pore) 5 -CACTCGATACAGGCAGCCCA-3 pri-vecprobe2 5 -
|
|
|
- Elfrieda Mills
- 6 years ago
- Views:
Transcription
1 : : CRE/loxP 35S ARABIDOPSIS THALIANA,.,,, Cre/loxP, Arabidopsis thaliana.,. : Cre/loxP,,,..,,,.,,., [3, 7]. nptii,, [5].
2 (, ) 50 [15]...,,. -..., [6, 14]. Cre/loxP 1. Cre. lox (locus of crossing-over) Cre. E.coli 1 lox [10].,, Cre/loxP 35S (CaMV).,. Arabidopsis thaliana - Cre/loxP.
3 . A. thaliana Cre/loxP,, pore-lox1hgc pore-lox2hgc.., cre, gus, nptii, loxp, (nos). gus nptii. hptii. Agrobacterium tumefaciens GV3101 [13]. A. tumefaciens [17] (100 ) (180 ) M, 5%-, MES ( Sigma, ) ( Sigma, ) ,8. A. thaliana Columbia. 4 0,. [2]
4 . 1 3:1 4 [12] (100 ).,. A. thaliana GUS ,2, 7,0, 10 TA, 20%, 0,01% Triton X-100, 2% O 0,1% (X-Gluc) [8]. 70%-. [4]. (200 Tris-HCl, ph 7,5, 250 NaCl, 25 E TA 0,5% ). 70% ,8%- (5 ). 2, 10 ( 0,5 ), 250, 250 MgCl 2, 0,3 Taq- («Sigma», ) («Sigma», ) 25. : hptiif2 ( 3 hptii) 5 -CACAGTTCTCGTCCACAGTTCG-3 35StermRevAvrII (, 3 35S ) 5 -aaacctagggatctggattttagtactgg-3.
5 300.. Cre loxp-, : pri-vecprobe1 (, pore) 5 -CACTCGATACAGGCAGCCCA-3 pri-vecprobe2 5 - GAATCTTGCCCTGCACGAATACC : ; 30 ( , , ), %-.. CRE/loxP 35S (. 1)., pore-lox1hgc pore-lox2hgc -,.. 1. pore-lox1hgc pore-lox2hgc. : 35S-, hptii, nos-
6 , GUS, re, oriv, nptii, ColEI, E. coli. 35S [18]. - Cre/loxP,., Cre/loxP, [10], HSP81-1 [11].,. 35S. 35S nos-., Kim et al. [9] Cre/loxP 35S nos-. gus lox.,,., gus.,,.. -,,.
7 . hptii... GUS- (. 2)., 35S.,, gus cre. pore-lox1hgc GUS- 78%. pore-lox2hgc GUS 85%. - Cre/loxP 35S )., Chong-Pérez et al. [1],, Cre/loxP Gmhsp17.6-L HSP18.2.,,. loxp 59,7% 40%. Zuo et al. [16] Cre/loxP XVE.
8 ,,. 66%. ) ). 2. gus A. thaliana: - GUS- ; - GUS-.. 35S hptii, loxp nptii pore-lox1hgc, loxp, 80%., pore-lox2hgc,, 87%., pore-lox1hgc,, 10%, pore-lox2hgc - 12% (. 3). GUS- (. 4).
9 1 2 1,8.. 0, Cre ( 0,8%- ), pore-lox2hgc: 1-5,, «6» -, 2. 1 ( 35S nptii), 0,3., 2, loxp ( nptii ), 1,8. (, loxp ) GUS- pore-lox1hgc GUS- pore-lox2hgc pore-lox1hgc pore-lox2hgc.
