Figure S4 A-H : Initiation site properties and evolutionary changes
|
|
|
- Sibyl Gilmore
- 6 years ago
- Views:
Transcription
1 A 0.3 Figure S4 A-H : Initiation site properties and evolutionary changes G-correction not used 0.25 Fraction of total counts tag 2 tags 3 tags 4 tags 5 tags 6 tags 7tags 8tags 9 tags >9 tags expected fraction AA AC AG AT CA CC CG CT GA GC GG GT TA TC TG TT B 0.3 G-correction used Initiation site usage, broken down by level of TSS CAGE support Fraction of total counts tag 2 tags 3 tags 4 tags 5 tags 6 tags 7tags 8tags 9 tags >9 tags expected fraction AA AC AG AT CA CC CG CT GA GC GG GT TA TC TG TT Initiation site usage, broken down by level of TSS CAGE support Figure 4 A-B. Dinucleotide distribution analysis of CTSS with varying CAGE tag support We analyzed the usage of different [-, +] dinucleotides relative to each CTSS in the data set (note that the - nucleotide is not part of the sequenced tag). We subdivided the cases in respect to how many tags the CTSS contained into 0 classes (,2,3 to 9 tags and 0 tags). As an additional reference class, we collected randomly selected start points in the genome (non-overlapping and not part of repetitive regions). This distribution will correspond to the expected distribution if start sites are random (noise). The frequency of all possible dinucleotides for the classes is shown as a barplot, with (panel B) or without G correction (panel A). The dinucleotide distribution is dramatically different from random selection, even with single CAGE tag support. We also note that there is a higher preference for INR-like CA dinucleotides when the transcript has a higher expression (i.e. more tag counts), while AG and GG dinucleotides are more favored in rarely expressed transcripts. Part of the GG dinucleotides corresponds to the GGG motif (before G correction) we found for the novel 3'UTR transcripts.this is true regardless of whether the CTSSs are subjected to G correction or not. The difference in dinucleotide use when the tag count is 5 is a rounding artifact in the G correction algorithm (which was designed for correcting larger tag counts). Regardless of this, the overall frequency pattern as a function of number of supporting tags is indicative of very low level of noise in the CAGE dataset: otherwise the preference for TSSs supported by one tag (singletons) would be much closer to that expected by chance, and different from the preference of TSSs supported by two or three tags.
2 Figure S4 A-H : Initiation site properties and evolutionary changes Fig. S4C-D Examples of pyrimidine-purine dinucleotides substitutions and effects. Gallery of barplots of mouse and human orthologous TCs illustrating dinucleotide substitutions and their effect on the start site usage. Y-axis indicate the number of CAGE tags starting at given genomic positions(x axis). Green arrows indicate the transition from a pyrimidine-purine start site to any other base combination. C Ccm gene Tag cluster T05F0003AFA6 D Wasf2 gene Tag cluster T04F07D7XFEE
3 Figure S4 A-H : Initiation site properties and evolutionary changes E Pfdn2 gene Tag cluster T0F04A379D63 F Jaridb gene Tag clustert0f08038b70
4 Figure S4 A-I : Initiation site properties and evolutionary changes G DBwg363 gene Tag cluster T0R048684BF H Grim9 gene Tag cluster T08R04BDDDA
5 Figure S4 A-I : Initiation site properties and evolutionary changes Mutation of a purine-purine dinuclotide to... 0e+2 0e-2 0e cases( 67.2 %) pu.pu>pu.pu 640 cases( 2.6 %) pu.pu>pu.py 56 cases( 3. %) pu.pu>py.pu 828 cases( 6.3 %) pu.pu>py.py 40 cases( 0.8 %) Mutation of a purine-pyrimidine dinuclotide to... 0e+2 0e-2 0e-5 49 cases( 5.3 %) pu.py>pu.pu 55 cases( 9 %) pu.py>pu.py 90 cases( %) pu.py>py.pu 80 cases( 9.8 %) pu.py>py.py 73 cases( 8.9 %) Mutation of a pyrimidine-pyrimidine dinuclotide to... 0e+2 0e-2 0e cases( 53 %) py.py>pu.pu 42 cases(.8 %) py.py>pu.py 78 cases( 3.4 %) py.py>py.pu 695 cases( 30 %) py.py>py.py 275 cases(.9 %) Mutation of a pyrimidine-purine dinuclotide to... 0e+2 0e-2 0e cases( 67.8 %) py.pu>pu.pu 048 cases( 7.7 %) py.pu>pu.py 36 cases( %) py.pu>py.pu 2362 cases( 7.3 %) py.pu>py.py 865 cases( 6.3 %) Fig. S4I Substitution effects on dinucleotides in core promoters. Boxplots show the effects of substitutions on initiation sites for all possible base combinations. Mutations are annotated relative to mouse (i.e. mouse to human). Boxplot generation and Y axis score is described in Methods. The four sections correspond to four different reference dinucleotides (Pu-Pu, Pu-Py, Py-Pu, Py-Py).
