Nodeotlde sequence of tht tmr locus of Agmbacterium tumefaciens pti T37 T-DNA

Transcription

1 Volume 12 Number Nucleic Acids Research Nodeotlde sequence of tht tmr locus of Agmbacterium tumefaciens pti T37 T-DNA S.B.GoMberg, J.S.Flkk and S.G.Rogers* Monsanto Company, 800 North Lindbergh Boulevard, Saint Louis, MO 63167, USA Received 5 March 1984; Revised and Accepted 16 May 1984 ABSTRACT The nucleotide sequence of the tmr locus from the nopaline-type pti T37 plasmid of Agrobacterium tumefaciens was determined. Examination of this sequence allowed us to identify an open reading frame of 720 nucleotides capable of encoding a protein with a derived molecular weight of d. Comparison of the pti T37 tmr sequence with the published sequence of the pti Ach5 tmr locus shows over 88% homology in the 240 bases 5' to the translational initiation codon and over 91% homology in the coding sequences. The 3 1 nontranslated regions show less than 50% homology as expected for the 3' regions of divergent related genes. The possible significance of areas of conserved sequences, particularly in the 5' regulatory regions, is discussed. INTRODUCTION AgrobfLCterium tumefaciens causes crown gall disease by transfer of a DNA segment from its large resident Ti plasmid into the plant cell where this DNA is covalently integrated into the genome (1-5). Expression of certain genes located on the transferred DNA (T-DNA) results in in situ neoplastic growth or phytohormone-independent growth of the infected tissue when placed into culture (6-7). Recent results implicate certain specific T-DNA encoded genetic and transcriptional units, the tms and tmr loci, as the units of expression responsible for the hormone-independent growth (8-12). Specifically, expression of the tins locus results in elevated auxin (indole acetic acid) levels in Ti transformed cells while expression of the tor locus elicits increased levels of cytokinins (13) in tumor tissues relative to non-transformed tissues. Mutations at these loci have specific effects on the morphology of the tumors induced by the mutant Ti plasmid (8). Tumors induced by a strain with an inactivated tans (tumor morphology shooty) locus show large numbers of shoots appearing on the tumor tissue. Tumors induced by a strain with an inactivated tmr (tumor morphology rooty) locus display excessive root development. The phenotype of the tumor induced by strains carrying mutations at these O IRL Pren Limited, Oxford, England. 4665

2 loci can be reverted to normal crown gall callus by supplying exogenous phytohormones. Added cytokinins reverse the effect of the tmr mutation; added auxins reverse the effect of the tas mutation on the morphology of normal cultured tumor tissue (14). From these results, it is evident that the products of the tins and tmr loci are involved in the regulation of phytohormone levels in the tumor tissue. As a first step to defining and better understanding the functions of these genes, we have determined the nucleotide sequence of the tar locus from the nopaline-type pti T37 plasmid. During the preparation of this manuscript, the nucleotide sequence for the tmr locus of an octopine-type pti Ach5 plasmid was published by Heidetamp et al. (15). The tmr locus resides in the DNA region common to both nopaline and octopine type Ti plasmids as determined by DNA heteroduplex analysis, genetic and transcript mapping (16,10-12). The availability of the DNA sequences of both tmr loci provides a unique opportunity to examine two functionally related genes for the extent of similarity or variation in their regulatory and structural regions. Such a comparison permits insight into the importance of various DNA sequences within the common regulatory regions and particular amino acids in the protein encoding regions. In this report we describe the nucleotide