10 , gus loxp Cre ,, , loxp, Cre.,. 4.,. Cre/loxP.,. 1. Chong-Perez B. Heat shock induced excision of selectable marker genes in transgenic banana by the Cre-lox site-specific recombination system./b. Chong- Perez, R.G. Kosky, M. Reyes, [et. al.] // J Biotechnol Vol.159, No.4. P
11 2. Clough J. S. Floral dip: simplified method for agrobacterium-mediated transformation of Arabidopsis thaliana / J.S. Clough, F.A. Bent // Plant J Vol. 16, No. 6. P Darbani B. Methods to produce marker-free transgenic plants./ B. Darbani, A. Eimanifar, Jr. C.N. Stewart // Biotechnol. J Vol. 2. P Dellaporta S. L. A plant DNA minipreparation: version II./ S.L. Dellaporta, J.Wood, J.B. Hicks // Plant Mol. Biol. Rep Vol. 1. P Goodin J. Transgenic plants: methods and protocols. /J. Goodwin, G. Pastori, M. Davey, H. Jones // Methods Mol. Biol Vol P Grindley N.D. Mechanisms of site specific recombination. / N.D. Grindley, K.L. Whiteson, P.A. Rice // Annu Rev. Biochem Vol.75. P Herrera-Estella L. Chimeric genes as dominant selectable markers in plant cells. /L. Herrera-Estrella, M. De Block, E. Messens [et al.] // EMBO J Vol. 2. P Jefferson R.A. Assaying chimeric genes in plants: the GUS gene fusion system./ R. A. Jefferson // Plant Mol. Biol. Rep Vol. 5. P Kim H.-B. Development of a simple and efficient system for excision selectable markers in Arabidopsis using a minimal promoter::cre fusion construct./h.-b. Kim, J.-I. Cho, N. Ryoo,[ et al.] // Mol Cells Vol. 33, No.1. P Kopertekh L., Cre-mediated seed-specific transgene excision in tobacco./ L. Kopertekh, K. Schulze, A. Frolov, [et al.] // Plant Mol. Biol Vol.72. P Liu H.K. Heat shock-regulated site-specific excision of extraneous DNA in transgenic plants./h.k. Liu, C. Yang, Z.W. Wei // Plant Sci Vol.168. P Murashige T., Skoog F. A revised medium for rapid growth and bio assays with tobacco tissue cultures./ T.Murashige, F. Skoog // Phys Pla Vol.15, N3. P Sambrook J: Molecular cloning: a laboratory manual. / J. Sambrook // Cold Spring Harbor, N.Y.: - Cold Spring Harbor Laboratory pp 2100.
12 14. Wang Y. Recombinase technology: applications and possibilities/ Y. Wang, Y.- Y. Yau, D. Perkins-Balding, J.G. Thompson // Plant Cel Rep Vol.30. P Yemets A.I. Modified tubulin genes as selectable markers for plant transformation Biotechnology [Eds. Blume Ya.B., Baird W.V., Yemets A.I., Breviario D.] // The Plant Cytoskeleton: Key Tool for Agro P Zuo J. Chemical-regulated, site-specific DNA excision in transgenic plants./ J., Zuo, Q.W. Niu, S.G.Møller, N.H Chua. // Nat Biotechnol Vol.19, No.2. P /.,.,...:, Arabidopsis thaliana,, Cre/loxP 35S /.,. // Development of DNA-Constructions with Site-Specific Recombinase System Cre/loxP Under the Control of a 35S Promoter for Transformation of Arabidopsis Thaliana to Produce Marker-Free Plants A.S. Sekan, S.V. Isaenkov The results of the development the vector DNA-constructions with site-specific recombinase system Cre/loxP for agrobacterium transformation of Arabidopsis thaliana plants. It is showed the efficiency of using this approach for obtaining marker-free transformated plants. Key words: site-specific recombinase system Cre/loxP, genetic transformation, molecular genetic analysis, expression of the foreign genes.
13 Cre/loxP 35S, Arabidopsis thaliana.,., Cre/loxP Arabidopsis thaliana.,. : Cre/loxP,,,.
1. Introduction Drought stress and climate change Three strategies of plants in response to water stress 3
Contents 1. Introduction 1 1.1 Drought stress and climate change 3 1.2 Three strategies of plants in response to water stress 3 1.3 Three closely related species of Linderniaceae family are experimental
Supplementary information, Data S1 MATERIALS AND METHODS. Growth of Arabidopsis and rice plants
Supplementary information, Data S1 MATERIALS AND METHODS Growth of Arabidopsis and rice plants Arabidopsis thaliana ecotype Columbia (Col-0) was used in all experiments. Seeds were sown on MS plates and
Cre Stoplight with Living Colors is a faster, brighter
Cre Stoplight with Living Colors is a faster, brighter reporter for Cre recombinase. Drago A Guggiana-Nilo 1, Anne Marie Quinn 2,Thomas E. Hughes 1 1 Department of Cell Biology and Neuroscience, Montana
TRANSFORMATION OF TOBACCO (Nicotiana tabacum L.) AND BUSH MONKEYFLOWER (Mimulus aurantiacus Curtis)
University of Ljubljana Biotechnical Faculty Agronomy Department TRANSFORMATION OF TOBACCO (Nicotiana tabacum L.) AND BUSH MONKEYFLOWER (Mimulus aurantiacus Curtis) Nik Susič, Jana Murovec, Borut Bohanec
Supplementary information, Figure S1
Supplementary information, Figure S1 (A) Schematic diagram of the sgrna and hspcas9 expression cassettes in a single binary vector designed for Agrobacterium-mediated stable transformation of Arabidopsis
pri 201 DNA Series (High-Expression Vectors for Plant Transformation)
For Research Use Cat #. 3264 3265 3266 3267 pri 201 DNA Series (High-Expression Vectors for Plant Transformation) Product Manual Table of Contents I. Description... 3 II. Product Information... 3 III.