High-throughput Transcriptome analysis
High-throughput Transcriptome analysis CAGE and beyond Dr. Rimantas Kodzius, Singapore, A*STAR, IMCB rkodzius@imcb.a-star.edu.sg for KAUST 2008 Agenda 1. Current research - PhD work on discovery of new
Supplementary Figure 1
number of cells, normalized number of cells, normalized number of cells, normalized Supplementary Figure CD CD53 Cd3e fluorescence intensity fluorescence intensity fluorescence intensity Supplementary
Transcription factor binding site prediction in vivo using DNA sequence and shape features
Transcription factor binding site prediction in vivo using DNA sequence and shape features Anthony Mathelier, Lin Yang, Tsu-Pei Chiu, Remo Rohs, and Wyeth Wasserman anthony.mathelier@gmail.com @AMathelier
Human mirna controls * * Lim 2003 Berezikov Mouse mirna controls. Not sequenced. Not enough reads. Berezikov 2006b. Xie 2005
Chiang135681_FigureS3 hsa-mir-124-1 hsa-mir-125a hsa-mir-128-1 hsa-mir-142 hsa-mir-150 hsa-mir-192 hsa-mir-205 hsa-mir-214 hsa-mir-455 hsa-mir-483 hsa-mir-499 hsa-mir-888 hsa-mir-9-1 hsa-mir-220a cand141
DNA sequence and chromatin structure. Mapping nucleosome positioning using high-throughput sequencing
DNA sequence and chromatin structure Mapping nucleosome positioning using high-throughput sequencing DNA sequence and chromatin structure Higher-order 30 nm fibre Mapping nucleosome positioning using high-throughput
Gene splice sites correlate with nucleosome positions
Gene splice sites correlate with nucleosome positions Simon Kogan and Edward N. Trifonov* Genome Diversity Center, Institute of Evolution, University of Haifa, Mount Carmel, Haifa 31905, Israel Abstract
Chapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
Mutation Rates and Sequence Changes
s and Sequence Changes part of Fortgeschrittene Methoden in der Bioinformatik Computational EvoDevo University Leipzig Leipzig, WS 2011/12 From Molecular to Population Genetics molecular level substitution
Accelerating Genomic Computations 1000X with Hardware
Accelerating Genomic Computations 1000X with Hardware Yatish Turakhia EE PhD candidate Stanford University Prof. Bill Dally (Electrical Engineering and Computer Science) Prof. Gill Bejerano (Computer Science,
The Human Genome Project has always been something of a misnomer, implying the existence of a single human genome
The Human Genome Project has always been something of a misnomer, implying the existence of a single human genome Of course, every person on the planet with the exception of identical twins has a unique
Supplementary Information
Supplementary Information Supplementary Figure 1: The proportion of somatic SNVs in each tumor is shown in a trinucleotide context. The data represent 31 exome-sequenced osteosarcomas. Note that the mutation
Computational Technique for Improvement of the Position-Weight Matrices for the DNA/Protein Binding Sites
Wright State University CORE Scholar Physics Faculty Publications Physics 2005 Computational Technique for Improvement of the Position-Weight Matrices for the DNA/Protein Binding Sites Naum I. Gershenzon
Figure 1. FasterDB SEARCH PAGE corresponding to human WNK1 gene. In the search page, gene searching, in the mouse or human genome, can be done: 1- By
1 2 3 Figure 1. FasterD SERCH PGE corresponding to human WNK1 gene. In the search page, gene searching, in the mouse or human genome, can be done: 1- y keywords (ENSEML ID, HUGO gene name, synonyms or
Question 2: There are 5 retroelements (2 LINEs and 3 LTRs), 6 unclassified elements (XDMR and XDMR_DM), and 7 satellite sequences.
