Virus-induced gene complementation reveals a transcription factor network in modulation of tomato fruit ripening
|
|
- Dorthy Lindsey
- 5 years ago
- Views:
Transcription
1 Supplementary Information Virus-induced gene complementation reveals a transcription factor network in modulation of tomato fruit ripening Tao Zhou 2,3, Hang Zhang 2,4, Tongfei Lai 1, Cheng Qin 1, Nongnong Shi 1, Huizhong, Wang 1, Mingfei Jin 2,5, Silin Zhong 6, Zaifeng Fan 3, Yule Liu 7, Zirong Wu 5, Stephen Jackson 2, James J Giovannoni 6, Dominique Rolin 8, Philippe Gallusci 8, and Yiguo Hong 1,2* 1 Research Centre for Plant RNA Signalling, College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou , China. 2 Warwick HRI and School of Life Science, University of Warwick, Warwick CV35 9EF, UK. 3 Department of Plant Pathology and State Key Laboratory of Agrobiotechnology, China Agricultural University, Beijing , China. 4 Chengdu Rongsheng Pharmaceuticals, Chengdu , China. 5 School of Life Science, East China Normal University, Shanghai , China. 6 Boyce Thompson Institute for Plant Science Research, Cornell University, Ithaca, New York , USA. 7 School of Life Sciences, Tsinghua University, Beijing , China. 8 Université de Bordeaux 1 UMR 1332, Biologie du Fruit et Pathologie, Bordeaux, France. * Correspondence should be addressed to Y. H. (yiguo.hong@hznu.edu.cn, yghongabc@googl .com or yiguo.hong@warwick.ac.uk) These authors contributed equally to this work. 1
2 Supplementary Text Stability of LeMADS-RIN RNA in VIGC vectors. When amplified by RT-PCR with a pair of primers PP82 and PP83 flanking the inserted LeMADS-RIN RNA in PVX/LeMADS-RIN, PVX/mLeMADS-RIN, PVX/HisG::LeMADS-RIN and PVX/HisG::mLeMADS-RIN, an intact construct should yield a single band (~1000-nt PVX-RIN RNA, Fig. S3), and any shorter fragments [e.g. ~700-nt PVX-RIN RNA (partial deletion) and 258-nt PVX RNA without RIN insert, Fig. S3] would indicate that part of the LeMADS-RIN RNA sequence was lost in these PVX-based VIGC vectors. PVX with a shorter version of the LeMADS-RIN RNA or PVX without any foreign sequence would be expected to replicate more efficiently. Consequently the accumulation of the RT-PCR products corresponding to the deleted-versions (partial or total deletion) of viruses should go up, while the full-size insert band originated from the non-deletion VIGC vectors should diminish. However, RT-PCR analysis showed a completely different situation, with two smaller bands present in considerably less abundance in all samples (Fig. S3). These data suggest that the full-length LeMADS-RIN RNA was largely maintained in all VIGC vectors during the course of infection and virus-induced complementation in rin fruits. However partial or complete deletion of the LeMADS-RIN RNA from a small portion of viral genomic RNAs of all VIGC vectors had taken place. The precise mechanism about how the LeMADS-RIN RNA was deleted from recombinant viruses is unknown. It is possible that such deletion could occur through homologous RNA recombination between the duplicated viral coat protein subgenomic promoter sequences, even between the endogenous rin transcript (which is transcribed from tomato deletion mutant rin gene) and the LeMADS- RIN RNA in the VIGC vectors. Taken together, these data demonstrate that the LeMADS- 2
3 RIN RNA was stable in the PVX-based VIGC vectors, consistent with its function to complement rin mutant fruits (Fig. 2). Supplementary Figure Legends Figure S1 Map of PVX and PVX/HisGMF1. A double-stranded oligonucleotide fragment which codes an oligopeptide of six histidines and one glycine (His6-Gly) was obtained by annealing a pair of primers PP645 and PP646, and cloned into the ClaI site of the PVX vector 28 to produce PVX/HisGMF1. Viral RNA dependent RNA polymerase (166K), movement proteins (25, 12 and 8K) and coat protein (CP) as well as the His6-Gly tag are indicated. Unique cloning restriction enzymes, T7 and T3 promoters as well as the SpeI site at the end of the PVX genome are also indicated. Nucleotides are numbered according to the original PVX vector in pbluescript 28. Figure S2 sqrt-pcr assays of viral transient expression of LeMADS-RIN mrna from VIGC vectors in rin fruits. Total RNA was extracted from two mock-injected rin fruits (I and II) or from fruits injected with PVX/LeMADS-RIN, PVX/meLeMADS-RIN or PVX/HisG::mLeMADS-RIN at 3 wpi and used for sqrt-pcr with 30 cycles of amplification. RNA samples from the ripe red sectors (R) and non-ripe green sectors (G) of two fruits (I and II) injected with PVX/LeMADS-RIN were analysed. Equal amount of total RNA (100 ng) used in each of the sqrt-pcr reactions was verified by detecting a similar level of 18S rrna in all samples. The positions and sizes of the 1-kb DNA marker (Ladder) and positions of RT-PCR products specific for PVX::LeMADS-RIN mrna (PVX- RIN RNA) as well as 18S rrna are indicated. 3
