + 0.1% (v/v) Tween20 were performed Western blotting All samples and/or cells were dissolved in sample buffer (0.35 mol L -1 Tris, 8% (m/v) SDS, 40% (v/v) glycerol) and incubated at 100 C for 5 minutes. Cell debris was removed by short run centrifugation at 2,000 g. Samples were separated on a 7.5% SDS polyacrylamide gel and western blotted onto nitrocellulose (Schleier & Schuell, Dassel, Germany). Blots were blocked in PBS + 3% (m/v) skimmed milk overnight at 4 C. Next they were incubated with peroxidase labeled anti-v5 antibody at 1/5,000 (Invitrogen) in PBS + 0.3% (m/v) skimmed milk for 1h on a rocker at room temperature. After washing, biotinylated antibodies were detected with peroxidase labeled streptavidin (Roche) at 1/15,000 in PBS + 0.3% (m/v) skimmed milk for 1h on a rocker at room temperature. Detection was with the enhanced chemiluminescence kit (ECL), following the instructions of the provider (GE Healthcare, Waukesha, WI) Immunofluorescent staining Cells were grown to confluency on lab-tek (Nunc, Rochester, NY, USA) chamber slides, and these were treated as mentioned above to express the recombinant protein. Next, cells were rinsed with PBS, fixed with 4% paraformaldehyde and, when required, permeabilized using 0.1% Triton-X-100. Fixed cells were blocked for 30 minutes at room temperature in blocking solution (PBS supplemented with 3% BSA (Sigma, St. Louis, MO) and 1% rabbit serum). Next, cells were incubated with primary murine antibody anti-v5 (Invitrogen) diluted 1/5,000 in blocking solution for 1 hour at 37 C. Cells were washed 10 times with PBS supplemented with 3% BSA and 0.1% Tween 20 (Acros, Geel, Belgium) and bound primary antibody was detected by 1h incubation with secondary fluoresceine thiocyanate (FITC) conjugated rabbit anti-mouse immunoglobulins (Jackson Immunoresearch, Soham Cambridgeshire, United Kingdom) at a 1/100 dilution in blocking buffer. Finally, cells were rinsed 10 times with PBS, supplemented with 3% BSA and 0.1% Tween 20 and two times with unsupplemented PBS and mounted with Prolong Gold Antifade reagent with 4'-6-Diamidino-2-131

132 CHAPTER 5: In vitro characterization of a novel ADAMTS-13 mutation phenylindole (DAPI) (Molecular Probes, Eugene, OR). Stained preparations were analysed with a Nikon Eclipse TE200 fluorescence microscope connected to an Image Analyser (Lucia, Laboratory Imaging Ltd., Analis, Namur, Belgium) using standard FITC and DAPI excitation/emission filter combinations. Overlayed pictures were created using Photoshop 7.0 (Adobe, San José, CA). Magnifications are indicated in Figure legends. 132

133 CHAPTER 5: In vitro characterization of a novel ADAMTS-13 mutation 5.4 RESULTS Genotyping reveals the presence of a novel mutation and a polymorphism Genomic DNA was used for sequencing of all 29 ADAMTS-13 exons. In exon 25, a thymidine for cytidine substitution was found, resulting in the substitution of an arginine for a tryptophane at position 1095 (R1095W) in the ADAMTS-13 protein sequence (counting starts from the initial methionine residue). Exon 21 also contained a thymidine for cytidine substitution, this time resulting in a missense codon of leucine for the wild-type serine at position 903 (S903L) in the TS repeat 5. This has previously been reported by Shibagaki et al to be a single nucleotide polymorphism (SNP) with an allele frequency of 5.5%, as assessed in 64 healthy Japanese individuals 12. This group has not performed in vitro analysis of the polymorphism. R1095W and the S903L were found on both alleles, suggesting that the proband s parents are related. Moreover, the ADAMTS-13 genes of several family members 9 could be analyzed and only the propositus was found homozygous for these mutations, confirming the recessive nature of inherited TTP In vitro study on R1095W Expression yield Recombinant expression of R1095W revealed hampered protein release, as no recombinant protein could be detected in the expression medium using western blot analysis (Figure 35), whereas cell lysate did contain mutant ADAMTS-13, indicating that the mutant protein is retained within the cell. Figure 35: Western blot of expression media and cell lysates of R1095W and wild-type ADAMTS-13 from stably transfected CHO cells. Blotted protein was detected with a mixture of two biotinylated monoclonal anti-adamts-13 antibodies and peroxidase labeled streptavidin. Secondary streptavidin alone didn t luminescence. WT = wild-type; M = mock medium. Cell lysate was prepared by lysing the cells in SDS- PAGE sample buffer. All samples were boiled and centrifuged prior to electrophoresis. 133

