Supplementary Figure 1
|
|
|
- Millicent Pope
- 6 years ago
- Views:
Transcription
1 number of cells, normalized number of cells, normalized number of cells, normalized Supplementary Figure CD CD53 Cd3e fluorescence intensity fluorescence intensity fluorescence intensity Supplementary Figure Antibody staining for excluded surface markers. Stained EL cells (red) compared to unstained cells (black) for the three cell surface markers expressed at low levels in EL cells and therefore not included in subsequent analyses. Nature Biotechnology: doi:0.03/nbt.306
2 Supplementary Figure a pxpr-0 psi+gag RRE h-u6 EGFP sgrna PGK Puromycin A EGFP WPRE b cell line + pxpr-0 cell line + pxpr-0 + Cas9 MOLM3 NB TF Supplementary Figure pxpr-0, Cas9 activity test vector. (a) Vector schematic of pxpr- 0. (b) FACS plots indicating the percentage of GFP negative cells in parental cells transduced with pxpr0 compared to Cas9 and pxpr-0 expressing cells. Nature Biotechnology: doi:0.03/nbt.306
3 Supplementary Figure 3 CD33 CD TF: sgrna percent rank TF: sgrna percent rank NB: sgrna percent rank MOLM3: sgrna percent rank Supplementary Figure 3 sgrna concordance across cell lines. Spearman rank correlation of 0.90 (left panel) and 0.76 (right panel). Nature Biotechnology: doi:0.03/nbt.306
4 Supplementary Figure a pooled Thy Cd5 Cd3 Day arrayed knockout (%) b 50 0 Thy Cd5 Cd3 % Knockout % Frameshift Alleles Supplementary Figure Activity of 7 sgrnas in arrayed format. (a) Scatter plot of markernegative fold enrichment values from the mouse pooled screen plotted against percent gene knockout as measured by flow cytometry in arrayed format. (b) Scatter plot of percent gene knockout as measured by flow cytometry plotted against the percentage of total sequenced alleles containing a frameshift, as measured by next generation sequencing of gdna following introduction of the sgrna. Nature Biotechnology: doi:0.03/nbt.306
5 Supplementary Figure CD bottom of the y-axis. The box around the sgrnas in Cd5 exons 3-6 indicate exons 30 isoform of this gene, Ref Seq 3 3 shown as lines on the x-axis with gaps 33 or other regions of low activity that were excluded from activity modeling are indicated in gray. Boundary sgrnas (green) are those where the cut site, Nature Biotechnology: doi:0.03/nbt n t annotated regions (e.g. CDS/intron). CD n t Supplementary Figure 5 Activity maps of sgrna by cut site position. (a) Cd5 and Cd5 in EL cells. All sgrnas with fold
6 Supplementary Figure 5, continued 6 6 Cd3 Cd nt nt Mouse Human Intron Boundary CDS Excluded CDS MOLM3 - CD33 6 MOLM3 - CD nt nt TF - CD33 6 TF - CD Nature Biotechnology: doi:0.03/nbt nt nt
7 Supplementary Figure 6.0 average sgrna activity (percent rank) Protein Length (%) Supplementary Figure 6 Activity as a function of protein length. The average sgrna percent rank is displayed for each protein quintile. For Cd5, the alternative transcript NM_0066. was used to annotate the coding sequence and thus exons 3 6 were excluded (see Supplementary Figure 5). Nature Biotechnology: doi:0.03/nbt.306
8 Supplementary Figure 7 6 Fold Enrichment Distance from CDS Supplementary Figure 7 sgrna activity as a function of cut site distance from exon/intron boundary in the mouse pool. Each dot indicates an sgrna with a cut position at the indicated distance from the CDS. The solid horizontal line at each position indicates the mean enrichment score for that distance from the CDS. The dotted horizontal line indicates 0-fold enrichment. Nature Biotechnology: doi:0.03/nbt.306
9 Supplementary Figure 00 Percentile sense antisense least active most active sgrna Activity Supplementary Figure Activity as a function of DNA target strand. sgrna activity bins by quintile. After correcting for multiple comparisons, no bin achieves statistical significance (p-values, Chi-squared test: Q = ; Q = 0.03; Q3 = 0.7; Q = 0.6; Q5 = 0.). Nature Biotechnology: doi:0.03/nbt.306