4 Figure S3 Stability of LeMADS-RIN RNA in VIGC vectors. Total RNA extracted from rin fruits injected with PVX, PVX/LeMADS-RIN, PVX/meLeMADS-RIN, PVX/HisG::LeMADS-RIN or PVX/HisG::mLeMADS-RIN at 3 weeks post-injection was used for sqrt-pcr with 30 cycles of amplification using a pair of PVX genomic primers PP82 and PP83 (Table S1; Table S2). This pair of primers allows amplifying a 258 bp fragment from the PVX genome harbouring no foreign RNA insert. Three RT-PCR products which represented PVX::LeMADS-RIN (PVX-RIN) RNA of the predicted size of approximately 1000 nucleotides (nt), PVX::LeMADS-RIN RNA with partial deletion of about 700 nt and 258-nt PVX RNA without any LeMADS-RIN insert were detected. Relative levels of accumulation of VIGC viruses with partial or complete deletion of the LeMADS-RIN RNA were estimated to be less than 1% or 1 5% of that of VIGC viruses having the full-length LeMADS-RIN RNA, respectively, when comparing the densities of corresponding ethidium bromide-stained RT-PCR bands in each sample. The positions and sizes of the 1-kb DNA marker (Ladder) and positions of three RT-PCR products as well as 18S rrna are indicated. 4
5 Supplementary Tables Supplementary Table S1 Sequences of Primers used in this study Primer Sequences (5-3 ) Origin PP82 CAGTGTTGGCTTGCAAACTAG PVX PP83 TGGCAGGAGTTGCGCCTGCAG PVX PP271 CGGCTACCACATCCAAGGAAGG 18S rrna PP272 GAGCTGGAATTACCGCGGCTG 18S rrna PP298 CCTCACATCGATGGAAACTAACAAATGGGAAGGGA LeSPL-CNR PP300 TAACAGCGGCCGTCTGCTACATTGCTGACAGAATC LeSPL-CNR PP402 AGTTGAATCGATGGGATCTGGGCATATATTTTTC LeHB1 PP403 AAATTGGGCCCAGACCAGAACCATCCAATAGGCTC LeHB1 PP404 GCTCATATCGATGGTGTCGATTGAACAAGTAGA SlTPR1 PP405 AAACCCGGGCCCCTTCTGAAATTGAACAGAGTAG SlTPR1 PP797 TCTTCAATCGATATGGGTAGAGGGAAAGTAGA LeMADS-RIN (start codon) PP798 TCTTCAATCGATTAGGGTAGAGGGAAAGTAGA LeMADS-RIN (mutated start codon) PP799 ACTCCACGGCCGAAGCATCCATCCAGGTACAAC LeMADS-RIN 5
6 Supplementary Table S2 Primers for cloning and RT-PCR detection Primer set RT-PCR Cloning PP82/PP83 PP82/PP799 PP271/PP272 PP298/PP300 PP402/PP403 PP404/PP405 PVX, PVX-RIN RNA PVX-RIN RNA 18S rrna LeSPL-CNR mrna LeHB1 mrna SlTPR1 mrna PP797/PP799 PP797/PP799 PP798/PP799 PP798/PP799 PVX/LeMADS-RIN PVX/HisG::LeMADS-RIN PVX/mLeMADS-RIN PVX/HisG::mLeMADS-RIN 6
7
8
9
Tuning LeSPL-CNR expression by SlymiR157 affects tomato fruit
Tuning LeSPL-CNR expression by affects tomato fruit ripening Weiwei Chen 1*, Junhua Kong 1*, Tongfei Lai 1*, Kenneth Manning 2, Chaoqun Wu 1, Ying Wang 1, Cheng Qin 1, Bin Li 1, Zhiming Yu 1, Xian Zhang
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationChapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
More informationAmplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :
Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and
More informationBi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
More informationSchematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
More informationIntroducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
More informationFactors affecting PCR
Lec. 11 Dr. Ahmed K. Ali Factors affecting PCR The sequences of the primers are critical to the success of the experiment, as are the precise temperatures used in the heating and cooling stages of the
More informationBiotechnology. Cloning. Transformation 2/4/ glue DNA
Biotechnology Cloning The production of multiple copies of a single gene (gene cloning) For basic research on genes and their protein products To make a protein product (insulin, human growth hormone)
More informationRegulation of enzyme synthesis
Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationDNA REPLICATION & BIOTECHNOLOGY Biology Study Review
DNA REPLICATION & BIOTECHNOLOGY Biology Study Review DNA DNA is found in, in the nucleus. It controls cellular activity by regulating the production of, which includes It is a very long molecule made up