Bio4342 Exercise 1 Answers: Detecting and Interpreting Genetic Homology (Answers prepared by Wilson Leung) Question 1: Low complexity DNA can be described as sequences that consist primarily of one or
Systematic clustering of transcription start site landscapes Zhao, Xiaobei; Valen, Eivind; Parker, Brian J; Sandelin, Albin Gustav
university of copenhagen Københavns Universitet Systematic clustering of transcription start site landscapes Zhao, Xiaobei; Valen, Eivind; Parker, Brian J; Sandelin, Albin Gustav Published in: P L o S
Supplementary table 1: List of sequences of primers used in sequenom assay
Supplementary table 1: List of sequences of primers used in sequenom assay SNP_ID 2nd-PCRP Sequence 1st-PCRP Sequence Allele specific (iplex) iplex primer primer Direction ROCK2 1 rs978906 ACGTTGGATGATAAAGCTCTCTCGGCAGTC
Genome-Wide Survey of MicroRNA - Transcription Factor Feed-Forward Regulatory Circuits in Human. Supporting Information
Genome-Wide Survey of MicroRNA - Transcription Factor Feed-Forward Regulatory Circuits in Human Angela Re #, Davide Corá #, Daniela Taverna and Michele Caselle # equal contribution * corresponding author,
Computational Investigation of Gene Regulatory Elements. Ryan Weddle Computational Biosciences Internship Presentation 12/15/2004
Computational Investigation of Gene Regulatory Elements Ryan Weddle Computational Biosciences Internship Presentation 12/15/2004 1 Table of Contents Introduction.... 3 Goals..... 9 Methods.... 12 Results.....
Annotation of contig27 in the Muller F Element of D. elegans. Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans.
David Wang Bio 434W 4/27/15 Annotation of contig27 in the Muller F Element of D. elegans Abstract Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans. Genscan predicted six
Functional Annotation and Prioritization of Whole Exome and Whole Genome Sequencing Variants. Mulin Jun Li
Functional Annotation and Prioritization of Whole Exome and Whole Genome Sequencing Variants Mulin Jun Li 2017.04.19 Content Genetic variant, potential function impact and general annotation Regulatory
Identification of individual motifs on the genome scale. Some slides are from Mayukh Bhaowal
Identification of individual motifs on the genome scale Some slides are from Mayukh Bhaowal Two papers Nature 423, 241-254 (15 May 2003) Sequencing and comparison of yeast species to identify genes and
Creation of a PAM matrix
Rationale for substitution matrices Substitution matrices are a way of keeping track of the structural, physical and chemical properties of the amino acids in proteins, in such a fashion that less detrimental
Introduction to ChIP Seq data analyses. Acknowledgement: slides taken from Dr. H
Introduction to ChIP Seq data analyses Acknowledgement: slides taken from Dr. H Wu @Emory ChIP seq: Chromatin ImmunoPrecipitation it ti + sequencing Same biological motivation as ChIP chip: measure specific
BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES
BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES We sequenced and assembled a genome, but this is only a long stretch of ATCG What should we do now? 1. find genes What are the starting and end points for
Nature Genetics: doi: /ng Supplementary Figure 1. The pedigree information for American upland cotton breeding.