10 Supplementary Figure 9 0, mouse + human sgrnas (log p-value) 6 Favored 6 6 Disfavored mouse sgrnas (log p-value) Supplementary Figure 9 Stability of observed base preferences. Comparison of the p-values for all single nucleotide features using only the data from the 6 mouse genes (959 sgrnas) to the p-values obtained for all 9 human and mouse genes (, sgrnas, Fig. 3a), showing that nearly doubling the data size and adding a different species does not appreciably alter the Nature Biotechnology: doi:0.03/nbt.306
11 Supplementary Figure 0 00 Percentile Least Lethal Q3 Q Most Lethal least active most active sgrna Predicted Score Supplementary Figure 0 Predicted activity scores of sgrnas targeting essential genes in A375 cells. Sequence feature weights (Supplementary Table 9) were used to compute predicted activity scores for a set of sgrnas targeting essential gene classes in a previouslypublished genome-wide CRISPR screen9. Predicted-activity scores are binned by quintile where a score of are the sgrnas predicted to be most active. sgrna effect on cell viability is binned by quartile where Q indicates most-lethal sgrnas. Nature Biotechnology: doi:0.03/nbt.306
12 Supplementary Table Sequences of the 3 sgrnas designed to target H-D that gave greater than 0-fold enrichment in the marker-negative population for H-K. Mismatches to H-K are bolded and underlined. Off-target scores were obtained from crispr.mit.edu, accessed April, 0. Data from Hsu et al. were used to calculate the score, as described on the webserver. A score of 00 indicates an sgrna predicted to have an off-target effect. Spacer Fold+Enrichment H+D5target5sequence Off+target5site5in5H+K Off+target5Score HD$ GGTCTGAGTCGGGGCCAGGG GGTCTGAGTCGGAGCCAGGG 3.7 HD$0 6.3 CGGGAAACACAGAAAGCCAA CGGGAGACACAGAAAGCCAA 6 HD$03.6 GGCCCCGACTCAGACCCGCG GGCTCCGACTCAGACCCGCG 00.0 HD$0 3.5 AGATGTACCGGGGCTCCTCG CCATGTACCGGGGCTCCCCG 0.7 HD$05. GCCCCGACTCAGACCCGCGC GCTCCGACTCAGACCCGCGC 9.6 HD$ TGCTCCATCCACGGCGCCCG TGCTCCATCCACCGCGCCCG 3.7 HD$ CACGCACTCGCCCTCCAGGT CACGCACGTGCCCTCCAGGT 3. HD$ CGGCTACTACAACCAGAGCG CGGCTACTACAACCAGAGCA.7 HD$ CCTGCTGCTGGCGGCCGCCC CCTGCTGTTGGCGGCCGCCC 00.0 HD$ CTCGAGGCCGGGCCGGGACA CCCGAGGCCGGGCCGGGACA 00.0 HD$.90 GGCGCCCGCGGCTCATATCT CGCGCCCGCGGCTCATATCT 00.0 HD$.3 GCGCCGTGGATGGAGCAGGA GCGCGGTGGATGGAGCAGGA 00.0 HD$3 0. CAGTGGACGGAGGAGGCTCT CAGTGGATGGAGGAGGCTCT 00.0 Nature Biotechnology: doi:0.03/nbt.306
13 Supplementary,Table,5 List of sgrnas used in arrayed validation (Supplementary Fig. ). The percent-rank values used later for predictive modeling are also included; Thy-sg5 was excluded from the percent rank calculation because it contains a run of thymidines, and as expected has very low activity. Name Sequence %,Frameshift,by, Sequencing %,KO,by,FACS Percent,Rank,in, Flow,Cytometry, Screen Cd5% GTAGCAGAAATCTTATATCG.3% 0.90% Cd5% TGTAATTTGTTTGGGCACGA 3.6%.9% 0.6 Cd5%3 CAACTAGGCTTAGGCGTTTC.9% 0.77% 0.6 Cd5% AAACGCCTAAGCCTAGTTGT.3%.55% Cd5%5 CCCTACTTGCCTATGTCAAT.5% 6.7% Cd5%6 TCCCATTGACATAGGCAAGT.90%.7% 0.70 Cd3% GACTGTCTGGGCTCGCCACC 7.75% 3.00% 0. Cd3% GTCGTCCTCTGCAGACTGTC 3.9%.9% 0.07 Cd3%3 AACTGATGGGCTGGCATTCT.79%.7% 0.05 Cd3% TGGGATTGTGGTCTGCCCCC 9.% 5.60% 0.76 Cd3%5 GGACCCAGCATGCCCCAAAG.63% 7.55% 0. Cd3%6 ACTTGGAGCTGTGATATGTG 5.03% 33.5% Thy% GGAGAGCGACGCTGATGGCT.3% 3.0% 6 Thy% GAGCAGGAGAGCGACGCTGA.9%.65% Thy%3 GGTGAACCAAAACCTTCGCC 6.73%.30% Thy% CATGGCGGCAGTCCAGGCGA.% 7.35% Thy%5 GGCGAAGGTTTTGGTTCACC 6.5%.% Nature Biotechnology: doi:0.03/nbt.306