sequence of the pti T37 tmr locus and compare this sequence with that of the previously reported pti Ach5 homologue. MATERIALS AND METHODS Bacteria and bacteriophage The Escherichia coli recipient for plasmid transformation was strain LE392:F", hsd«514(rk", mk + ), awtbl (17). The host for M13 phage cloning and growth was JM101 (18). M13 mp8 and mp9 were obtained from BKL (Gaithersburg, MD.) All restriction endonucleases were purchased from New England Biolabs (Beverly, MA) and used according to the manufacturers instructions. See Roberts (19) for specificity. Bacteriophage T4 DNA ligase was prepared using a modification of the procedure of Murray et al. (20). Plasmid and phage DNA reconstructions Cleavage of DNAs, ligations, and transformations were performed as described by Taylor et al. (23) for plasmids and as described by Messing ot al. (18) for M

3 DNA preparation and sequencing Plasmid DNA was prepared as described by Davis et aj. (21). M13 DNA was prepared by the procedure of Messing et al. (18) and used as template for the dideoxynucleotide chain termination method described by Anderson (22). Analysis and assembly of the DNA sequence data was performed using programs obtained from IntelliGenetics (Palo Alto, CA). RESULTS Cloning of the tar locus The tar locus was first isolated on the 3.8 kb HindIII-22 fragment prepared by digestion of the nos::tn7 derivative of pti T37, pgv3106 (24). This fragment was inserted into the Hindlll site of pbr327 (25) to yield pmon69. Restriction mapping showed that the inserted fragment was indeed HindIII-22 by comparison of the internal BamHI cleavage sites with published restriction cleavage site maps of the pti T37 plasmid (11-12,26). Transcript mapping carried out by both Bevan and Chilton (12) and Willmitzer et al. (11) had g 8 I 1 1 i i i 8 8 P I I S 3 I?! 1 U Figure 1. Restriction endonuclease cleavage map of the pti T37 HindIII-22 fragment and tar locus containing 2 kb BamHI to HindiII subfragment. The major restriction endonuclease cleavage sites are shown for the BamHI-Hindlll subfragment. The arrows beneath the map show the independent clones of various subfragments, jj, and the number of times each was used for sequence determinations ( ). The length of the arrow shows the approximate extent of the sequence data obtained. Continuous sequence through all junctions showed that no small fragments were lost during subcloning. 4667

4 identified the tar transcript as a 1200 bp mluja that mapped entirely within the 2.0 kb BamHI to Hindlll segment from the right side of fragment Hindlll- 22 (Fig. 1). This 2.0 kb B«mHI-HindIII fragment was isolated from pmon69 and inserted into similarly cleaved pbr327 to yield pmon99. The 2.0 kb insert was mapped by cleavage with various restriction endonucleases to provide the detailed map in Fig. 1. The presence of the unique Hpal site at approximately nucleotide 1350 served to locate the active portion of the pti T37 tmr gene since insertion of DNA fragments encoding antibiotic resistance at this site results in the tmr phenotype and inactivates the gene (27-28). Nucleotide sequence determination of the tar locus The resulting restriction map (Fig. 1) provided a large number of cleavage sites all of which were used, alone or in combinations, to obtain sub- 1 GGATCCTGTT ACAAGTATTG CACGTTTTAT AAATTCCATA TTAATGCMT CTTGATTTTC 61 AACAACGAAG CTAATGCCCT AAAAGAAAAA ATGTATGTTA TTCTATTGAT CTTTCATGAT 121 CTTGAAGCGT GCCATAATAT GATGATCTAT AATTAAAATA TTAACTGTCG CATTTTATTG 181 AAATGGCACT GTTATTTCAA CCATATCTTT GATTCTGTTA CATGACACGA CTGCAAGAAG 241 TAAATAATAG ACGCCGTTGT TAAAGAATTG CTATCATATG TGCCTAACTA GAGGGAATTT 301 GAGCGTCAGA CCTMTCAAA TATTACAAAA TATCTCACTC TGTCGCCAGC AATGGTGTM 361 TCAGCGCAGA CAAATGGCCT AAAGATCGCG GAAAAACCTC CCCGAGTGGC ATGATAGCTG 421 CCTCTGTATT GCTGATTTAG TCAGCCTTAT TTGACTTAAG GGTGCCCTCG