Supplementary Figure 1 The pedigree information for American upland cotton breeding. The integrated figure was modified from Fig. 1 to 10 in Calhoun, Bowman & May (1994). The accessions with blue color
ORTHOMINE - A dataset of Drosophila core promoters and its analysis. Sumit Middha Advisor: Dr. Peter Cherbas
ORTHOMINE - A dataset of Drosophila core promoters and its analysis Sumit Middha Advisor: Dr. Peter Cherbas Introduction Challenges and Motivation D melanogaster Promoter Dataset Expanding promoter sequences
Supplementary Information Targeting fidelity of adenine and cytosine base editors in mouse embryos
Supplementary Information ing fidelity of adenine and cytosine base s in mouse embryos Lee et al. a P = 1.012e-14 b Frequency (%) 100% 80% 60% 40% 20% 0% CB AB On-target Bystander Proximal Indels Frequency
Reviewers' Comments: Reviewer #1 (Remarks to the Author)
Reviewers' Comments: Reviewer #1 (Remarks to the Author) In this study, Rosenbluh et al reported direct comparison of two screening approaches: one is genome editing-based method using CRISPR-Cas9 (cutting,
Computational Genomics. Irit Gat-Viks & Ron Shamir & Haim Wolfson Fall
Computational Genomics Irit Gat-Viks & Ron Shamir & Haim Wolfson Fall 2015-16 1 What s in class this week Motivation Administrata Some very basic biology Some very basic biotechnology Examples of our type
Supplementary Material
Reverse Transcriptase-Mediated Tropism Switching in Bordetella Bacteriophage Minghsun Liu, Rajendar Deora, Sergei R. Doulatov, Mari Gingery, Frederick A. Eiserling, Andrew Preston, Duncan J. Maskell, Robert
Supplementary Figures
Supplementary Figures A B Supplementary Figure 1. Examples of discrepancies in predicted and validated breakpoint coordinates. A) Most frequently, predicted breakpoints were shifted relative to those derived
nature methods A paired-end sequencing strategy to map the complex landscape of transcription initiation
nature methods A paired-end sequencing strategy to map the complex landscape of transcription initiation Ting Ni, David L Corcoran, Elizabeth A Rach, Shen Song, Eric P Spana, Yuan Gao, Uwe Ohler & Jun
Systematic evaluation of spliced alignment programs for RNA- seq data
Systematic evaluation of spliced alignment programs for RNA- seq data Pär G. Engström, Tamara Steijger, Botond Sipos, Gregory R. Grant, André Kahles, RGASP Consortium, Gunnar Rätsch, Nick Goldman, Tim
Genomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
Statistical Methods for Quantitative Trait Loci (QTL) Mapping
Statistical Methods for Quantitative Trait Loci (QTL) Mapping Lectures 4 Oct 10, 011 CSE 57 Computational Biology, Fall 011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 1:00-1:0 Johnson
Mapping by recurrence and modelling the mutation rate
Current knowledge is from apping by recurrence and modelling the mutation rate Shamil Sunyaev Broad Institute of.i.t. and Harvard Comparative genomics Experimental systems: yeast reporter assays Potential
Axiom mydesign Custom Array design guide for human genotyping applications
TECHNICAL NOTE Axiom mydesign Custom Genotyping Arrays Axiom mydesign Custom Array design guide for human genotyping applications Overview In the past, custom genotyping arrays were expensive, required
Figure 7.1: PWM evolution: The sequence affinity of TFBSs has evolved from single sequences, to PWMs, to larger and larger databases of PWMs.
Chapter 7 Discussion This thesis presents dry and wet lab techniques to elucidate the involvement of transcription factors (TFs) in the regulation of the cell cycle and myogenesis. However, the techniques
MATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class
Thousands of corresponding human and mouse genomic regions unalignable in primary sequence contain. Elfar Þórarinsson February 2006
Thousands of corresponding human and mouse genomic regions unalignable in primary sequence contain common RNA structure Elfar Þórarinsson February 2006 It s interesting to note that: Approximately half
Gene Prediction in Eukaryotes
Gene Prediction in Eukaryotes Jan-Jaap Wesselink Biomol Informatics, S.L. jjw@biomol-informatics.com June 2010/Madrid jjw@biomol-informatics.com (BI) Gene Prediction June 2010/Madrid 1 / 34 Outline 1 Gene
Computational Genomics. Ron Shamir & Roded Sharan Fall
Computational Genomics Ron Shamir & Roded Sharan Fall 2012-13 Bioinformatics The information science of biology: organize, store, analyze and visualize biological data Responds to the explosion of biological
Minor Introns vs Major Introns
.... Minor Introns vs Major Introns Sebastian Bartschat Bioinformatics, Leipzig October 2009 table of content...1 introduction...2 two different types...3 classification of minor introns...4 results reminder
Introduction to BIOINFORMATICS
COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/
Transcription start site classification
Transcription start site classification Max Libbrecht, Matt Fisher, Roy Frostig, Hrysoula Papadakis, Anshul Kundaje, Serafim Batzoglou December 11, 2009 Abstract Understanding the mechanisms of gene expression