14 Supplementary,Table,6 Annotation of exon sequences used to make activity maps in Fig. b and Supplementary Fig. 5. Gene,Symbol Ensembl,Transcript,ID, Exon, number, Ensembl,Exon,ID Cd ENSMUST ENSMUSE ENSMUSE ENSMUSE ENSMUSE Cd5 ENSMUST ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE Thy ENSMUST ENSMUSE ENSMUSE ENSMUSE ENSMUSE HK ENSMUST ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE Cd3 ENSMUST ENSMUSE ENSMUSE Cd5 ENSMUST ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE ENSMUSE00000 ENSMUSE CD5 ENST ENSE CD3 ENST ENSE ENSE ENSE ENSE ENSE ENSE ENSE ENSE ENSE ENSE ENSE ENSE ENSE ENSE ENSE ENSE ENSE ENSE ENSE ENSE ENSE CD33 ENST ENSE ENSE ENSE ENSE ENSE ENSE ENSE Nature Biotechnology: doi:0.03/nbt.306
15 Supplementary,Table,9 Feature weights from the final model used to score sgrnas. See Methods for additional details on the implementation of these values for scoring sgrnas. Feature Coefficient Intercept G A C C C G A C C G A A C A C T6 99 A G C G A C G T G T C T T C G T A C T G T C G GT GC AA TA GG GG TA TC TT GG GA GC TG GG TC CC TG AC 6093 CG GA GG TC CG3 697 CT AA 9799 AG AG CG TG GT GG gc_low gc_high Nature Biotechnology: doi:0.03/nbt.306
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Negative selection analysis of sgrnas targeting all Brd4 exons comparing day 2 to day 10 time points. Systematic evaluation of 64 Brd4 sgrnas in negative selection experiments, targeting
Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm
Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Anja Smith Director R&D Dharmacon, part of GE Healthcare Imagination at work crrna:tracrrna program Cas9 nuclease Active crrna is
(Practical) Bioinformatics for CRISPR/Cas9
(Practical) Bioinformatics for CRISPR/Cas9 Jacob Corn IGI Workshop 2016 Bioinformatics is (mostly) things you could do yourself Just done very fast What makes these guides different? GAGTCCGAGCAGAAGAAGAA
Figure S4 A-H : Initiation site properties and evolutionary changes
A 0.3 Figure S4 A-H : Initiation site properties and evolutionary changes G-correction not used 0.25 Fraction of total counts 0.2 0.5 0. tag 2 tags 3 tags 4 tags 5 tags 6 tags 7tags 8tags 9 tags >9 tags
Supplementary Information Targeting fidelity of adenine and cytosine base editors in mouse embryos
Supplementary Information ing fidelity of adenine and cytosine base s in mouse embryos Lee et al. a P = 1.012e-14 b Frequency (%) 100% 80% 60% 40% 20% 0% CB AB On-target Bystander Proximal Indels Frequency
i-stop codon positions in the mcherry gene
Supplementary Figure 1 i-stop codon positions in the mcherry gene The grnas (green) that can potentially generate stop codons from Trp (63 th and 98 th aa, upper panel) and Gln (47 th and 114 th aa, bottom
Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna
Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna expression. It contains a U6-promoter-driven sgrna
Mammalian non-cg methylations are conserved and cell-type specific and may have been involved in the evolution of transposon elements
Mammalian non-cg methylations are conserved and cell-type specific and may have been involved in the evolution of transposon elements Weilong Guo, Michael Zhang, Hong Wu Supplementary Figures Fig. S1-S16
Transcription factor binding site prediction in vivo using DNA sequence and shape features
Transcription factor binding site prediction in vivo using DNA sequence and shape features Anthony Mathelier, Lin Yang, Tsu-Pei Chiu, Remo Rohs, and Wyeth Wasserman anthony.mathelier@gmail.com @AMathelier
Reprogramming MHC specificity by CRISPR-Cas9-assisted cassette exchange
1 Supplementary Materials Reprogramming MHC specificity by CRISPR-Cas9-assisted cassette exchange 3 4 5 6 Authors William Kelton 1, Ann Cathrin Waindok 1, Theresa Pesch 1, Mark Pogson 1, Kyle Ford 1, Cristina
Supplementary Figure 1 Activities of ABEs using extended sgrnas in HEK293T cells.
