A tool kit for rapid cloning and expression of. recombinant antibodies
|
|
|
- Harriet Pierce
- 6 years ago
- Views:
Transcription
1 A tool kit for rapid cloning and expression of recombinant antibodies Tihomir S Dodev 1,4, Panagiotis Karagiannis 1,2, Amy E Gilbert 1,2, Debra H Josephs 1,2,3, Holly Bowen 1,4, Louisa K James 4, Heather J Bax 4, Rebecca Beavil 4, Marie O Pang 4, Hannah J Gould 4, Sophia N Karagiannis 1,2 and Andrew J Beavil 4 *
2 EM7 Supplementary Figure S1. Schematic representation of expression vectors& a( b( IRES EF1 pan 6000 MCS1 ref1 prom 3600 enh 0 pvitro1 6491bp mef1 prom MCS enh 1600 pmb1 Ori pan EM7 IRES VK A26 Secretary Leader VK 6000 C-Kappa ref1 prom 5200 EF1 pan enh pvitro1-ige/κ 8883bp 4000 mef1 prom pmb1 Ori VH1-02 Secretary 2000 VH 2400 C-Epsilon pan Leader enh Comments(for(pVITRO1(6491(nucleo<des:( ( Simian&Virus&40&enhancer&(&enh):&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&82242(bp& Mouse&Elonga:on&Factor&1&alpha&promoter&(mEF1&prom):& (bp& Mul:ple&Cloning&Site&2&(MSC2):&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& (bp& Simian&Virus&40&late&polyadenyla:on&signal&(&pAn):&&& (bp& Minimal&E.#coli#origin&of&replica:on&(pMB1&Ori):&&&&&&&&&&&&&&&&& (bp& Human&&enhancer:&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& (bp& & Rat&Elonga:on&Factor&1&alpha&promoter&(rEF1&prom):&&&&&&& (bp& Mul:ple&Cloning&Site&1&(MSC1):&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& (bp& Internal&Ribosome&Entry&Site&(IRES):&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& (bp& Bacterial&promoter&EM7:&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& &bp& Hygromycin&B&resistant&&gene:&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& (bp& EF1&polyadenyla:on&signal:&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& (bp& & Comments(for(pVITRO12IgE/κ(8883(nucleo<des:( ( Simian&Virus&40&enhancer&(&enh):&&&&&&&&&&&&&&& &&&&&&&&&&&&82242(bp& Mouse&Elonga:on&Factor&1&alpha&promoter&(mEF1&prom):& (bp( Human&VH1?02&Secretary&Leader:& &&&&&&&&&&&&&&&&&&&&&&& (bp( Variable&Heavy&(VH)®ion:&&& &&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& (bp( Human&Epsilon&Constant®ion&(C?Epsilon):&&&&&&&&&&&&&&&&&&&&&&&& (bp( Simian&Virus&40&late&polyadenyla:on&signal&(&pAn):&&& (bp( Minimal&E.#coli#origin&of&replica:on&(pMB1&Ori):&&&&&&&&&&&&&&&&& (bp( Human&&enhancer:&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& (bp& Rat&Elonga:on&Factor&1&alpha&promoter&(rEF1&prom):&&&&&&& (bp( Human&VK&A26&Secretary&Leader:&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& (bp( Variable&Kappa&(VK)®ion:&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& (bp( Human&Kappa&Constant®ion&(C?Kappa):&&&&&&&&&&&&&&&&&&&&&&&&&&& (bp( Internal&Ribosome&Entry&Site&(IRES):&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& (bp( Bacterial&promoter&EM7:&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& (bp( Hygromycin&B&resistant&&gene:&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& (bp( EF1&polyadenyla:on&signal:&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&& (bp& a) pvitro1 mammalian expression vector with two multiple cloning sites (MCS), allowing the co-expression of a pair of genes from two different transcription units. b) b) pvitro1-ige/κ antibody expression vector with human epsilon heavy chain expression cassette integrated within MCS2 under the action of enhancer and human kappa light chain expression cassette within MCS1 under human enhancer. &
3 a" Supplementary Figure S2. Gel electrophoresis analysis of PIPE amplified DNA products 4 kb! 0.5 kb! 0.4 kb! 0.3 kb! 0.8% Gel! 1.3% Gel! b" 8 kb! 1 kb! 0.8% Gel! 1.3% Gel! a) Bands representing the two vector fragments (0.8% gel) amplified from vector pvitro1-ige/κ by V H and V K flanking primer pairs in two independent PCR reactions, and vector fragment terminal end-homologous V H and V K (1.3% gel), alongside with 1 kb and 100 bp DNA ladders respectively. b) Bands representing the PCR linearized vector pvitro1-cspg4-ige/κ (0.8% gel) by epsilon constant region flanking primer pair, and vector terminal end-homologous human Gamma 1 constant region (1.3% gel), alongside with 1 kb and 100 bp DNA ladders respectively. The electrophoresis analysis shows clear DNA products with no unspecific amplifications.