BIOTECHNOLOGY AGRICULTURE
Syllabus BIOTECHNOLOGY AGRICULTURE - 73534 Last update 19-10-2017 HU Credits: 3 Degree/Cycle: 2nd degree (Master) Responsible Department: biotechnology Academic year: 0 Semester: 2nd Semester Teaching
Plant Cell, Tissue and Organ Culture
Supplementary materials for Plant Cell, Tissue and Organ Culture Article tile: Agrobacterium mediated Genetic Transformation of Miscanthus sinensis Authors: Ok-Jin Hwang 1, Mi-Ae Cho 1, Yun-Jeong Han 1,
The case of switchgrass C. Neal Stewart, Jr.
Environmental and Regulatory Sustainability of Genetically Engineered Bioenergy Feedstocks The case of switchgrass C. Neal Stewart, Jr. nealstewart@utk.edu Biomass utilization is a multifactorial problem
oligonucleotide primers listed in Supplementary Table 2 and cloned into ppcr-script (Stratagene) before digestion
Supplementary Methods. Construction of BiFC vectors The full-length ARC3 cdna, ARC3 1-1794 and ARC3 1-1083 were amplified from ppcr-script/arc3 using the oligonucleotide primers listed in Supplementary
The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A.
The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A. tumefaciens to the plant inspired the promise that A. tumefaciens might
Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression
Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression LVP336 LVP336-PBS LVP339 LVP339-PBS LVP297 LVP297-PBS LVP013 LVP013-PBS LVP338 LVP338-PBS LVP027 LVP027-PBS LVP337 LVP337-PBS
Comparative study of EST-SSR, SSR, RAPD, and ISSR and their transferability analysis in pea, chickpea and mungbean
EUROPEAN ACADEMIC RESEARCH Vol. IV, Issue 2/ May 2016 ISSN 2286-4822 www.euacademic.org Impact Factor: 3.4546 (UIF) DRJI Value: 5.9 (B+) Comparative study of EST-SSR, SSR, RAPD, and ISSR and their transferability
Electroporated intact BY-2 tobacco culture cells as a model of transient expression study *.
Vol. 48 No. 3/2001 657661 QUARTERLY This work is dedicated to the memory of Professor Jacek Augustyniak Communication Electroporated intact BY-2 tobacco culture cells as a model of transient expression
Superexpression of tuberculosis antigens in plant leaves
Superexpression of tuberculosis antigens in plant leaves Tuberculosis Volume 87, Issue 3, May 2007, Pages 218-224 Yuri L. Dorokhov, a,, Anna A. Shevelevaa, Olga Y. Frolovaa, Tatjana V. Komarovaa, Anna
Arabidopsis nitrate transceptor NRT1.1
Multiple mechanisms of nitrate sensing by Arabidopsis nitrate transceptor NRT1.1 Bouguyon E 1, Brun F 1, Kubeš M 3, Meynard D 2, Pervent M 1, Leran S 1, Lacombe B 1, Krouk G 1, Guiderdoni E 2, Zažímalová
Supplementary Information for Synthetic circuits integrating logic and memory in living cells
Supplementary Information for Synthetic circuits integrating logic and memory in living cells Piro Siuti, John Yazbek and Timothy K. Lu a b AND + None AND + AHL c d AND + atc AND + atc GFP Supplementary
Intron distance to transcription start (nt)*
Schwab et al. SOM: Enhanced microrna accumulation through stemloop-adjacent introns 1 Supplemental Table 1. Characteristics of introns used in this study Intron name Length intron (nt) Length cloned fragment
Experimental Tools and Resources Available in Arabidopsis. Manish Raizada, University of Guelph, Canada
Experimental Tools and Resources Available in Arabidopsis Manish Raizada, University of Guelph, Canada Community website: The Arabidopsis Information Resource (TAIR) at http://www.arabidopsis.org Can order
cdna Cloning and Sequence Analysis of Rice Sbe1 and Sbe3 Genes
Rice Science, 2004, 11(3): 81 85 81 http://www.ricescience.info cdna Cloning and Sequence Analysis of Rice Sbe1 and Sbe3 Genes CHEN Xiu-hua 1, LIU Qiao-quan 1,2, WU Hsin-kan 1, WANG Zong-yang 3, GU Ming-hong
Mos1 insertion. MosTIC protocol-11/2006. repair template - Mos1 transposase expression - Mos1 excision - DSB formation. homolog arm.