Supplementary Figure 1 Activities of ABEs using extended sgrnas in HEK293T cells. Base editing efficiencies of ABEs with extended sgrnas at Site 18 (a), Site 19 (b), the HBB-E2 site (c), and the HBB-E3
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
Nature Immunology: doi: /ni.3694
Supplementary Figure 1 Expression of Bhlhe41 and Bhlhe40 in B cell development and mature B cell subsets. (a) Scatter plot showing differential expression of genes between splenic B-1a cells and follicular
Supplementary table 1: List of sequences of primers used in sequenom assay
Supplementary table 1: List of sequences of primers used in sequenom assay SNP_ID 2nd-PCRP Sequence 1st-PCRP Sequence Allele specific (iplex) iplex primer primer Direction ROCK2 1 rs978906 ACGTTGGATGATAAAGCTCTCTCGGCAGTC
Human mirna controls * * Lim 2003 Berezikov Mouse mirna controls. Not sequenced. Not enough reads. Berezikov 2006b. Xie 2005
Chiang135681_FigureS3 hsa-mir-124-1 hsa-mir-125a hsa-mir-128-1 hsa-mir-142 hsa-mir-150 hsa-mir-192 hsa-mir-205 hsa-mir-214 hsa-mir-455 hsa-mir-483 hsa-mir-499 hsa-mir-888 hsa-mir-9-1 hsa-mir-220a cand141
Supplementary Material
Reverse Transcriptase-Mediated Tropism Switching in Bordetella Bacteriophage Minghsun Liu, Rajendar Deora, Sergei R. Doulatov, Mari Gingery, Frederick A. Eiserling, Andrew Preston, Duncan J. Maskell, Robert
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use
Supplementary Figure 1. NORAD expression in mouse (A) and dog (B). The black boxes indicate the position of the regions alignable to the 12 repeat
Supplementary Figure 1. NORAD expression in mouse (A) and dog (B). The black boxes indicate the position of the regions alignable to the 12 repeat units in the human genome. Annotated transposable elements
Supplementary Figure 1. Supporting data for Figure 1
Supplementary Figure 1 Supporting data for Figure 1 (A) Schematic of BLI assay used to measure dissociation. 5 monobiotinylated substrate DNA (identical to λ1, Figure 2) is associated with streptavidin-coated
Nature Biotechnology: doi: /nbt.4166
Supplementary Figure 1 Validation of correct targeting at targeted locus. (a) by immunofluorescence staining of 2C-HR-CRISPR microinjected embryos cultured to the blastocyst stage. Embryos were stained
Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
DNA sequence and chromatin structure. Mapping nucleosome positioning using high-throughput sequencing
DNA sequence and chromatin structure Mapping nucleosome positioning using high-throughput sequencing DNA sequence and chromatin structure Higher-order 30 nm fibre Mapping nucleosome positioning using high-throughput
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Distribution of mirnas between lncrna and protein-coding genes. Pie chart showing distribution of human mirna between protein coding and lncrna genes. To the right, lncrna mirna
Nature Biotechnology doi: /nbt Supplementary Figure 1. Substrate-linked protein evolution components.
Supplementary Figure 1 Substrate-linked protein evolution components. (a) loxbtr subsites used for the combinational directed-evolution process to generate Brec1. Sequence differences (compared to the
You use the UCSC Genome Browser (www.genome.ucsc.edu) to assess the exonintron structure of each gene. You use four tracks to show each gene:
CRISPR-Cas9 genome editing Part 1: You would like to rapidly generate two different knockout mice using CRISPR-Cas9. The genes to be knocked out are Pcsk9 and Apoc3, both involved in lipid metabolism.