4 1 Supplementary Figure S3. Schematic representation of PIPE cloning strategy for swapping antibody constant regions! -C-Kappa - CSPG4 V Κ -Secretory Leader Secretory Leader- CSPG4 V H - pvitro1-cspg4-ige/κ C-Epsilon CSPG4-VH_Rev Cg1_Fwd C-Gamma Cg1_Rev pigγ1 PCR Vector Linearization pan_fwd PCR Amplification for Vector Terminal End-Homology - C-Gamma 1 Unpurified PCR Products are Mixed 1:1 (V/V) Transformation Sequencing Anti-CSPG4 IgG 1 Mammalian Expression -C-Kappa - CSPG4 V Κ Secretory Leader- -Secretory Leader CSPG4 V H - 1 pvitro1-cspg4-igg1/κ C-Gamma pvitro1-cspg4-ige/κ expression vector is PCR linearized by Epsilon constant region flanking primer pair and subsequently DpnI-treated. Simultaneously, human Gamma 1 constant region is PCR amplified for generation of vector terminal end-homology. The unpurified DpnI-treated linearized vector is mixed 1:1 (v/v) with unpurified Gamma 1 PCR product. The single-stranded DNA fragments anneal directionally across the complementary sequences and nicks and gaps are repaired in vivo after transformation, generating pvitro1-cspg4-igg 1 /κ expression vector.!
5 Supplementary Table S1. Comparison of cloning efficiency of different vector assembly methods. Single Colonies GENEART Seamless Cloning and Assembly Gibson Assembly Polymerase Incomplete Primer Extension (PIPE) Sequenced Positive 23 (88.5%) 21 (91.3%) 18 (90%) False-Positive 3 (11.5%) 2 (8.7%) 2 (10%) Negative 0 (0%) 0 (0%) 0 (0%) Vector pvitro1-cspg4-ige/κ was assembled using GENEART Seamless Cloning and Assembly, Gibson Assembly or Polymerase Incomplete Primer Extension (PIPE). Positive colonies represent the correctly assembled vector, verified by sequencing over the annealing junctions. False-Positive refer to the vector template, used for vector linearization, undigested by the DpnI enzyme. Negative represent colonies, which do not carry pvitro1 vector.
6 Supplementary Table S2. Antibody expression vectors Species Isotype Human IgE/κ/λ IgG 1 /κ/λ IgG 2 /κ/λ IgG 3 /κ/λ IgG 4 /κ/λ IgA 1 /κ/λ IgA 2 /κ/λ IgM/κ/λ Rat IgE/κ - IgG 2 b/κ Mouse IgE/λ pvitro1 antibody expression vectors generated by the PIPE cloning method.
Vector Linearization. igem TU/e 2016 Biomedical Engineering
igem TU/e 2016 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2016.igem.org/Team:TU_Eindhoven Vector
Factors affecting PCR
Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the
Vector Linearization. igem TU/e 2015 Biomedical Engineering
igem TU/e 2015 Biomedical Engineering Eindhoven University of Technology Room: Ceres 0.04 Den Dolech 2, 5612 AZ Eindhoven The Netherlands Tel. no. +31 50 247 55 59 2015.igem.org/Team:TU_Eindhoven Vector
Supplementary Information
Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA
Enzymatic assembly of DNA molecules up to several hundred kilobases
nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures
GenBuilder TM Cloning Kit User Manual
GenBuilder TM Cloning Kit User Manual Cat.no L00701 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ. DNA
GenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2
GenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.