TTAGTGACAA 4*1 ATTGCnTCA AGGAGACAGC CATGCCCCAC ACTTTGTTGA AAAACAAATT GCCTTTGGC; 541 AGACGGTAAA GCCAGTTGCT CTTCAATAAG GAATCTCGAG GAGGCAATAT AACCGCCTCT 601 GCTACTACAC TTCTCTAATC CAAAAATCAA TTTGTATTCA AGATACCGCA AAAAACTT 659 ATG GAT CTG CGT CTA ATT TTC GCT CCA ACT TGC ACA GGA AAG ACG TCG MET Asp Leu Arg Leu He Phe Gly Pro Thr Cya Thr Gly Lyi Thr Ser 707 ACC GCG GTA GCT CTT GCC CAG CAG ACT GGG CTT CCA GTC CTT TCG CTC Thr Ala V.I Ala Leu Ala Gin Gin Thr Gly Leu Pro Val Leu Ser Leu 755 GAT CGG GTC CAA TGT TGT CCT CAG CTG TCA ACC GGA AGC GGA CGA CCA Aap Arg Val Gin Cya Cya Pro Gin Leu Ser Thr Gly Ser Gly Arg Pro 803 ACA GTC GAA GAA CTG AAA CGA ACG AGC CGT CTA TAC CTT GAT GAT CGG Thr Val Glu Glu Leu Lya Gly Thr Ser Arg Leu Tyr Leu Aap Alp Arg 851 CCT CTG GTG AAG GGT ATC ATC GCA GCC AAG CAA GCT CAT GAA AGG CTG Pro Leu Val Lya Gly lie lie Ala Ala Lya Gin Ala Hii Glu Arg Leu 899 ATG GGG GAG GTG TAT AAT TAT GAG GCC CAC GGC GGG CTT ATT CTT GAG MET Gly Glu Val Tyr Aan Tyr Glu Ala Uia Gly Gly Leu lie Leu Glu 947 GGA GGA TCT ATC TCG TTG CTC AAG TGC ATG GCG CAA AGC ACT TAT TGG Gly Gly Ser He Ser Leu Leu Lya Cya KET Ala Gin Ser Ser Tyr Trp 99S ACT GCG GAT TTT CGT TGG CAT ATT ATT CGC CAC GAG TTA GCA GAC GAA Ser Ala Asp Phe Arg Trp His He He Arg Hla Glu Leu Ala Aap Glu 1043 GAC ACC TTC ATC AAC GTG GCC AAG GCC AGA CTT AAG CAG ATG TTA CGC Glu Thr Phe MET Aan Val Ala Lys Ala Arg Val Lya Gin KET Leu Arg 4668

5 1091 CCT GCT GCA GGC CTT TCT ATT ATC CAA GAC TTG GTT GAT CTT TGG AAA Pro Ala Al> Gly Leu Ser lie lie Gin Glu Leu Val Asp Leu Trp Lys 1139 GAG CCT CCG CTG ACC CCC ATA CTG AAA GAG ATC GAT GGA TAT CGA TAT Glu Pro Arg Leu Arg Pro lie Leu Lys Glu lie Asp Gly Tyr Arg Tyr 1187 GCC ATG TTG TTT GCT AGC CAG AAC CAG ATC ACA TCC GAT ATG CTA TTG Ala MET Leu Phe Ala Ser Gin Am Gin He Thr Ser Aap MET Leu Leu 1235 CAG CTT GAC GCA GAT ATG GAG GAT AAG TTG ATT CAT GGG ATC GCT CAG Gin Leu Aip Ala Asp HET Glu Asp Lys Leu He His Gly lie Ala Gin 1283 GAG TAT CTC ATC CAT GCA CGC CGA CAA GAA CAG AAA TTC CCT CGA GTT Glu Tyr Leu He His Ala Arg Arg Gin Glu Gin Lys Phe Pro Arg Vsl 1331 AAC GCA GCC GCT TAC GAC GGA TTC GAA GGT CAT CCA TTC GGA ATG TAT Asn Ala Ala Ala Tyr Asp Gly Phe Glu Gly His Pro Phe Gly MET Tyr 1379 TAG TTTGCACCAG CTCCGCGTCA CACCTGTCTT CATTTGAATA AGATGTTCGC 1432 AATTGTTTTT AGCTTTGTCT TGTTGTGGCA GGGCGGCAAG TGCTTCAGAC ATCATTCTGT H92 TTTCAAATTT TATGCTGGAG AACAGCTTCT TAATTCCTTT GGAAATAATA GACTGCGTCT 1552 TAAAATTCAG ATGTCTGGAT ATAGATATGA TTGTAAAATA ACCTATTTAA GTGTCATTTA 1612 GAACATAAGT TTTATGAATG TTCTTCCATT TTCGTCATCG AACGAATAAG AGTAAATACA 1672 CCTTTTTTAA CATTATAAAT AAGTTCTTAT ACGTTGTTTA TACACCGGGA ATCATTTCCA 1732 TTATTTTCGC GCAAAAGTCA CGGATATTCG TGAAAGCGAC AAAAACTGCG AAATTTGCGG 1792 GGAGTGTCTT CAGTTTGCCT ATTAATATTT AGTTTGACAC TAATTGTTAC CATTGCAGCC 1852 AAGCTCAGCT GIHUIHC TTAAAAACGC AGGATCGAAA GAGCATGACT CGGCAAGGTT 1912 GGCTTGTACC ATGCCTTTCT CATGGCAAAG ATGATCAACT GCAGGATGAA CTCTCGGAGC 1972 TTTCAAAAGC TT Figure 2. Nucleotide sequence of the 2 kb Baniil-Hindlll pti T37 tmr locus containing fragment. The 720 bp open reading frame and derived amino acid sequence begins at nucleotide 659 with an ATG translation initiator and ends at nucleotide 1378 adjacent to a TAG translational terminator. fragments that were cloned into M13 mp8 or mp9 for subsequent di-deoxy sequencing. The strategy for the subcloning and sequencing appears in Fig. 1. No difficulty was encountered in obtaining clones of any of the subfragments nor in their sequencing. The final nucleotide sequence appears in Fig. 2. The total sequence extending from the beginning of the BanMl recognition sequence to the end of the Hindlll recognition sequence comprises 1983 nucleotides. An open reading frame of 720 nucleotides sufficient to encode a protein of derived molecular weight d was found. Significantly, this open reading frame includes the Hpal cleavage site, preceding nucleotide 1331, where insertions of foreign DNAs result in inactivation of the pti T37 tmr locus (27-28). This coding sequence starts with an ATG initiator codon beginning at nucleotide 659 and ends at nucleotide 1378 which is adjacent to a TAG translational 4669