Systematic evaluation of spliced alignment programs for RNA- seq data
Systematic evaluation of spliced alignment programs for RNA- seq data Pär G. Engström, Tamara Steijger, Botond Sipos, Gregory R. Grant, André Kahles, RGASP Consortium, Gunnar Rätsch, Nick Goldman, Tim
VHL inhibition as protective during states of mitochondrial dysfunction. Isha H. Jain et al. Science 2016;352:54-61
VHL inhibition as protective during states of mitochondrial dysfunction Isha H. Jain et al. Science 2016;352:54-61 La fosforilazione ossidativa nel mitocondrio Tymoczko et al., PRINCIPI DI BIOCHIMICA,
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 ATP1A1 variants with in-frame deletions are enriched in ouabain-resistant cell populations. (a) Total editing efficacy along with spectrum and frequency of individual indels as determined
Result Tables The Result Table, which indicates chromosomal positions and annotated gene names, promoter regions and CpG islands, is the best way for
Result Tables The Result Table, which indicates chromosomal positions and annotated gene names, promoter regions and CpG islands, is the best way for you to discover methylation changes at specific genomic
Supporting Information. Multi-strand Structure Prediction of Nucleic. Acid Assemblies and Design of RNA Switches
Supporting Information Multi-strand Structure Prediction of Nucleic Acid Assemblies and Design of RNA Switches Eckart Bindewald 1#, Kirill A. Afonin 2,3#, Mathias Viard 1, Paul Zakrevsky 2, Taejin Kim
Supplementary Materials for
www.advances.sciencemag.org/cgi/content/full/1/7/e1500454/dc1 Supplementary Materials for CRISPR-Cas9 delivery to hard-to-transfect cells via membrane deformation Xin Han, Zongbin Liu, Myeong chan Jo,
Gene splice sites correlate with nucleosome positions
Gene splice sites correlate with nucleosome positions Simon Kogan and Edward N. Trifonov* Genome Diversity Center, Institute of Evolution, University of Haifa, Mount Carmel, Haifa 31905, Israel Abstract
Targeted RNA sequencing reveals the deep complexity of the human transcriptome.
Targeted RNA sequencing reveals the deep complexity of the human transcriptome. Tim R. Mercer 1, Daniel J. Gerhardt 2, Marcel E. Dinger 1, Joanna Crawford 1, Cole Trapnell 3, Jeffrey A. Jeddeloh 2,4, John
SUPPLEMENTAL MATERIALS
SUPPLEMENL MERILS Eh-seq: RISPR epitope tagging hip-seq of DN-binding proteins Daniel Savic, E. hristopher Partridge, Kimberly M. Newberry, Sophia. Smith, Sarah K. Meadows, rian S. Roberts, Mark Mackiewicz,
Nature Genetics: doi: /ng Supplementary Figure 1. The pedigree information for American upland cotton breeding.
Supplementary Figure 1 The pedigree information for American upland cotton breeding. The integrated figure was modified from Fig. 1 to 10 in Calhoun, Bowman & May (1994). The accessions with blue color
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)
user s guide Question 1
Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966
Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.
Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out
initial single-cell analysis, with a pragmatic focus on surface markers with the highest potential for
Supplementary Figure 1: Summary of the exclusionary approach to surface marker selection for initial single-cell analysis, with a pragmatic focus on surface markers with the highest potential for protein
Reviewers' Comments: Reviewer #1 (Remarks to the Author)
Reviewers' Comments: Reviewer #1 (Remarks to the Author) In this study, Rosenbluh et al reported direct comparison of two screening approaches: one is genome editing-based method using CRISPR-Cas9 (cutting,
SUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Number and length distributions of the inferred fosmids.
Supplementary Figure 1 Number and length distributions of the inferred fosmids. Fosmid were inferred by mapping each pool s sequence reads to hg19. We retained only those reads that mapped to within a
Nature Biotechnology: doi: /nbt Supplementary Figure 1. sndrop-seq overview.
Supplementary Figure 1 sndrop-seq overview. A. sndrop-seq method showing modifications needed to process nuclei, including bovine serum albumin (BSA) coating and droplet heating to ensure complete nuclear
Isolation of single-base genome-edited human ips cells without
Nature Methods Isolation of single-base genome-edited human ips cells without antibiotic selection Yuichiro Miyaoka, Amanda H. Chan, Luke M. Judge, Jennie Yoo, Miller Huang, Trieu D. Nguyen, Paweena P.