Result Tables The Result Table, which indicates chromosomal positions and annotated gene names, promoter regions and CpG islands, is the best way for
Result Tables The Result Table, which indicates chromosomal positions and annotated gene names, promoter regions and CpG islands, is the best way for you to discover methylation changes at specific genomic
Mammalian non-cg methylations are conserved and cell-type specific and may have been involved in the evolution of transposon elements
Mammalian non-cg methylations are conserved and cell-type specific and may have been involved in the evolution of transposon elements Weilong Guo, Michael Zhang, Hong Wu Supplementary Figures Fig. S1-S16
Promoter Architectures and Developmental Gene Regulation
Promoter Architectures and Developmental Gene Regulation Vanja Haberle a,b,1 and Boris Lenhard a,* a Institute of Clinical Sciences and MRC Clinical Sciences Center, Faculty of Medicine, Imperial College
Functional microrna targets in protein coding sequences. Merve Çakır
Functional microrna targets in protein coding sequences Martin Reczko, Manolis Maragkakis, Panagiotis Alexiou, Ivo Grosse, Artemis G. Hatzigeorgiou Merve Çakır 27.04.2012 microrna * micrornas are small
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact
BTRY 7210: Topics in Quantitative Genomics and Genetics
BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu January 29, 2015 Why you re here
User s Manual Version 1.0
User s Manual Version 1.0 University of Utah School of Medicine Department of Bioinformatics 421 S. Wakara Way, Salt Lake City, Utah 84108-3514 http://genomics.chpc.utah.edu/cas Contact us at issue.leelab@gmail.com
Mapping strategies for sequence reads
Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements
Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4
WHITE PAPER Oncomine Comprehensive Assay Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 Contents Scope and purpose of document...2 Content...2 How Torrent
On the sequence specificity of apoptotic nucleases. Haifa-NP 2012
Max Planck Institute of Psychiatry Munich Germany On the sequence specificity of apoptotic nucleases Haifa-NP 2012 Thomas ettecken Nucleosomes and Chromatin DNA in the nucleus is packaged into nucleosomes
Supplementary Figure 1 Strategy for parallel detection of DHSs and adjacent nucleosomes
Supplementary Figure 1 Strategy for parallel detection of DHSs and adjacent nucleosomes DNase I cleavage DNase I DNase I digestion Sucrose gradient enrichment Small Large F1 F2...... F9 F1 F1 F2 F3 F4
Annotation of Contig8 Sakura Oyama Dr. Elgin, Dr. Shaffer, Dr. Bednarski Bio 434W May 2, 2016
Annotation of Contig8 Sakura Oyama Dr. Elgin, Dr. Shaffer, Dr. Bednarski Bio 434W May 2, 2016 Abstract Contig8, a 45 kb region of the fourth chromosome of Drosophila ficusphila, was annotated using the
Traditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding.
1 Introduction What is Genomic selection and how does it work? How can we best use DNA data in the selection of cattle? Mike Goddard 5/1/9 University of Melbourne and Victorian DPI of genomic selection
An introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy
An introduction to RNA-seq Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy The central dogma Genome = all DNA in an organism (genotype) Transcriptome = all RNA (molecular
132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, This exposition is based on the following source, which is recommended reading:
132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, 214 1 Gene Prediction Using HMMs This exposition is based on the following source, which is recommended reading: 1. Chris Burge and Samuel
Grundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, This exposition is based on the following source, which is recommended reading:
Grundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, 211 155 12 Gene Prediction Using HMMs This exposition is based on the following source, which is recommended reading: 1. Chris Burge and Samuel
(Practical) Bioinformatics for CRISPR/Cas9
(Practical) Bioinformatics for CRISPR/Cas9 Jacob Corn IGI Workshop 2016 Bioinformatics is (mostly) things you could do yourself Just done very fast What makes these guides different? GAGTCCGAGCAGAAGAAGAA
amplification High Resolution Melt Parameter Considerations for Optimal Data Resolution tech note 6009
amplification tech note 6009 High Resolution Melt Parameter Considerations for Optimal Data Resolution Carl Fisher, Ray Meng, Francisco Bizouarn, and Rachel Scott Gene Expression Division, Bio-Rad Laboratories,
Midterm exam BIOSCI 113/244 WINTER QUARTER,
Midterm exam BIOSCI 113/244 WINTER QUARTER, 2005-2006 Name: Instructions: A) The due date is Monday, 02/13/06 before 10AM. Please drop them off at my office (Herrin Labs, room 352B). I will have a box
Module 2: Core Bioinformatics FINAL EXAM SOLUTIONS
Master in Bioinformatics January 9th, 2013 Universitat Autònoma de Barcelona Module 2: Core Bioinformatics FINAL EXAM SOLUTIONS Question 1: What is the statement that does NOT apply to the FASTA format?