6 419 TCCCTCTGTA TTGCTGATTT ACTCAGCCTT ATTTCACTTA AGGCTGCCCT CCTTAGTCAC 450 TTCCTCTGCA TTGCCAATTT ATTCAGCTTT ATTTCACTTA GGTGTGCCTT CGTTAGCGAC 479 AAATTCCTTT CAAGGAGACA GCCATCCCCC ACACTTTGTT GAAAAACAAA TTGCCTTTGG 510 AAATTCCTTT CAAGGAGACA GCCATCCCCC ACACTTTGTT GAAAAACAAC TTGCCTTTTG 539 GGAGACGGTAAAGCCAGTTG CTCTTCAATA AGCAATCTCC AGCAGGCAAJ ATAACCOCCT 570 GCATAC^GTA AACC({AGTTG CACTTCAATA ATGAATTTCA AGCAGACAAfr ATAACCGCCT 599 CTGCTAGTAC ACTTCTCTAA TCCAAAAATC AATTTGTATT CAAGATACCC CAAAAAACTT ATG 630 CTGATAACAC AATTCTCTAA frataaaaatc ACTTTGTATT CAATATACTC CAAAAAACTT ATG Figure 3. Comparison of the 5' nontranslated regions of the tmr loci from the T37 (upper lines) and Ach5 (lower lines) Ti plasmids. The underscored nucleotides are those in the Ach5 sequence that differ from the T37 sequence. The enclosed nucleotides are regions of potential importance in RNA polymerase 11 binding and transcription initiation. termination codon. The derived size for the proposed tmr protein is in agreeoent with the bacterial expression and hybrid-selected translation data of Schroder and his co-workers (29-30) and with the derived octopine tar protein size of d. reported by Heidekamp et ai. (15). Further similarities to the octopine tar protein will be discussed in the comparison of the coding sequences below. Examination of the DNA sequences immediately preceding the coding sequence reveal the features expected for an RNA polymerase II recognition and transcription initiation region. These include a 5'-TATAA- sequence beginning at nucleotide 588. This canonical "TATA box" is preceded at nucleotide 545 by the sequence S'-GGTAAAG- which was also identified by Heidekamp et aj. (15), bears some resemblance to the canonical "CAAT box" (5'-GGC/TCAATCT-) described for non-plant eucaryotic RNA polymerase II recognition regions (31). Based upon our current understanding of plant gene regulatory elements (38), it is possible that plant gene promoters do not contain this feature. Although we have not performed SI digestion analysis to precisely locate the 5' end of the transcript, the similarity of the signals just described for the pti T37 tor gene and those of the pti Ach5 tmr gene discussed below suggest strongly that these signals are indeed those recognized during transcription of the pti T37 tmr gene in transformed plant cells. 4670

7 Comparison of the nucleotide sequences of the pti T37 tmr and pti Ach5 tmr loci The 5' regions The sequences of the 240 nucleotides preceding the ATG initiator codon of both the pti T37 and pti Ach5 tmr genes show greater than 88% homology (Fig. 3). Interestingly, the region with the greatest continuous conserved sequence falls between bases 477 and 526 which are approximately 130 to 180 nucleotides 5' to the ATG initiation codon. Whether this has significance with respect to promoter function will await deletion or site-directed mutagenesis analysis of these sequences. Of the 27 base changes that occur in this 240 nucleotide segment, most (17 of 27) are transitions which preserve a purine or pyrimidine, respectively, at the site of the change. Of the transversions that have occurred, most of these have been of the G+T type when comparing the pti T37 to the pti Ach5 sequence. Without quantitative comparison of transcription levels from the two tmr loci, it is not possible to assess the overall effects of these base changes on relative promoter strength. Heidekamp at ai. found two mrnas from the pti Ach5 tmr locus: a minor, "long start" transcript (5' end:nucleotides , Ach5; nucleotides , T37) and