Data Sheet Quick PCR Cloning Kit
Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without
Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual
Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.
Antisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability
Antisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability Riaaz Lalani, Nathaniel Susilo, Elisa Xiao, Andrea Xu
Ready_to_use Fast Seamless Cloning Kit. User Manual
For general laboratory use. Not for use in diagnostic procedures. FOR IN VITRO USE ONLY. Ready_to_use Fast Seamless Cloning Kit User Manual 1 / 6 Tel: 021-58975266 Fax: 021-50800270 Email:tech@dogene.com
BBF RFC 57: Assembly of BioBricks by the Gibson Method
BBF RFC 57: Assembly of BioBricks by the Gibson Method Bill Collins, Hannah Copley, Peter Emmrich, Will Handley, Anja Hohmann, Emily Knott, Paul Masset, Ben Reeve and Theo Sanderson October 28, 2010 1
Design. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
Supplementary Methods pcfd5 cloning protocol
Supplementary Methods cloning protocol vermilion trna grna trna grna U6:3 Terminator AmpR attb is a vector for expressing one or multiple trna-flanked Cas9 grnas under the control of the strong, ubiquitous
I. Gene Cloning & Recombinant DNA. Biotechnology: Figure 1: Restriction Enzyme Activity. Restriction Enzyme:
I. Gene Cloning & Recombinant DNA Biotechnology: Figure 1: Restriction Enzyme Activity Restriction Enzyme: Most restriction enzymes recognize a single short base sequence, or Restriction Site. Restriction
Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10163 Supplementary Table 1 Efficiency of vector construction. Process wells recovered efficiency (%) Recombineering* 480 461 96 Intermediate plasmids 461 381 83 Recombineering efficiency
Use of In-Fusion Cloning for Simple and Efficient Assembly of Gene Constructs No restriction enzymes or ligation reactions necessary
No restriction enzymes or ligation reactions necessary Background The creation of genetic circuits and artificial biological systems typically involves the use of modular genetic components biological
Fast and efficient site-directed mutagenesis with Platinum SuperFi DNA Polymerase
APPLICATION NOTE Platinum Superi Polymerase ast and efficient site-directed mutagenesis with Platinum Superi Polymerase Introduction Site-directed mutagenesis is one of the most essential techniques to
Polymerase Chain Reaction PCR
Polymerase Chain Reaction PCR What is PCR? An in vitro process that detects, identifies, and copies (amplifies) a specific piece of DNA in a biological sample. Discovered by Dr. Kary Mullis in 1983. A
Fatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
Molecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
Molecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
Genetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
Simple Deletion: a vector- and marker-free method to generate and isolate site-directed
Electronic supplementary materials Simple Deletion: a vector- and marker-free method to generate and isolate site-directed deletion mutants Yasuhiro Inoue 1, Seiji Tsuge 2 1 National Agriculture and Food
Virus-induced gene complementation reveals a transcription factor network in modulation of tomato fruit ripening
Supplementary Information Virus-induced gene complementation reveals a transcription factor network in modulation of tomato fruit ripening Tao Zhou 2,3, Hang Zhang 2,4, Tongfei Lai 1, Cheng Qin 1, Nongnong
Genome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
Enhanced Arginase production: rocf
Enhanced Arginase production: rocf Purpose and Justification: Bacillus subtilis produces urease, which catalyses the hydrolysis of urea into ammonium and carbonate. Since the cell wall of the bacteria
Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.
Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules
Schematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
DNA Technology. Asilomar Singer, Zinder, Brenner, Berg
DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other
ProductInformation INTRODUCTION TO THE VECTORETTE SYSTEM
INTRODUCTION TO THE VECTORETTE SYSTEM ProductInformation The following is background information on the Vectorette System, included to familiarize the researcher with the Vectorette Unit and its function
Recitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
NZYGene Synthesis kit
Kit components Component Concentration Amount NZYGene Synthesis kit Catalogue number: MB33901, 10 reactions GS DNA Polymerase 1U/ μl 30 μl Reaction Buffer for GS DNA Polymerase 10 150 μl dntp mix 2 mm
Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection
Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. A version
Hetero-Stagger PCR Cloning Kit
Product Name: Code No: Size: DynaExpress Hetero-Stagger PCR Cloning Kit DS150 20 reactions Kit Components: Box 1 (-20 ) phst-1 Vector, linearized Annealing Buffer Ligase Mixture phst Forward Sequence Primer
Supplementary Information
Single day construction of multi-gene circuits with 3G assembly Andrew D. Halleran 1, Anandh Swaminathan 2, and Richard M. Murray 1, 2 1. Bioengineering, California Institute of Technology, Pasadena, CA.
Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
Page 1 of 10 MIDTERM EXAM OF BIO
Page 1 of 10 MIDTRM XAM OF IO3151 2017 Name: Student number: Part I: Calculations 1 2 3 4 NaCl: Water: 5 6 7 Volume of NaCl: 8 Plasmid A: Amount of 1 Kb insert: Part II: ioinformatics 1 2 3 Forward: Reverse:
Lab Book igem Stockholm Sortase A. Week 5
Sortase A Week 5 Summarized below are the experiments conducted this week in chronological order. Click on the experiment name to view it. To go back to this summary, click Summary in the footer. Summary
3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
Introduction to some aspects of molecular genetics
Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...
Computational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
Construct Design and Cloning Guide for Cas9-triggered homologous recombination
Construct Design and Cloning Guide for Cas9-triggered homologous recombination Written by Dan Dickinson (ddickins@live.unc.edu) and last updated December 2013. Reference: Dickinson DJ, Ward JD, Reiner
XXII DNA cloning and sequencing. Outline
XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;
13-2 Manipulating DNA Slide 1 of 32
1 of 32 The Tools of Molecular Biology The Tools of Molecular Biology How do scientists make changes to DNA? Scientists use their knowledge of the structure of DNA and its chemical properties to study
MUTAGENESIS OF THE PROMOTER OF THE OIL PALM HOMOGENTISATE GERANYLGERANYL TRANSFERASE GENE (HGGT) BY PCR-DRIVEN OVERLAP EXTENSION
ICBAA2017-30 MUTAGENESIS OF THE PROMOTER OF THE OIL PALM HOMOGENTISATE GERANYLGERANYL TRANSFERASE GENE (HGGT) BY PCR-DRIVEN OVERLAP EXTENSION Mohd Shahrul Nizwanshah Karim and Siti Nor Akmar Abdullah Laboratory
DETERMINATION OF THE Rh FACTOR BY PCR
DETERMINATION OF THE Rh FACTOR BY PCR Ref.: PCR2 1. EXPERIMENT OBJECTIVE The aim of this experiment is to introduce students to the principles and practice of the Polymerase Chain Reaction (PCR) by studying
Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :
Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and
Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
Chapter 5. Genetic Models. Organization and Expression of Immunoglobulin Genes 3. The two-gene model: Models to Explain Antibody Diversity
Chapter 5 Organization and Expression of Immunoglobulin Genes 3 4 5 6 Genetic Models How to account for: ) Vast diversity of antibody specificities ) Presence of Variable regions at the amino end of Heavy
Characteristics of bacterial Plasmid : Size : Conformation : Replication origin of replication : Replication Protein :
Characteristics of bacterial Plasmid : Size : Conformation : Replication origin of replication : Replication Protein : Definition of Plasmid Plasmids are extrachromosomal circular, double stranded DNA
Lecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
PLNT2530 (2018) Unit 6b Sequence Libraries
PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the
Restriction Enzymes (endonucleases)
In order to understand and eventually manipulate DNA (human or otherwise) an array of DNA technologies have been developed. Here are some of the tools: Restriction Enzymes (endonucleases) In order to manipulate
peco TM -T7-nGST, Eco cloning Kit User Manual (Patent pending)
peco TM -T7-nGST, Eco cloning Kit User Manual (Patent pending) Cloning PCR products for E Coli expression of N-term GST-tagged protein Cat# Contents Amounts Application IC-1004 peco-t7-ngst vector built-in
Ligation Independent Cloning (LIC) Procedure
Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) LIC cloning allows insertion of DNA fragments without using restriction enzymes into specific vectors containing engineered
GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
Marker Antibody Supplier. CD7 CD7 PE-CY 7 anti-human CD7 ebioscience, San Diego, USA
Supplementary Table 1: Flurochrome labelled antibody used Marker Antibody Supplier CD3 CD4 CD8 CD25 CD26 CD127 CCR4 CCR7 Ki67 Viability stain Alexa Fluor 700 anti-human CD3 Fluorescein isothiocyanate antihuman
MightyAmp DNA Polymerase Ver.3
Cat. # R076A For Research Use MightyAmp DNA Polymerase Ver.3 Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. General PCR Reaction Mix... 3 V. Primer Design...