Genome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
Non-conserved intronic motifs in human and mouse are associated with a conserved set of functions
Non-conserved intronic motifs in human and mouse are associated with a conserved set of functions Aristotelis Tsirigos Bioinformatics & Pattern Discovery Group IBM Research Outline. Discovery of DNA motifs
Genetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT
GBinsight Sample Name: GB4408 Race: East Asian Gender: Female Reason for Testing: Family history of premature CAD MRN: 0123456790 Specimen: Saliva Received: 07/26/2016 Test ID: 113-1487118782-1 Test: Dyslipidemia
In 1996, the genome of Saccharomyces cerevisiae was completed due to the work of
Summary: Kellis, M. et al. Nature 423,241-253. Background In 1996, the genome of Saccharomyces cerevisiae was completed due to the work of approximately 600 scientists world-wide. This group of researchers
EECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 08: Gene finding aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggc tatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatt
Scoring Alignments. Genome 373 Genomic Informatics Elhanan Borenstein
Scoring Alignments Genome 373 Genomic Informatics Elhanan Borenstein A quick review Course logistics Genomes (so many genomes) The computational bottleneck Python: Programs, input and output Number and
Solutions will be posted on the web.
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 7 FRIDAY December 3,
Nature Methods: doi: /nmeth.4396
Supplementary Figure 1 Comparison of technical replicate consistency between and across the standard ATAC-seq method, DNase-seq, and Omni-ATAC. (a) Heatmap-based representation of ATAC-seq quality control
Introduction to Transcription Factor Binding Sites (TFBS) Cells control the expression of genes using Transcription Factors.
Identification of Functional Transcription Factor Binding Sites using Closely Related Saccharomyces species Scott W. Doniger 1, Juyong Huh 2, and Justin C. Fay 1,2 1 Computation Biology Program and 2 Department
MODULE TSS1: TRANSCRIPTION START SITES INTRODUCTION (BASIC)
MODULE TSS1: TRANSCRIPTION START SITES INTRODUCTION (BASIC) Lesson Plan: Title JAMIE SIDERS, MEG LAAKSO & WILSON LEUNG Identifying transcription start sites for Peaked promoters using chromatin landscape,
Prioritization: from vcf to finding the causative gene
Prioritization: from vcf to finding the causative gene vcf file making sense A vcf file from an exome sequencing project may easily contain 40-50 thousand variants. In order to optimize the search for
Outline. Gene Finding Questions. Recap: Prokaryotic gene finding Eukaryotic gene finding The human gene complement Regulation
Tues, Nov 29: Gene Finding 1 Online FCE s: Thru Dec 12 Thurs, Dec 1: Gene Finding 2 Tues, Dec 6: PS5 due Project presentations 1 (see course web site for schedule) Thurs, Dec 8 Final papers due Project
Supporting Information
Supporting Information Schnall-Levin et al. 10.1073/pnas.1006172107 SI Text Cell Transfections. S2R þ cells were maintained in Schneider s medium (Invitrogen), supplemented with 10% FBS and 1% pen-strep.
9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3
cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences
Retracing transcription regulatory activities that control expression and chromatin dynamics
Retracing transcription regulatory activities that control expression and chromatin dynamics Basel Biozentrum Erik van Nimwegen Biozentrum, University of Basel, and Swiss Institute of Bioinformatics Transcription
Prediction of noncoding RNAs with RNAz
Prediction of noncoding RNAs with RNAz John Dzmil, III Steve Griesmer Philip Murillo April 4, 2007 What is non-coding RNA (ncrna)? RNA molecules that are not translated into proteins Size range from 20
Applied Bioinformatics - Lecture 16: Transcriptomics
Applied Bioinformatics - Lecture 16: Transcriptomics David Hendrix Oregon State University Feb 15th 2016 Transcriptomics High-throughput Sequencing (deep sequencing) High-throughput sequencing (also
Comparative Genomics. Page 1. REMINDER: BMI 214 Industry Night. We ve already done some comparative genomics. Loose Definition. Human vs.