a major, "short start" transcript (5' end:nucleotides , Ach5; nucleotides , T37). Each of these starts is preceded by a canonical "TATA box" approximately 30 nucleotides upstream. Significantly, the "TATA box" (5'-TATAAA) for the "short" transcript has been mutated at nucleotides 620 and 621 of the pti T37 sequence to become 5'-TCCAAA presumably eliminating this transcript of the ptit37 tmr Iocu6. As mentioned previously, we have not mapped the transcription start of the pti T37 tmr RNA and cannot say for certain that the T37 gene will show only one mrna equivalent to the longer of the two transcripts described for the Ach5 tmr gene. Certainly that would be the prediction based on studies which demonstrate the importance of the "TATA box" in positioning the start point for transcription of other eucaryotic genes (31). The answer to this question awaits further experimental analysis. If only the "long start" is used during pti T37 tmr transcription, then the transcription start should lie between nucleotides 615 and 620 of the T37 sequence as shown by Heidekamp and co-workers (15) for Ach5. This means that 5 out of the 27 changes have occurred in the 5' nontranslated leader (nucleotides ) of the tmr gene and confirms the variability seen in the 5' nontranslated sequences of other plant gene transcripts of different 4671

8 659 ATC CAT CTG CCT CTA ATT TTC CGT CCA ACT TCC ACA CCA AAC ACG TCC MET Aap Leu Arg Leu He Pbe Cly Pro Thr Cya Thr Gly Lyi Thr Ser C A A Asp Hia Thr 707 ACC CCC CTA CCT CTT CCC CAC CAC ACT GGG CTT CCA GTC CTT TCC CTC Thr Ala Val Ala Leu Ala Gin Gin Thr Cly Leu Pro Val Leu Ser Leu A A T lie Thr Leu 755 GAT CCG GTC CAA TGT TGT CCT CAG CTC TCA ACC CCA ACC GGA CCA CCA Aap Arg Val Gin Cya Cye Pro Gin Leu Ser Thr Gly Ser Gly Arg Pro C A A Cya Gin Leu 803 ACA CTG GAA GAA CTG AAA GGA ACG ACC CGT CTA TAC CTT GAT GAT CGG Thr Val Glu Glu Leu Lya Gly Thr Ser Arg Leu Tyr Leu Ajp Aap Arg C Leu 851 CCT CTG GTG AAG GCT ATC ATC CCA CCC AAG CAA GCT CAT GAA AGG CTG Pro Leu Val Lya Cly lie Ha Ala Ala Lya Gin Ala Eia Clu Arg Leu G C T Glu Hia 899 ATG GGG GAG GTG TAT AAT TAT GAG CCC CAC GGC GGG CTT ATT CTT GAG MET Gly Glu Val Tyr Aan Tyr Clu Ala Hla Gly Gly Leu He Leu Glu C A C A lie Glu Uia Aan 947 GGA GCA TCT ATC TCG TTC CTC AAG TGC ATG GCG CAA ACC ACT TAT TGG Gly Cly Ser He Ser Leu Leu Lye Cya MET Ala Gin Ser S«r Tyr Trp C C C G A C Ser Thr Aan Arg Aan Ser 995 ACT GCG GAT TTT CGT TGG CAT ATT ATT CGC CAC GAG TTA GCA GAC GAA Ser Ala Aap Phe Arg Trp Hia lie He Arg Bla Glu Leu Ala Aap Glu A A C C C Ala Lya Pro Gin 1043 GAC ACC TTC ATG AAC GTG GCC AAG GCC AGA GTT AAC CAG ATG TTA CGC Glu Thr Phe HET Aan Val Ala Lya Ala Arg Val Lya Gin MET Leu Arg AC G A Lya.Ala Leu Hla 1091 CCT GCT GCA GGC CTT TCT ATT ATC CAA GAG TTG GTT GAT CTT TGG AAA Pro Ala Ala Gly Leu Ser He He Gin Glu Leu Val Aap Leu Trp Lya C A T T T Pro Hia He Tyr Aan 1139 GAC CCT CCG CTG AGO CCC ATA CTG AAA GAG ATC GAT GGA TAT CGA TAT Glu Pro Arg Leu Arg Pro He Leu Lya Glu He Asp Gly Tyr Arg Tyr A T Glu He 1187 GCC ATG TTC TTT CCT AGC CAC AAC CAG ATC ACA TCC GAT ATG CTA TTG Ala MET Leu Phe Ala Ser Gin Aan Gin He Thr Ser Aap MET Leu Leu GGA Thr Ala 1235 CAG CTT GAC GCA GAT ATG GAG GAT AAG TTC ATT CAT GGG ATC CCT CAG Gin Leu Aap Ala Aap HET Glu Aap Lya Leu He Hia Gly He Ala Gin A AC A Aan Glu Gly Aan 1283 GAG TAT CTC ATC CAT GCA CCC CGA CAA GAA CAG AAA TTC CCT CGA CTT Glu Tyr Leu He Hia Ala Arg Arg Gin Glu Gin Lya Phe Pro Arg Val T G A G C A Phe Ala GID Gin Pro Gin 1331 AAC GCA GCC GCT TAC GAC GGA TTC GAA GCT CAT CCA TTC GCA ATG TAT TAG Aan Ala Ala Ala Tyr Aap Gly Phe Glu Gly Hia Pro Phe Cly MET Tyr. T G Pha Pro Figure 4. Comparison of the nucleotide and derived anino acids sequences of the tmr~loci from the T37 (upper lines) and Ach5 (lower lines) Ti plasmids. 4872