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationIdentification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio
2013 Plant Management Network. Accepted for publication 18 December 2012. Published. Identification of a Cucumber mosaic virus Subgroup II Strain Associated with Virus-like Symptoms on Hosta in Ohio John
More informationSUPPLEMENTARY INFORMATION
Ca 2+ /calmodulin Regulates Salicylic Acid-mediated Plant Immunity Liqun Du, Gul S. Ali, Kayla A. Simons, Jingguo Hou, Tianbao Yang, A.S.N. Reddy and B. W. Poovaiah * *To whom correspondence should be
More informationEpigenetic control of tomato fruit development. Key Laboratories of Molecular Epigenetics of MOE, Northeast Normal University, Changchun, China
Epigenetic control of tomato fruit development Silin Zhong 1,2*,, Zhangjun Fei 1,3,*,, Yun-Ru Chen 1, Yi Zheng 1, Mingyun Huang 1, Julia Vrebalov 1, Ryan McQuinn 1, Nigel Gapper 1, Bao Liu 2, Jenny Xiang
More informationBio Rad PCR Song Lyrics
Bio Rad PCR Song Lyrics There was a time when to amplify DNA, You had to grow tons and tons of tiny cells. (Oooh) Then along came a guy named Dr. Kary Mullis, Said you can amplify in vitro just as well.
More informationApplicazioni biotecnologiche
Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationProblem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationDevelopment of Positive Control for Hepatitis B Virus
Human Journals Research Article December 2015 Vol.:2, Issue:2 All rights are reserved by Saurabh Bandhavkar et al. Development of Positive Control for Hepatitis B Virus Keywords: Hepatitis B virus, pbluescript,
More informationChapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationBiosc10 schedule reminders
Biosc10 schedule reminders Review of molecular biology basics DNA Is each person s DNA the same, or unique? What does DNA look like? What are the three parts of each DNA nucleotide Which DNA bases pair,
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationBS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
More informationSUPPLEMENTARY INFORMATION
Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers Wataru Sakai, Elizabeth M. Swisher, Beth Y. Karlan, Mukesh K. Agarwal, Jake Higgins, Cynthia Friedman, Emily Villegas,
More information13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription.
13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. The Role of RNA 1. Complete the table to contrast the structures of DNA and RNA. DNA Sugar Number of Strands Bases
More informationGuided Notes Unit 5: Molecular Genetics
Name: Date: Block: Chapter 8: From DNA to Protein I. Concept 8.4: Transcription a. Central Dogma of Molecular Biology i. Information flows in one direction: ii. How? Guided Notes Unit 5: Molecular Genetics
More informationDNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA
21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationMethods that do not require growth in laboratory PCR
Methods that do not require growth in laboratory PCR Nucleotide sequencing MLST/MLVST Profiles Microarrays Polymerase Chain Reaction [PCR] Use to find a rare sequence in a pool of many different sequences
More informationPre-AP Biology DNA and Biotechnology Study Guide #1
Last Name: First Name: Per. Pre-AP Biology DNA and Biotechnology Study Guide #1 Structure of DNA: Number of strands. Parallel or antiparallel?. Rosalind Franklin s x-ray crystallography image indicated
More informationA Nucleus-Encoded Chloroplast Protein YL1 Is Involved in Chloroplast. Development and Efficient Biogenesis of Chloroplast ATP Synthase in Rice
A Nucleus-Encoded Chloroplast Protein YL1 Is Involved in Chloroplast Development and Efficient Biogenesis of Chloroplast ATP Synthase in Rice Fei Chen 1,*, Guojun Dong 2,*, Limin Wu 1, Fang Wang 3, Xingzheng
More informationSimple Deletion: a vector- and marker-free method to generate and isolate site-directed
Electronic supplementary materials Simple Deletion: a vector- and marker-free method to generate and isolate site-directed deletion mutants Yasuhiro Inoue 1, Seiji Tsuge 2 1 National Agriculture and Food
More informationGENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationRecitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
More informationBiotechnology. Biotechnology is difficult to define but in general it s the use of biological systems to solve problems.