Supplementary Information
Supplementary Information RapGene: a fast and accurate strategy for synthetic gene assembly in Escherichia coli Massimiliano Zampini, Pauline Rees Stevens, Justin A. Pachebat, Alison Kingston-Smith, Luis
California Institute of Technology. Directed evolution. Dr. F.H. Arnold s lab
Directed evolution. Dr. F.H. Arnold s lab May 4, 1999 Mutagenic PCR -[Mn] The amount of Mn used in the reaction should be titrated to produce the desired mutagenic rate. Libraries that have close to 30%
SUPPLEMENTARY INFORMATION
Gene replacements and insertions in rice by intron targeting using CRISPR Cas9 Table of Contents Supplementary Figure 1. sgrna-induced targeted mutations in the OsEPSPS gene in rice protoplasts. Supplementary
Overview: The DNA Toolbox
Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant
CELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector)
Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Catalog number: CTG-CAS9-18 Introduction The vector Lenti-EF1 -Cas9-EGFP-U6 sgrna is designed for
Molecular Biology Techniques Supporting IBBE
Molecular Biology Techniques Supporting IBBE Jared Cartwright Protein Production Lab Head Contact Details: email jared.cartwright@york.ac.uk Phone 01904 328797 Presentation Aims Gene synthesis Cloning
Chapter 10 (Part II) Gene Isolation and Manipulation
Biology 234 J. G. Doheny Chapter 10 (Part II) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. What does PCR stand for? 2. What does the
B. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
Reverse Transcription & RT-PCR
Creating Gene Expression Solutions Reverse Transcription & RT-PCR Reverse transcription, a process that involves a reverse transcriptase (RTase) which uses RNA as the template to make complementary DNA
Justin Veazey. Experiment 3; Analysis of digestion products of puc19, GFPuv, and pgem-t easy
Veazey 1 Justin Veazey 7A Experiment 3; Analysis of digestion products of puc19, GFPuv, and pgem-t easy Construction of recombinants GFPuv-pGEM-T easy and GFPuv-pUC19 Transformation and analysis of recombinant
A Modified Digestion-Circularization PCR (DC-PCR) Approach to Detect Hypermutation- Associated DNA Double-Strand Breaks
A Modified Digestion-Circularization PCR (DC-PCR) Approach to Detect Hypermutation- Associated DNA Double-Strand Breaks SARAH K. DICKERSON AND F. NINA PAPAVASILIOU Laboratory of Lymphocyte Biology, The
Polymerase Chain Reaction
Polymerase Chain Reaction Amplify your insert or verify its presence 3H Taq platinum PCR mix primers Ultrapure Water PCR tubes PCR machine A. Insert amplification For insert amplification, use the Taq
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
MCB 102 University of California, Berkeley August 11 13, Problem Set 8
MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without
Problem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
IMMUNOGLOBULIN GENES UNDERGO TWO DNA REARRANGEMENTS
A Prototype Ig Gene: Murine Kappa About 10 0 V κ gene segments 4 J Gene Segment s 1 C κ Gene Segmen t Multiple V gene segments, distant from J and C A few J gene segments One C gene segment GERMLINE Ig
PCR in the Classroom. UC Davis - PCR Workshop Friday, September 26, 2003
PCR in the Classroom UC Davis - PCR Workshop Friday, September 26, 2003 A little history In 1983, Kary B. Mullis conceived the procedure. He went on to Cetus Corp in Emeryville, CA where it was developed
1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA.