SUPPLEMENTARY INFORMATION
A diphtheria toxin resistance marker for in vitro and in vivo selection of stably transduced human cells Gabriele Picco, Consalvo Petti, Livio Trusolino, Andrea Bertotti and Enzo Medico SUPPLEMENTARY INFORMATION
mrna Sequencing Quality Control (V6)
mrna Sequencing Quality Control (V6) Notes: the following analyses are based on 8 adult brains sequenced in USC and Yale 1. Error Rates The error rates of each sequencing cycle are reported for 120 tiles
Supplementary Information
Supplementary Information Super-resolution imaging of fluorescently labeled, endogenous RNA Polymerase II in living cells with CRISPR/Cas9-mediated gene editing Won-Ki Cho 1, Namrata Jayanth 1, Susan Mullen
Revised: RG-RV2 by Fukuhara et al.
Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the
Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)
Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) A schematic overview of the production and amplification of a single pirna from a transposon transcript. The
Supplementary Information Supplementary Figures
Supplementary Information Supplementary Figures Figure S. The number of reads mapped to the and models for 76 human plasmablasts (AW-AW dataset) using bowtie reconstructed from (A) (B) (C) IMGT_mapped
Annotation of contig27 in the Muller F Element of D. elegans. Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans.
David Wang Bio 434W 4/27/15 Annotation of contig27 in the Muller F Element of D. elegans Abstract Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans. Genscan predicted six
Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
SUPPLEMENTARY INFORMATION
doi: 1.138/nature875 a promoter firefly luciferase CNS b Supplementary Figure 1. Dual luciferase assays on enhancer activity of CNS1, 2, and 3. a. promoter sequence was inserted upstream of firefly luciferase
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Development of conditions to convert 4-thiouridine (s 4 U) into a convertible nucleoside. Development of conditions to convert 4-thiouridine (s 4 U) into a convertible nucleoside.
Supplemental Figure 1.
Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Endogenous gene tagging to study subcellular localization and chromatin binding. a, b, Schematic of experimental set-up to endogenously tag RNAi factors using the CRISPR Cas9 technology,
Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb
Cell Reports Supplemental Information Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb Hirotsugu Ishizu, Yuka W. Iwasaki, Shigeki Hirakata, Haruka Ozaki, Wataru Iwasaki,
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Workflow for multimodal analysis using sc-gem on a programmable microfluidic device (Fluidigm). 1) Cells are captured and lysed, 2) RNA from lysed single cell is reverse-transcribed
HUMAN GENOME BIOINFORMATICS. Tore Samuelsson, Dec 2009
HUMAN GENOME BIOINFORMATICS Tore Samuelsson, Dec 2009 The sequenced (gray filled) and unsequenced (white) portions of the human genome. Peter F.R. Little Genome Res. 2005; 15: 1759-1766 Human genome organisation
Nature Methods: doi: /nmeth Supplementary Figure 1. DMS-MaPseq data are highly reproducible at elevated DMS concentrations.
Supplementary Figure 1 DMS-MaPseq data are highly reproducible at elevated DMS concentrations. a, Correlation of Gini index for 202 yeast mrna regions with 15x coverage at 2.5% or 5% v/v DMS concentrations
Chapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
The first thing you will see is the opening page. SeqMonk scans your copy and make sure everything is in order, indicated by the green check marks.
Open Seqmonk Launch SeqMonk The first thing you will see is the opening page. SeqMonk scans your copy and make sure everything is in order, indicated by the green check marks. SeqMonk Analysis Page 1 Create
Introduction to CRISPR/Cas9 Background DNA Cleavage and Repair (NHEJ and HDR) Alternative Cas9 Variants Delivery of Cas9 and sgrna Library Products
Introduction to CRISPR/Cas9 Background DNA Cleavage and Repair (NHEJ and HDR) Alternative Cas9 Variants Delivery of Cas9 and sgrna Library Products which one is right for you? CRISPR Workflow abm s Toolbox
Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction)
Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction) Epo Fw CTGTATCATGGACCACCTCGG Epo Rw TGAAGCACAGAAGCTCTTCGG Jak2 Fw ATCTGACCTTTCCATCTGGGG Jak2 Rw TGGTTGGGTGGATACCAGATC Stat5A Fw TTACTGAAGATCAAGCTGGGG
SUPPLEMENTARY INFORMATION
Gene replacements and insertions in rice by intron targeting using CRISPR Cas9 Table of Contents Supplementary Figure 1. sgrna-induced targeted mutations in the OsEPSPS gene in rice protoplasts. Supplementary
embryos. Asterisk represents loss of or reduced expression. Brackets represent
Supplemental Figures Supplemental Figure 1. tfec expression is highly enriched in tail endothelial cells (A- B) ISH of tfec at 15 and 16hpf in WT embryos. (C- D) ISH of tfec at 36 and 38hpf in WT embryos.