Page 1 REMINDER: BMI 214 Industry Night Comparative Genomics Russ B. Altman BMI 214 CS 274 Location: Here (Thornton 102), on TV too. Time: 7:30-9:00 PM (May 21, 2002) Speakers: Francisco De La Vega, Applied
COMPAS for the Analysis of SELEX Experiments
COMPAS for the Analysis of SELEX Experiments COMPAS (COMmon PAtternS) is a software tool that was especially developed to harness the technology of next generation sequencing (NGS) to bring light into
Annotation of contig62 from Drosophila elegans Dot Chromosome
Abstract: Annotation of contig62 from Drosophila elegans Dot Chromosome 1 Maxwell Wang The goal of this project is to annotate the Drosophila elegans Dot chromosome contig62. Contig62 is a 32,259 bp contig
Edinburgh Research Explorer
Edinburgh Research Explorer Mice and men Citation for published version: Bajic, VB, Tan, SL, Christoffels, A, Schönbach, C, Lipovich, L, Yang, L, Hofmann, O, Kruger, A, Hide, W, Kai, C, Kawai, J, Hume,
Genetic characterization and polymorphism detection of casein genes in Egyptian sheep breeds
Genetic characterization and polymorphism detection of casein genes in Egyptian sheep breeds Othman E. Othman and Samia A. El-Fiky Cell Biology Department - National Research Center - Dokki - Egypt Corresponding
Selective constraints on noncoding DNA of mammals. Peter Keightley Institute of Evolutionary Biology University of Edinburgh
Selective constraints on noncoding DNA of mammals Peter Keightley Institute of Evolutionary Biology University of Edinburgh Most mammalian noncoding DNA evolves rapidly Homo-Pan Divergence (%) 1.5 1.25
Use of a neural network to predict normalized signal strengths from a DNA-sequencing microarray
www.bioinformation.net Volume 13(9) Hypothesis Use of a neural network to predict normalized signal strengths from a DNA-sequencing microarray Charles Chilaka 1, 5, Steven Carr 2, 3, *, Nabil Shalaby 3,
Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.
Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out
What I hope you ll learn. Introduction to NCBI & Ensembl tools including BLAST and database searching!
What I hope you ll learn Introduction to NCBI & Ensembl tools including BLAST and database searching What do we learn from database searching and sequence alignments What tools are available at NCBI What
Biology Evolution: Mutation I Science and Mathematics Education Research Group
a place of mind F A C U L T Y O F E D U C A T I O N Department of Curriculum and Pedagogy Biology Evolution: Mutation I Science and Mathematics Education Research Group Supported by UBC Teaching and Learning
Evolutionary Mechanisms
Evolutionary Mechanisms Tidbits One misconception is that organisms evolve, in the Darwinian sense, during their lifetimes Natural selection acts on individuals, but only populations evolve Genetic variations
Supporting Information
Supporting Information Geggier and Vologodskii 10.1073/pnas.1004809107 SI Text Sequences of DNA Fragments Used in the Current Study. The sequence names correspond to those mentioned in the text. For each
Machine learning applications in genomics: practical issues & challenges. Yuzhen Ye School of Informatics and Computing, Indiana University
Machine learning applications in genomics: practical issues & challenges Yuzhen Ye School of Informatics and Computing, Indiana University Reference Machine learning applications in genetics and genomics
Supporting Information
Supporting Information Table S1. Overview of samples used for sequencing, and the number of sequences obtained from each sample. Visit 1 is day 0, Visit 2 is day 7, Visit 3 is day 28, and Visit 4 is day
Computational Systems Biology Deep Learning in the Life Sciences
Computational Systems Biology Deep Learning in the Life Sciences 6.802 6.874 20.390 20.490 HST.506 Christina Ji April 6, 2017 DanQ: a hybrid convolutional and recurrent deep neural network for quantifying