MITE 2 S Biology Biotechnology Summer 2004 Austin Che Biotechnology is difficult to define but in general it s the use of biological systems to solve problems. Recombinant DNA consists of DNA assembled
More informationChapter 20 Biotechnology
Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the
More informationRoche Molecular Biochemicals Technical Note No. LC 12/2000
Roche Molecular Biochemicals Technical Note No. LC 12/2000 LightCycler Absolute Quantification with External Standards and an Internal Control 1. General Introduction Purpose of this Note Overview of Method
More informationGenome research in eukaryotes
Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics
More informationChapter 10 Genetic Engineering: A Revolution in Molecular Biology
Chapter 10 Genetic Engineering: A Revolution in Molecular Biology Genetic Engineering Direct, deliberate modification of an organism s genome bioengineering Biotechnology use of an organism s biochemical
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationMCB 102 University of California, Berkeley August 11 13, Problem Set 8
MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without
More informationksierzputowska.com Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster
Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster Research plan: Specific aims: 1. To successfully engineer transgenic Drosophila expressing TALENs
More informationManipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.
Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More information2014 Pearson Education, Inc. CH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More informationThe Biotechnology Toolbox
Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific
More informationBy two mechanisms: Mutation Genetic Recombination
Genetics (see text pages 257-259, 267-298) Remember what it is we want to address: How is it that prokaryotes gain new genetic ability? The cells are haploid and reproduce by fission...so how does an genetic
More informationBIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?
BIOLOGY 205 Midterm II - 19 February 1999 Name Multiple choice questions 4 points each (Best 12 out of 13). 1. Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?
More informationBootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
More informationGENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
More informationData Sheet Quick PCR Cloning Kit
Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without
More informationCH 8: Recombinant DNA Technology
CH 8: Recombinant DNA Technology Biotechnology the use of microorganisms to make practical products Recombinant DNA = DNA from 2 different sources What is Recombinant DNA Technology? modifying genomes
More informationCombinatorial Evolution of Enzymes and Synthetic pathways Using
Supplementary data Combinatorial Evolution of Enzymes and Synthetic pathways Using One-Step PCR Peng Jin,, Zhen Kang,,, *, Junli Zhang,, Linpei Zhang,, Guocheng Du,, and Jian Chen, The Key Laboratory of
More informationConstruction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
More informationRecombinant DNA recombinant DNA DNA cloning gene cloning
DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific
More informationChapter 10 (Part II) Gene Isolation and Manipulation
Biology 234 J. G. Doheny Chapter 10 (Part II) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. What does PCR stand for? 2. What does the
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationLac Operon contains three structural genes and is controlled by the lac repressor: (1) LacY protein transports lactose into the cell.
Regulation of gene expression a. Expression of most genes can be turned off and on, usually by controlling the initiation of transcription. b. Lactose degradation in E. coli (Negative Control) Lac Operon
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationSensitivity vs Specificity
Viral Detection Animal Inoculation Culturing the Virus Definitive Length of time Serology Detecting antibodies to the infectious agent Detecting Viral Proteins Western Blot ELISA Detecting the Viral Genome
More information7.012 Problem Set 5. Question 1
Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationRestriction Enzymes (endonucleases)
In order to understand and eventually manipulate DNA (human or otherwise) an array of DNA technologies have been developed. Here are some of the tools: Restriction Enzymes (endonucleases) In order to manipulate
More informationPBG 430/530 Exam
1 PBG 430/530 Exam 2 2013 1. In a deoxyribonucleotide, 5 and 3 refer to the a. start site for transcription. b. start site for translation. c. carbons where (respectively) the phosphate and hydroxyl groups
More informationLecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, ; ; 330 PCR, ; 329.
Lecture 3 (FW) January 28, 2009 Cloning of DNA; PCR amplification Reading assignment: Cloning, 240-245; 286-87; 330 PCR, 270-274; 329. Take Home Lesson(s) from Lecture 2: 1. DNA is a double helix of complementary
More informationPercent survival. Supplementary fig. S3 A.
Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice
More informationBurrH: a new modular DNA binding protein for genome engineering
Supplementary information for: BurrH: a new modular protein for genome engineering Alexandre Juillerat, Claudia Bertonati, Gwendoline Dubois, Valérie Guyot, Séverine Thomas, Julien Valton, Marine Beurdeley,
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationA tool kit for rapid cloning and expression of. recombinant antibodies
A tool kit for rapid cloning and expression of recombinant antibodies Tihomir S Dodev 1,4, Panagiotis Karagiannis 1,2, Amy E Gilbert 1,2, Debra H Josephs 1,2,3, Holly Bowen 1,4, Louisa K James 4, Heather
More informationA. I think it is DNA or RNA (circle your answer) because: B. I think it is DNA or RNA (circle your answer) because:
Name: Test Date: Block: Biology I: Unit 7 Molecular Genetics and Biotechnology Review for Unit Test Directions: You should use this as a guide to help you study for your test. You should also read through
More informationEfficient Multi-site-directed Mutagenesis directly from Genomic Template.
Efficient Multi-site-directed Mutagenesis directly from Genomic Template. Fengtao Luo 1, Xiaolan Du 1, Tujun Weng 1, Xuan Wen 1, Junlan Huang 1, Lin Chen 1 Running title: Multi-site-directed Mutagenesis
More informationGenetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms
Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination
More informationProtein Synthesis: From Gene RNA Protein Trait
Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains
More informationSupporting Information Innate Reverse Transcriptase Activity of DNA Polymerase for Isothermal RNA Direct Detection
Supporting Information Innate Reverse Transcriptase Activity of DNA Polymerase for Isothermal RNA Direct Detection Chao Shi, Xiaotong Shen, Shuyan Niu and Cuiping Ma *, Key Laboratory of Sensor Analysis
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More informationStudy Guide A. Answer Key
From DNA to Proteins Answer Key SECTION 1. IDENTIFYING DNA AS THE GENETIC MATERIAL 1. Mice lived 2. Mice died 3. Mice lived 4. Mice died 5. S 6. bacteria 7. DNA; DNA; DNA 8. protein 9. radioactive 10.
More informationSperm cells are passive cargo of the pollen tube in plant fertilization
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 3 ARTICLE NUMBER: 17079 Sperm cells are passive cargo of the pollen tube in plant fertilization Jun Zhang 1, Qingpei
More informationModule 6 Microbial Genetics. Chapter 8
Module 6 Microbial Genetics Chapter 8 Structure and function of the genetic material Genetics science of o Study of what genes are, how they determine the characteristics of an organism, how they carry
More informationSupplementary Information. Optimization of the production of knock-in alleles by CRISPR/Cas9 microinjection into the mouse zygote
Supplementary Information Supplementary Figures S1 to S5 and Tables S1 to S3. Optimization of the production of knock-in alleles by CRISPR/Cas9 microinjection into the mouse zygote Aurélien Raveux, Sandrine
More informationAntisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability
Antisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability Riaaz Lalani, Nathaniel Susilo, Elisa Xiao, Andrea Xu
More informationOverview: The DNA Toolbox
Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant
More informationUnit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics
More informationCONSTRUCTION OF GENOMIC LIBRARY
MODULE 4-LECTURE 4 CONSTRUCTION OF GENOMIC LIBRARY 4-4.1. Introduction A genomic library is an organism specific collection of DNA covering the entire genome of an organism. It contains all DNA sequences
More informationSite directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha
Site directed mutagenesis, Insertional and Deletion Mutagenesis Mitesh Shrestha Mutagenesis Mutagenesis (the creation or formation of a mutation) can be used as a powerful genetic tool. By inducing mutations
More informationTechnical tips Session 4
Technical tips Session 4 Biotinylation assay: Streptavidin is a small bacterial protein that binds with high affinity to the vitamin biotin. This streptavidin-biotin combination can be used to link molecules
More informationSuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes
WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus
More informationPolymerase Chain Reaction
Polymerase Chain Reaction Problem Suppose you have a patient with an infection or a heritable disease. You want to know which infection or disease it is and.. you want to know it fast and... from as little
More informationDNA Structure and Replication, and Virus Structure and Replication Test Review
DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks
More informationBIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)
BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9
More informationRegulation of ARE transcript 3 end processing by the. yeast Cth2 mrna decay factor
Regulation of ARE transcript 3 end processing by the yeast Cth2 mrna decay factor Manoël Prouteau, Marie-Claire Daugeron and Bertrand Séraphin Supplementary Information Material and Methods Plasmid construction
More information