MosTIC (Mos1 excision induced Transgene Instructed gene Conversion) Valérie Robert (vrobert@biologie.ens.fr) and Jean-Louis Bessereau (jlbesse@biologie.ens.fr) (November 2006) Introduction: MosTIC (Robert
PRODUCT INFORMATION. Composition of SOC medium supplied :
Product Name : Competent Cell BL21(DE3)pLysS Code No. : DS260 Size : 100 μl 10 Competency : > 5 10 7 cfu/μg (puc19) Supplied product : SOC medium, 1 ml 10 This product is for research use only Description
Application of gene targeting in plant functional genomics
16 4 2004 8 Chinese Bulletin of Life Sciences Vol. 16, No. 4 Aug., 2004 1004-0374(2004)04-0236-05 310006 (gene targeting) Q75 A Application of gene targeting in plant functional genomics WANG De-Kai, LI
AGROBACTERIUM - MEDIATED TRANSFORMATION OF SECONDARY SOMATIC EMBRYOS FROM ROSA HYBRIDA L. AND RECOVERY OF TRANSGENIC PLANTS
AGROBACTERIUM - MEDIATED TRANSFORMATION OF SECONDARY SOMATIC EMBRYOS FROM ROSA HYBRIDA L. AND RECOVERY OF TRANSGENIC PLANTS A. Borissova, T. Hvarleva, I. Bedzhov, V. Kondakova, A. Atanassov, I. Atanassov
Expression of spider silk and spider silk-like proteins in potato and tobacco
Expression of spider silk and spider silk-like proteins in potato and tobacco Dissertation zur Erlangung des akademischen Grades Doctor rerum naturalium (Dr. rer. nat.) vorgelegt der Naturwissenschaftlichen
Transformation of Lesquerella Fendleri with the New Binary Vector pgpro4-35s
OnLine Journal of Biological Sciences 11 (3): 90-95, 2011 ISSN 1608-4217 2011 G.Q. Chen et al., This open access article is distributed under a Creative Commons Attribution (CC-BY) 3.0 license Transformation
ksierzputowska.com Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster
Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster Research plan: Specific aims: 1. To successfully engineer transgenic Drosophila expressing TALENs
Molecular cloning of wasabi defensin gene into plasmid containing bar gene
Molecular cloning of wasabi defensin gene into plasmid containing bar gene Totik Sri Mariani 1), Raham Sher Khan 2), Ikuo Nakamura 2), Masahiro Mii 2) 1) School of Life Science and Technology, Bandung
Arabinose inducible prokaryotic recombinase expression plasmid
TECHNICAL PROTOCOL FOR Arabinose inducible prokaryotic recombinase expression plasmid psc101-bad-cre (A301) psc101-bad-dre (A302) psc101-bad-flpe (A303) Gene Bridges GmbH Im Neuenheimer Feld 584 69120
Supplemental Data. Yang et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Activities of the Cm-BBX24 promoter in response to hormone treatments and abiotic stresses in transgenic Arabidopsis plants. (A) Cis-element analysis of the Cm-BBX24 promoter. (B)
Genome manipulation by homologous recombination in Drosophila Xiaolin Bi and Yikang S. Rong Date received (in revised form): 9th May 2003
Xiaolin Bi is a post doctoral research fellow at the Laboratory of Molecular Cell Biology, National Cancer Institute, National Institutes of Health, Bethesda, Maryland, USA. Yikang S. Rong is the principal
TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:
Giovanna Gambarotta- Only for teaching purposes. TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random
NCERT. 2. An enzyme catalysing the removal of nucleotides from the ends of DNA is: a. endonuclease b. exonuclease c. DNA ligase d.
BIOTECHNOLOGY PRINCIPLES AND PROCESSES 75 CHAPTER 11 BIOTECHNOLOGY: PRINCIPLES AND PROCESSES 1. Rising of dough is due to: MULTIPLE-CHOICE QUESTIONS a. Multiplication of yeast b. Production of CO 2 c.