9 members of the same functional gene family, such as those of the pea small subunit of ribulose Ms-phosphate carboxylase family (32-33). The coding sequence The 723 nucleotides that comprise the coding sequence and termination codons of both tmr loci are shown in Fig. 4, and the deduced amino acid sequence for each is also presented. There is greater than 91% nucleotide homology. Of the 54 nucleotide changes that occur, 21 are third position changes which do not alter the amino acid at this position. Nine of the remaining changes result in substitution of similar amino acids such as the change of a threonine for a serine at amino acid 16. The remaining changes result in substantial differences of the amino acid; for example, the replacement of lysine by glutamate at amino acid 68 or the replacement of aspartate by tyrosine at amino acid 157. Overall, these changes result in a net negative charge of -2 for the T37 tmr protein versus a net negative change of -5 for the Ach5 protein. These changes have not substantially altered the basic function of the resulting tmr proteins since genetic evidence suggest that each performs the same function in T37 or Ach5 transformed tissues. What effects these substitutions might have on the efficiency with which each of the respective tar proteins fulfills its intracellular role awaits identification of biological activity and comparison of the two purified proteins. It should be noted that there is no great difference in the codon usage for the two coding sequences. Codons that appear infrequently in either of the tmr genes are not under represented in the codon usage of both the octopine and nopaline synthase proteins (34-35) and probably represent only random variation in codon usage in the smaller tmr proteins with their fewer number of codons. The 3' region The sequences of nearly 360 nucleotides from the 3' end of the pti T37 and pti Ach5 tar genes appear in Fig. 5. We have attempted to align these so that the maximum homology has been shown. This has been accomplished by including spaces in both sequences where insertions or deletions appear to have occurred. As has been described for the 3 1 nontranslated regions of different members of a gene family (33,36-37), a great amount of variability exists between the two tmr genes. The overall homology is only about 50%. Because neither we nor Heidekamp and his co-workers (15) have performed SI analysis to accurately determine the location of the 3' end of the respective tmr mrnas, the following conclusions will be based entirely on inspection of the sequences for the presence of the canonical plant poly-adenylation site 4673

10 1382 TTTCCACCAG CTCCGCCTCA CACCTCTCTT CATTTGAATA AGATGTTCCC AATTGTTTTT 1413 GTTACCCCAG CCCTGCGTCG CACCTCTCTT CATCTCCATA ACATCTTCCT AATTGTTTTT 1447 AGCTTTCTCT TGTTGTGGCA GCGCGGCAAG TGCTTCAGAC ATCATTCTG TTTTCAAAT 1473 GCCTTTGTCC TCTTGTGCCA GCGCGCCAAA TACTTCCGAC AATCCATCGT GTCTTCAAAC 1500 TTTATGCTGG AGAACAGCTT CTTAATTCCT TTGCAAATAA TAGACTGCGT CTTAAAATT 1533 TTTATCCTGG TGAACAAGTC TTAGTTTCCA CGAAAGTA TTATCTTAAA TTTTAAAATT 1559 CAGATGTCTG GATATAGATA TGATTGTAAA ATAACCTATT TAAGTGTCA TTTAGAACAT 1591 TCGATGTATA ATGTGGaAT AATTGTAAAA ATAAACTATC GTAAGTCTGC GTGTTATGTA 1618 AAGTTTTATG AATGTTCTTC CATTTTCGTC ATCGAACGAA TAAGAGTAAA TACACCTTTT 1651 TAATTTGTCT AAATGTTTAA TATATATCAT AGAACGCAAT AAATATTAAA TATAGCGCTT 1678 TTAACAT TA TAAATAAGTT CTTATACGTT GTTTATACAC CGGGAATCAT TTCCATTATT 1711 TTATGAAATA TAAATACATC ATTACAAGTT GTTTATATTT CGGGTACCTT TTCCATTATT Figure 5. Comparison of the 3' nontranslated regions of the tmr loci from the T37(upper lines) and Ach5 (lower lines) Ti plasmids. Spaces have been inserted into both sequences to achieve maximal alignment. The nucleotide numbering is the same as in Fig. 2 and has been adjusted for the inserted spaces in the pti T37 tmr sequence. The underscored nucleotides are potential poly-adenylation signals. 