Supplemental data: 1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA. Strategy#1: 20nt at both sides: #1_BglII-Fd primer : 5 -gga
Bio Rad PCR Song Lyrics
Bio Rad PCR Song Lyrics There was a time when to amplify DNA, You had to grow tons and tons of tiny cells. (Oooh) Then along came a guy named Dr. Kary Mullis, Said you can amplify in vitro just as well.
CRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Guide-it Products for Successful CRISPR/Cas9 Gene Editing - Why choose Guide-it products? Optimized methods designed for speed and ease of use Complete kits that don t
Supplementary Material for StairSTEPS Manuscript
Supplementary Material for StairSTEPS Manuscript S1. Supplementary Materials and Methods S1.1 Plasmid vector construction All plasmids for expression of dcas9 were derived from the pjed103 vector series
Chapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
Supplementary Information
Supplementary Information Super-resolution imaging of fluorescently labeled, endogenous RNA Polymerase II in living cells with CRISPR/Cas9-mediated gene editing Won-Ki Cho 1, Namrata Jayanth 1, Susan Mullen
Protocols for cloning SEC-based repair templates using SapTrap assembly
Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (ddickins@live.unc.edu) and last updated July 2016. Overview SapTrap (Schwartz and Jorgensen, 2016) is a
Puro. Knockout Detection (KOD) Kit
Puro Knockout Detection (KOD) Kit Cat. No. CC-03 18 Oct. 2016 Contents I. Kit Contents and Storage II. Product Overview III. Methods Experimental Outline Genomic DNA Preparation Obtain Hybrid DNA Digest
Bootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
CHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
Programmable Sequence-Specific Transcriptional Regulation of Mammalian Genome Using Designer TAL Effectors
Supplementary Information Programmable Sequence-Specific Transcriptional Regulation of Mammalian Genome Using Designer TAL Effectors Feng Zhang 1,2,3,5,7 *,±, Le Cong 2,3,4 *, Simona Lodato 5,6, Sriram
CELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector)
Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Catalog number: CTG-CAS9-11 Introduction The vector Lenti-U6 sgrna-ef1 -Puro is designed for expression
CSS451 Spring 2010 Polymerase Chain Reaction Laboratory
CSS451 Spring 2010 Polymerase Chain Reaction Laboratory The purpose of the polymerase chain reaction (PCR) is to amplify specific segments of DNA. If one knows the DNA sequence of regions of DNA that flank
Efficient Multi-site-directed Mutagenesis directly from Genomic Template.
Efficient Multi-site-directed Mutagenesis directly from Genomic Template. Fengtao Luo 1, Xiaolan Du 1, Tujun Weng 1, Xuan Wen 1, Junlan Huang 1, Lin Chen 1 Running title: Multi-site-directed Mutagenesis
Adenoviral Expression Systems. Lentivirus is not the only choice for gene delivery. Adeno-X
Adenoviral Expression Systems Lentivirus is not the only choice for gene delivery 3 Adeno-X Why choose adenoviral gene delivery? Table I: Adenoviral vs. Lentiviral Gene Delivery Lentivirus Adenovirus Infects
Recombinant DNA recombinant DNA DNA cloning gene cloning
DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific
CHAPTER FOUR. Characterization of parasporal genes in. Paenibacillus popilliae and Paenibacillus lentimorbus. Abstract
CHAPTER FOUR Characterization of parasporal genes in Paenibacillus popilliae and Paenibacillus lentimorbus Abstract The parasporal gene, cry18aa1, was cloned and sequenced by Zhang et al. (4) from the
In-Fusion HD Cloning Plus System
In-Fusion HD Cloning Plus System One trustworthy solution for all your cloning and mutagenesis projects Seamless 15-30 Directional Any vector GOI + Any insert Anywhere Large & small inserts or vectors