Fast-Link DNA Ligation Kits
Fast-Link DNA Ligation Kits Cat. Nos. LK0750H and LK6201H Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA086E Fast-Link DNA Ligation Kits 6/2017 1 1. Introduction The Fast-Link
Field Tests on Transgenic Potatoes in Mexico
The 3rd JlRCAS Symposium: The 4th International Symposium on the Biosafety Results of Field Tests Field Tests on Transgenic Potatoes in Mexico Victor M. Villalobos 1 and Rafael Rivera~Bustamante 1 Abstract
The HSP Terminator of Arabidopsis thaliana Increases Gene Expression in Plant Cells
The HSP Terminator of Arabidopsis thaliana Increases Gene Expression in Plant Cells Shingo Nagaya, Kazue Kawamura, Atsuhiko Shinmyo and Ko Kato Graduate School of Biological Sciences, Nara Institute of
TITLE: Mammary Specific Expression of Cre Recombinase Under the Control of an Endogenous MMTV LTR: A Conditional Knock-out System
AD Award Number: DAMD17-98-1-8233 TITLE: Mammary Specific Expression of Cre Recombinase Under the Control of an Endogenous MMTV LTR: A Conditional Knock-out System PRINCIPAL INVESTIGATOR: Rama Kudaravalli,
Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab
Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is
(Candidate Gene Selection Protocol for Pig cdna Chip Manufacture Using TIGR Gene Indices)
(Candidate Gene Selection Protocol for Pig Chip Manufacture Using TIGR Gene Indices) Chip Chip Chip Red Hat Linux 80 MySQL Perl Script TIGR(The Institute for Genome Research http://wwwtigrorg) SsGI (Sus
Theoretical cloning project
Theoretical cloning project Needed to get credits Make it up yourself, don't copy Possible to do in groups of 2-4 students If you need help or an idea, ask! If you have no idea what to clone, I can give
Rapid Generation of Selectable Marker-Free Transgenic Rice with Three Target Genes by Co-Transformation and Anther Culture
Rice Science, 2007, 14(4): 239-246 Copyright 2007, China National Rice Research Institute. Published by Elsevier BV. All rights reserved Rapid Generation of Selectable Marker-Free Transgenic Rice with
previously. co and fca-9 alleles were isolated from the Col background. Plants were
Supporting Online Material Materials and Methods Plant Growth Conditions The flc-3, FRI Sf2 -Col (S1), fve-4 (S2), ld-1 (S3) and fpa (S4) lines were described previously. co and fca-9 alleles were isolated
BL21(DE3) expression competent cell pack DS265. Component Code No. Contents Competent cell BL21(DE3) DS250 5 tubes (100 μl/tube)
Product Name : Code No. : Kit Component : BL21(DE3) expression competent cell pack DS265 Component Code No. Contents Competent cell BL21(DE3) DS250 5 tubes (100 μl/tube) transfromation efficiency: 5 10
Modification of vectors for functional genomic analysis in plants
Modification of vectors for functional genomic analysis in plants J.T. Li 1 *, G. Yu 1 *, X.H. Sun 1, C.G. Jia 1, Q. Du 2, Q.Y. Li 2 and H.Y. Pan 1 1 College of Plant Science, Jilin University, Changchun,
Testing GM crops. Mitesh Shrestha
Testing GM crops Mitesh Shrestha GMO food/feed testing is based on some fundamental principles of genetic engineering and cellular physiology: DNA: The introduction of foreign DNA into a recipient plant
species- Mus musculus Engineering the mouse genome David Ornitz
species- Mus musculus Engineering the mouse genome David Ornitz How do we analyze gene function in mice? Gene addition (transgenic approach) Permits GOF, DN and knockdown experiments Ectopic (spatial or
Plant Biotechnology I METHODOLOGY. Centre of the Region Haná for Biotechnological and Agricultural Research Olomouc, Czech Republic.