5'-G/AATAA- (38). These sites are marked on Fig. 5. It is interesting that both the pti T37 and the pti Ach5 tmr loci show a consensus poly-adenylation signal near to the coding sequence (nucleotide 1416; 5'-AATAA- for T37 and 5'-GATAA for Ach5). The significance of these signals approximately 36 nucleotides from the translational termination codon is not known but they have been found in most of the plant 3' nontranslated sequences examined (38). In addition to these "close-in" poly-adenylation signals both the pti T37 and pti Ach5 3' regions show consensus plant signals at similar locations at approximately 200 and 270 nucleotides downstream from the translation terminator. The pti T37 sequence shows two additional consensus polyadenylation signals one of which is located 155 nucleotides from the terminator codon and the other of which occurs approximately 300 nucleotides from the terminator. The relative utilization of these various signals in posttranscriptional modification of the respective tmr mrnas awaits further experimentation. DISCUSSION In this paper we report the nucleotide sequence of the pti T37 tar locus and compare and contrast this with the sequence of the pti Ach5 tmr locus. The results raise many basic questions concerning plant gene expression as have previous reports describing and comparing nucleotide sequences in the absence 4674

11 of experimental manipulation of these DNAs. The existence of two functionally identical but structurally different DNAs has allowed us to reach the following conclusions concerning the significance of, in particular, the conserved sequences. We suggest that the extreme conservation of sequences located 130 to 180 nucleotides 5 1 of the translational start signal indicates a more significant role of these distal sequences in proper binding and interaction with the plant cell RNA polymerase II complex than is usually presumed. The importance of these regions might be assessed by experimental analysis. The significance of the pti T37 single "TATA box" versus two such signals and two different mrnas for the pti Ach5 promoter can only be assessed by quantitation of the total amount of transcription from the two different tmr gene promoters. Fortunately, all of the questions raised are answerable. We now have access to the nucleotide sequences and the means to alter and re-introduce modified DNAs into plant cells to assay the effects of our manipulations (39-40). In addition, the availability of the coding sequence permits us to modify the pti T37 tar gene for expression in Escherichia coll. This will enable us to obtain the product free from contaminating plant proteins and be able to perform assays for the possible cytokinin biosynthetic enzyme activities of this protein (42). Such experiments are currently in progress. ACKNOWLEDGEMENTS The authors are grateful to Dr. J. Schell for plasmid pgv3106. The authors wish to thank Ms. P. Guenther for exceptional patience during the preparation of the figures and text of this manuscript and to Drs. R. Fraley, R. Horsch, G. Barry and A. Levine for their critical reading of this manuscript. *To whom correspondence should be addressed ABBREVIATIONS nos nopaline synthase kb kilobases, 1000 bases REFERENCES 1. Chilton, M.-D., Drummond, M. H., Merlo, D. J., Sciaky, D., Montoya, A. L-, Gordon, M. P. and Nester, E. W. (1977) Cell 1±, Zaenen, I., Van Larebeke, N., Teuchy, H., Van Montagu, M. and Schell, J. (1979) J: Mol. Biol. 86, Chilton, M.-D. (1982) in Molecular Biology of Plant Tumors, Kahl, G. and Schell, J. Eds., Academic Press, New York. 4675