134 CHAPTER 5: In vitro characterization of a novel ADAMTS-13 mutation Concentrations of all radamts-13 forms in expression media were determined using our previously developed ADAMTS-13 antigen assay. The medium of R1095W radamts-13 gave no signal and hence, if present, the concentration would be lower than the average detection limit of the exerted assays of 40 ± 5 ng per 10 6 cells (Figure 36). Wild-type levels were in the normal range (225 ± 23 ng per 10 6 cells). Figure 36: Measurement of expression yields. R1095W (RW) and wild-type (WT) radamts-13 were expressed in an inducible expression system. Expression yields were determined using the antigen ELISA, as described previously by our group. The detection limit was 40 ± 5 ng per 10 6 cells on average and used as baseline Determination of specific VWF cleaving activity Using the assay of Gerritsen et al 11, activity in the expression medium was determined. Since no known antigen of R1095W radamts-13, could be detected, the maximal possible amount of expression medium of these cell lines was added to the substrate. The activity assay is very sensitive and trace amounts of VWF cleaving activity should be picked up, if present. For wild-type and normal human pooled plasma (NHP, n = 20), 10 ng of recombinant protein was added. This amount corresponds to what is commonly used 13 in reference mixtures to determine 50% of normal activity and therefore it can be interpreted as an EC 50. No VWF cleaving activity was found in the R1095W medium (Figure 37). There was background activity present in the expression medium, most probably from traces of bovine ADAMTS-13 or other randomly cleaving proteases that could be inactivated by EDTA. 134

135 CHAPTER 5: In vitro characterization of a novel ADAMTS-13 mutation Figure 37: Activity determination of R1095W versus wild-type radamts-13 and NHP. (black bars) 10 ng of recombinant wild-type ADAMTS-13 (WT) and normal pooled human plasma (NHP) was used to digest 12 µg of purified VWF using the assay according to Gerritsen et al 11. Since no R1095W radamts-13 (RW) could be detected in the expression medium, a maximal amount of expression medium was added to the reaction tube, therefore only a relative activity could be measured. (white bars) 10 mmol L -1 EDTA was added prior to the reaction resulting in complete inhibition of cleavage in all assays employing expression medium. The ratio of VWF:CBA and VWF:AG parameters is depicted in the ordinate. Results are the mean of at least three independent assays and error bars indicate the standard deviation Immunofluorescent staining ADAMTS-13 expressing CHO cells were permeabilized and immunostained for recombinant wild-type and R1095W radamts-13. No clear-cut empirical differences between these two forms were observed using regular fluorescence microscopy at 1000 x magnification (Figure 38). All controls using solely secondary antibody were negative for FITC staining. No ADAMTS-13 was detected on the cell surface, when cells were not permeabilized. When the cells were not induced, no intracellular nor extracellular recombinant protein could be detected. The mutant protein is hence not secreted in the medium but completely retained within the cell cytoplasm. Figure 38: Intracellular immunofluorescent staining of radamts-13. Wild-type (WT) and R1095W cells were permeabilized and stained using anti-v5 and secondary FITC labeled antibodies. Cell nuclei were stained with DAPI. Analysis was performed at 1000 x magnification. Control cells (CTR) were incubated with secondary FITC labeled antibody alone and the depicted result is representative for all cells on the slide. 135