Plant Biotechnology I METHODOLOGY Centre of the Region Haná for Biotechnological and Agricultural Research Olomouc, Czech Republic Ivo Frébort Summary of the plant biotechnology lectures Plant Biotechnology
Review of previous work: Overview of previous work on DNA methylation and chromatin dynamics
CONTENTS Preface Acknowledgements Lists of Commonly Used Abbreviations Review of previous work: Overview of previous work on DNA methylation and chromatin dynamics Introduction Enzymes involved in DNA
THE RAY- MANUAL. Instructions for the construction of complex targeting vectors using RAY (rapid assembly in yeast) Thorsten Storck December '96
Thorsten Storck December '96 THE RAY- MANUAL Instructions for the construction of complex targeting vectors using RAY (rapid assembly in yeast) Principle of the method Genetic elements (selection markers,
TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:
TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random insertion 2- embryonic stem cell-mediated gene
Hammer blot-mediated RNA extraction: an inexpensive, labor-saving method to extract RNA for plant virus detection
Hammer blot-mediated RNA extraction: an inexpensive, labor-saving method to extract RNA for plant virus detection Md. Shamim Akhter et al. Online Supplementary Materials Supplementary methods Preparation
Cisgenics: : Green Genetic Engineering Technology via Rearrangement of Endogenous Functional Genetic Elements to Create Improved Grapevines
Cisgenics: : Green Genetic Engineering Technology via Rearrangement of Endogenous Functional Genetic Elements to Create Improved Grapevines D J Gray, S A Dhekney, Z T Li, D L Hopkins Mid-Florida Research
TRANSFORMATION EFFICIENCY ENHANCEMENT OF ARABIDOPSIS VACUUM INFILTRATION BY SURFACTANT APPLICATION AND APICAL INFLORESCENCE REMOVAL
Trakia Journal of Sciences, Vol. 8, No. 1, pp 19-26, 2010 Copyright 2009 Trakia University Available online at: http://www.uni-sz.bg ISSN 1313-7050 (print) ISSN 1313-3551 (online) Original Contribution
Lecture 15: Functional Genomics II
Lecture 15: Functional Genomics II High-throughput RNAi screens High-throughput insertional/chemical screens Homologous recombination (yeast and mouse) - Other methods in discerning gene function Activation
Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
Conditions for efficient transformation of tomato (Lycopersicon esculentum M.) cultivars with cry1a(c) gene of Bacillus thuringiensis
2018; 7(2): 1772-1776 E-ISSN: 2278-4136 P-ISSN: 2349-8234 JPP 2018; 7(2): 1772-1776 Received: 19-01-2018 Accepted: 22-02-2018 Biotechnology section, Central Instrumentation Laboratory, SDAU, S.K. Nagar,
Experimental genetics - 2 Partha Roy
Partha Roy Experimental genetics - 2 Making genetically altered animal 1) Gene knock-out k from: a) the entire animal b) selected cell-type/ tissue c) selected cell-type/tissue at certain time 2) Transgenic
Supporting Online Material
Supporting Online Material 1. Materials and Methods 2. Supporting online figures 3. Supporting online references 1. Material and Methods Plasmid constructs All AvrPphB and protease inactive AvrPphB() constructs
Summary Notification Information Format
BIJLAGE 12 Summary Notification Information Format A. General information A1. Details of notification Notification Number Member State Belgium Date of Acknowledgement Title of the Project Scientific field
GM (Genetically Modified) Plants. Background
1 GM (Genetically Modified) Plants Background Genetically modified crops (GM) have been used since 1996 in the U.S. GM crops contain foreign genetic material The DNA may be from another plant or from a
Transgenic Research (2006) 15: Ó Springer 2006 DOI /s
Transgenic Research (2006) 15:375 384 Ó Springer 2006 DOI 10.1007/s11248-006-0011-6 Removal of the selectable marker gene from transgenic tobacco plants by expression of Cre recombinase from a Tobacco
S1: MATERIALS AND METHODS TALEN
Supplemental File S1: MATERIALS AND METHODS TALEN design and synthesis TALEN target sites within the tomato PRO gene (Solyc11g011260.1) were identified using TAL Effector Nucleotide Targeter (TALE-NT)
Accepted 24 January, 2013
African Journal of Biotechnology Vol. 12(11), pp. 1203-1208, 13 March, 2013 Available online at http://www.academicjournals.org/ajb DOI: 10.5897/AJB12.2629 ISSN 1684 5315 2013 Academic Journals Full Length
BIOTECHNOLOGY TO GENERATE DISEASE RESISTANT, MATURE CITRUS AS A SERVICE. UF/IFAS, CREC, CRDF Janice Zale Ph.D. November 15, 2018
BIOTECHNOLOGY TO GENERATE DISEASE RESISTANT, MATURE CITRUS AS A SERVICE UF/IFAS, CREC, CRDF Janice Zale Ph.D. November 15, 2018 THE MATURE CITRUS FACILITY (MCF) TEAM BRIEF BIO Dual American, Canadian citizen