12 4. Holsters, M., Hernalsteens, J.-P. Van Moatagu, M. and Schell, J. (1982) in Molecular Biology of Plant Tumors, Kahl, G. and Schell, J. Eds., Academic Press, New York. 5. Bevan, M. W. and Chilton, M.-D. (1982) Ann. Rev. Genet. Ib, Braun, A. C. (1958) Proc. Natl. Acad. Sci. USA 44, Braun, A. C. (1978) Biochim. Biophys. Acta. 516, Garfinkel, D. J., Simpson, R. B., Ream, L. W., White, F. F., Gordon, M. P. and Nester, E. W. (1981) Cell 27, Leenans, J., Deblaere, R., Willmitzer, L., De Greve, H., Hernalsteens, J.-P., Van Montagu, M. and Schell, J. (1982) The EMBO Journal 1_, Joos, H., Inze, D., Caplan, A., Sonnann, M., Van Montagu, M. and Schell, J. (1983) Cell 32, Willmitzer, L., Dhaese, P., Schreier, P. H., Schmalenbach, W., Van Montagu, M. and Schell, J. (1983) Cell 32, Bevan, M. W. and Chilton, M.-D. (1982) J. Mol. Appl. Genet. \, Akiyoshi, D. E., Morris, R. 0., Hinz, R., Mischke, B. S., Kosuge, T., Garfinkel, D. J., Gordon, M. P. and Nester, E. W. (1983) Proc. Natl. Acad. Sci. USA 80, Ooms, G., Klapwijk, P. M., Poulis, J. A. and Schilperoort, R. A. (1980) J. Bacteriology 144, Heidekamp, F., Dirkse, W. G., Hille, J. and van Ormondt, H. (1983) Nucleic Acids Res. U, Engler, G., Depicker, A., Maenhaut, R., Villarroel, R., Van Montagu, M. and Schell, J. (1981) J. Mol. Biol. ^52, Maniatis, T., Fritsch, E. F. and Sambrook, J. (1982) Molecular Cloning, A laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 18. Messing, J., Crea, R. and Seeburg, P. H. (1981) Nucleic Acids Res. 9, Roberts, R. J. (1982) Nucleic Acids Res. 10, 1830 (rll7-rl44). 20. Murray, N. E., Bruce, S. A. and Murray, K. (1979) J. Mol. Biol. 132, Davis, R. W., Botstein, D. and Roth, J. R. (1980) Advanced Bacterial Genetics. Cold Spring Harbor Labortory, Cold Spring Harbor, New York. 22. Anderson, S. (1981) Nucleic Acids Res. 9, Taylor, A. F., Silicano, P. G. and Weiss, B. (1980) Gene 9, Hernalsteens, J.-P., Van Vliet, F., De Beuckeleer, M., DePicker, A., Engler, G., Lemmers, M., Holsters, M., Van Montagu, M. and Schell, J. (1980) Nature 282, Soberon, X., Covarrubias, L. and Bolivar F. (1980) Gene 9, Hepburn, A. G., Clarke, L. E., Blundy, K. S. and White, J. (1983) J. Mol. Appl. Genet. 2, Matzke, A. J. M. and Chilton, M.-D. (1981) J. Mol. Appl. Genet. 1_, Barton, K. A., Binns, A. N., Matzke, A. J. M. and Chilton, M.-D. (1983) Cell 32, Schroder, G., Klipp, W., Hillebrand, A., Ehring, R., Koncz, C. and Schroder, J. (1983) The EMBO J. 2, Schroder, G. and Schroder, J. (1982) Mol. Gen. Genet. 185, Breathnach, R. and Chambon, P. (1981) Ann. Rev. Biochem. 50, Cashmore, A. R. (1983) in Genetic Engineering of Plants, an Agricultural Perspective, Kosuge, T., Meredith, C. P. and Hollaender, A. Eds., pp , Plenum Press, New York. 33. Broglie, R., Coruzzi, G., Lamppa, G., Keith, B. and Chua, N.-H. (1983) Biotechnology 1_,

13 34. De Greve, H., Dhaese, P., Seurinck, J., Learners, M., Van Montagu, M. and Schell, J. (1982) J. Mol. Appl. Genet. 1_, Depicker, A., Stachel, S., Dhaese, P., Zambryski, P. and Goodman, H. M. (1982) J. Mol. Appl. Genet. 1, Berry-Lowe, S. L., McKnight, T. D., Shah, D. M. and Meagher, R. B. (1982) J. Mol. Appl. Genet. 1^ Coruzzi, G., Broglie, R., Edwards, C. and Chua, N.-H. (1984) Cell, submitted for publication. 38. Messing, J., Geraghty, D., Heidecker, G., Hu, N.-T., Kridl, J. and Rubenstein, I. (1983) in Genetic Engineering of Plants, an Agricultural Perspective, Kosuge, T., Meredith, C. P. and Hollaender, A. Eds., pp , Plenum Press, New York. 39. Herrera-Estrella, L., De Block, M., Hernalsteens, J.-P., Van Montagu, M. and Schell, J. (1983) The EMBO Journal 2, Bevan, M. W., Flavell, R. and Chilton, M.-D. (1983) Nature 304, Fraley, R. T., Rogers, S. G., Horsch, R. B., Sanders, P. R., Flick, J. S., Adams, S. P., Bittner, M. L., Brand, L. B., Fink, C. L., Fry, J. S., Galluppi, G. R., Goldberg, S. B., Hoffmann, N. L. and Woo, S. C. (1983) Proc. Natl. Acad. Sci. USA 80, Morris, R. 0., Akiyoshi, D. E., MacDonald, E. M. S., Morris, J. W., Regier, D. A. and Zaerr, J. B. (1982) in Plant Growth Substances, Waring, P. F., Ed., Acadmic Press, London. 4677