New Biological Approaches for Agriculture: A General Perspective
New Biological Approaches for Agriculture: A General Perspective Pere Puigdomènech Centre for Research in Agricultural Genomics. CSIC-IRTA-UAB-UB CRAG Building. Campus de la Universitat Autònoma de Barcelona
Trichome Development in Arabidopsis thaliana. II. lsolation and Complementation of the GLABROUSI Gene
The Plant Cell, Vol. 1, 1051-1055, November 1989 O 1989 American Society of Plant Physiologists Trichome Development in Arabidopsis thaliana. II. lsolation and Complementation of the GLABROUSI Gene Patricia
Fast-Link DNA Ligation Kits
Cat. Nos. LK11025, LK0750H, and LK6201H The provide reagents optimized for the construction of recombinant vectors in a short time. Ligation reactions require incubation for as little as 5 minutes at room
Refresher on gene expression - DNA: The stuff of life
Plant Pathology 602 Plant-Microbe Interactions Lecture 2 Molecular methods for studying hostpathogen interactions I Sophien Kamoun kamoun.1@osu.edu The Ohio State University Ohio Agricultural Research
Concept 13.1 Recombinant DNA Can Be Made in the Laboratory
13 Biotechnology Concept 13.1 Recombinant DNA Can Be Made in the Laboratory It is possible to modify organisms with genes from other, distantly related organisms. Recombinant DNA is a DNA molecule made
FOGA-III: HOW DOES GENETIC CHANGE HAPPEN? - NATURAL GENETIC ENGINEERING OF GENOME STRUCTURE
FOGA-III: HOW DOES GENETIC CHANGE HAPPEN? - NATURAL GENETIC ENGINEERING OF GENOME STRUCTURE Cells have a large toolbox of biochemical systems that carry out genome restructuring at all levels of complexity
Genome editing as a new powerful tool for wheat breeding
Genome editing as a new powerful tool for wheat breeding Vladimir Nekrasov 15 th WGIN Stakeholders Meeting Applying CRISPR Cas9 technology in model and crop plants Model plant: Crop plants: Nicotiana
TRANSFORMATION EFFECTIVENESS FOR Arabidopsis thaliana PLANTS BY DNA-CONSTRUCTIONS WITH SITE-SPECIFIC RECOMBINASE SYSTEM CRE/loxP
UDC 577.218:577.29 doi: 10.15407/biotech8.01.049 TRANSFORMATION EFFECTIVENESS FOR Arabidopsis thaliana PLANTS BY DNA-CONSTRUCTIONS WITH SITE-SPECIFIC RECOMBINASE SYSTEM CRE/loxP А. S. Sekan SO «Institute
Agrobacterium-mediated Genetic Transformation of Phalaenopsis bellina Using GFP and GUS Reporter Genes
Pertanika J. Sci. & Technol. 16 (2): 129-139 (2008) ISSN: 0128-7680 Universiti Putra Malaysia Press Agrobacterium-mediated Genetic Transformation of Phalaenopsis bellina Using GFP and GUS Reporter Genes
UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Plant Biotechnology. Time Allowed: 2 hours
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Plant Biotechnology Time Allowed: 2 hours Marking Scheme: Total
Optimization of Agrobacterium tumefaciens mediated genetic transformation protocol for aromatic rice
J. Bangladesh Agril. Univ. 7(2): 235 240, 2009 ISSN 1810-3030 Optimization of Agrobacterium tumefaciens mediated genetic transformation protocol for aromatic rice M. R. Hossain, L. Hassan, A. K. Patwary
Supplementary Methods
Caussinus and Gonzalez Supplementary Methods Mitotic clones Clones of NBs homozygous for numb 03235, mira ZZ176, pros 17 or apkc k06403 were generated by FLP/FRT mediated mitotic recombination (1). As
GUS Assays. 1. Label all tubes. Prepare solutions and have ready at hand.
GUS Assays I. Protein isolation A. Method for ~1g or more of tissue. 1. Label all tubes. Prepare solutions and have ready at hand. 2. Remove the tissue from the 80 o C freezer and thaw on ice. If the tissue
Single- and double-ssr primer combined analyses in rice
Single- and double-ssr primer combined analyses in rice J. Ma, S.C. Guan, Z. Zhang and P.W. Wang Biotechnology Center of Jilin Agricultural University, Changchun, China Corresponding author: P.W. Wang
Cloning of an ovule specific promoter from Arabidopsis thaliana and expression of β-glucuronidase
Indian Journal of Experimental Biology Vol. 46, April 2008, pp. 207-211 Cloning of an ovule specific promoter from Arabidopsis thaliana and expression of β-glucuronidase Vikrant Nain, Anju Verma a, Neeraj
Genome research in eukaryotes
Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics
MarkerGene TM -Glucuronidase (GUS) Reporter Gene Activity Detection Kit
Product Information Sheet MarkerGene TM -Glucuronidase (GUS) Reporter Gene Activity Detection Kit Product M0877 Marker Gene Technologies, Inc. University of Oregon Riverfront Research Park 1850 Millrace
CLONING OF BACTERIAL PCB-DEGRADING GENE INTO THE PLANTS
CLONING OF BACTERIAL PCB-DEGRADING GENE INTO THE PLANTS M. Surá 1, M. Macková 1, T. Macek 2, R. Borovka 1, M. Szekeres 3, S. Bancos 3 1 Institute of Chemical Technology Faculty of Food and Biochemical
2009 Annual Report. Technical Report
2009 Annual Report PI: Anireddy S.N. Reddy Organization: Colorado State University ONR Award Number: N000140810470 Award Title: Metabolic Engineering of Plants to Produce Precursors (Phloroglucinol and
Historical Perspective
Genetic transformation of E.Coli and selection, DNA recombination without ligase: topoisomerase, cre-lox recombination, Gate way method etc. DNA library: genomic library, cdna library, expression library,
The effectiveness of a particular antibiotic resistance system depends mainly on the following elements: [add a comment]
![The effectiveness of a particular antibiotic resistance system depends mainly on the following elements: [add a comment]](/thumbs/90/103914266.jpg "The effectiveness of a particular antibiotic resistance system depends mainly on the following elements: [add a comment]")
1 of 38 11/04/2007 4:13 PM Printable Version Antibiotic resistance genes and their uses in genetic transformation, especially in plants Originally Authored by: Carolina Roa Rodríguez and Carol Nottenburg
Barley as a model for cereal engineering and genome editing. Wendy Harwood
Barley as a model for cereal engineering and genome editing Wendy Harwood MonoGram 29 th April 2015 www.bract.org BRACT Transformation Platform Over-expression of single genes RNAi based silencing Promoter
Mouse Engineering Technology. Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology
Mouse Engineering Technology Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology Core service and new technologies Mouse ES core Discussions
Color-Switch CRE recombinase stable cell line
Color-Switch CRE recombinase stable cell line Catalog Number Product Name / Description Amount SC018-Bsd CRE reporter cell line (Bsd): HEK293-loxP-GFP- RFP (Bsd). RFP" cassette with blasticidin antibiotic
Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
IMPROVEMENT OF CRISPR GENE EDITING EFFICIENCY AND BEYONDS
IMPROVEMENT OF CRISPR GENE EDITING EFFICIENCY AND BEYONDS YONGLUN LUO (ALUN) ALUN@BIOMED.AU.DK VIB, NOV. 21. 2017 Associate Professor, Department of Biomedicine, Aarhus University, Denmark Executive Director,
Targeted complete next generation sequencing and quality control of transgenes and integration sites in CHO cell line development
Targeted Locus Amplification Technology Targeted complete next generation sequencing and quality control of transgenes and integration sites in CHO cell line development Cergentis B.V. Yalelaan 62 3584
BIO440 Genetics Laboratory Transformation
BIO440 Genetics Laboratory Transformation The transfer of genetic information between bacteria has been occurring for billions of years. Humans first noticed this process in the laboratory in the 1920
Certificate of Analysis
Certificate of Analysis Catalog No. Amount Lot Number 631986 10 μg Specified on product label. Product Information plvx-ef1α-mcherry-n1 is a lentiviral expression vector that can be used to generate high-titer
Supplemental information Precise A T to G C base editing in the rice genome
Supplemental information Precise A T to G C base editing in the rice genome Kai Hua, Xiaoping Tao, Fengtong Yuan, Dong Wang, Jian-Kang Zhu Contents Supplemental Figure 1. TA cloning results of two base
Te c htips. Simple Approaches for Optimization of RT-PCR TECH TIP 206
Te c htips TECH TIP 206 Fueling Innovation USB Corporation 26111 Miles Road Cleveland, Ohio 44128 800.321.9322 www.usbweb.com Simple Approaches for Optimization of RT-PCR Reverse transcription-polymerase
Supporting Online Material. Seeds were surface sterilized and plated on growth medium (GM)
Supporting Online Material Materials and Methods Seedling growth and measurements Seeds were surface sterilized and plated on growth medium (GM) without sucrose as described by Huq and Quail (2002) (S3).
A Simple Method for Transient Expression of Reporter Gene in Brinjal Leaves through Agroinfiltration
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 3 (2017) pp. 317-323 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.603.035
Methods to produce marker-free transgenic plants
Biotechnol. J. 2007, 2, 83 90 DOI 10.1002/biot.200600182 www.biotechnology-journal.com Review Methods to produce marker-free transgenic plants Behrooz Darbani 1, Amin Eimanifar 2, C. Neal Stewart, Jr.
Inducibility of dehydration responsive element (DRE)-based promoter through gusa expression in transgenic tobacco
Indian Journal of Biotechnology Vol 13, April 2014, pp 172-177 Inducibility of dehydration responsive element (DRE)-based promoter through gusa expression in transgenic tobacco Supratim Basu 1 and Aryadeep