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary figure 1 Flow diagram summarizing the overall experimental
Supplementary Data Supplementary Figure 1. Knockdown of VentX with a different sirna sequence reduces terminal monocyte to macrophage
Supplementary Data Supplementary Figure 1. Knockdown of VentX with a different sirna sequence reduces terminal monocyte to macrophage differentiation. Monocytes were transfected with either a scrambled
Measuring gene expression
Measuring gene expression Grundlagen der Bioinformatik SS2018 https://www.youtube.com/watch?v=v8gh404a3gg Agenda Organization Gene expression Background Technologies FISH Nanostring Microarrays RNA-seq
Surrogate reporter-based enrichment of cells containing RNA-guided Cas9 nucleaseinduced
Supplementary Data Surrogate reporter-based enrichment of cells containing RNA-guided Cas9 nucleaseinduced mutations Suresh Ramakrishna 1, Seung Woo Cho 2, Sojung Kim 2, Myungjae Song 1, Ramu Gopalappa
Supplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1 shrna mediated knockdown of ZRSR2 in K562 and 293T cells. (a) ZRSR2 transcript levels in stably transduced K562 cells were determined using qrt-pcr. GAPDH was
Quantitative analysis of recombination in YFP and CFP gene of FRET biosensor induced by lentiviral or retroviral gene transfer.
Supplementary Information: Quantitative analysis of recombination in and gene of FRET biosensor induced by lentiviral or retroviral gene transfer. Akira T. Komatsubara, Michiyuki Matsuda,, and Kazuhiro
Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably
Supplementary Information Supplementary Figure S1. The tetracycline-inducible CRISPR system. A) Hela cells stably expressing shrna sequences against TRF2 were examined by western blotting. shcon, shrna
Supporting Information
Supporting Information Park et al. 10.1073/pnas.1410555111 5 -TCAAGTCCATCTACATGGCC-3 5 -CAGCTGCCCGGCTACTACTA-3 5 -TGCAGCTGCCCGGCTACTAC-3 5 -AAGCTGGACATCACCTCCCA-3 5 -TGACAGGAACACCTACAAGT-3 5 -AAGGCACCTTTCTGTCTCCA-3
Figure 1. FasterDB SEARCH PAGE corresponding to human WNK1 gene. In the search page, gene searching, in the mouse or human genome, can be done: 1- By
1 2 3 Figure 1. FasterD SERCH PGE corresponding to human WNK1 gene. In the search page, gene searching, in the mouse or human genome, can be done: 1- y keywords (ENSEML ID, HUGO gene name, synonyms or
Spermatazoa. Sertoli cells. Morc1 WT adult. Morc1 KO adult. Morc1 WT P14.5. Morc1 KO P14.5. Germ cells. Germ cells. Spermatids.
a. Spermatazoa Sertoli cells Morc1 WT adult c. Morc1 KO adult Morc1 WT P1.5 Morc1 KO P1.5 Morc1 WT adult Morc1 KO adult Germ cells Germ cells Spermatids Spermatozoa Supplementary Figure 1. Confirmation
CRISPR GENOMIC SERVICES PRODUCT CATALOG
CRISPR GENOMIC SERVICES PRODUCT CATALOG DESIGN BUILD ANALYZE The experts at Desktop Genetics can help you design, prepare and manufacture all of the components needed for your CRISPR screen. We provide
Supplementary Figures and Figure legends
Supplementary Figures and Figure legends 3 Supplementary Figure 1. Conditional targeting construct for the murine Satb1 locus with a modified FLEX switch. Schematic of the wild type Satb1 locus; the conditional
Genome-wide CRISPR screen reveals novel host factors required for Staphylococcus aureus α-hemolysin-mediated toxicity
Genome-wide CRISPR screen reveals novel host factors required for Staphylococcus aureus α-hemolysin-mediated toxicity Sebastian Virreira Winter, Arturo Zychlinsky and Bart W. Bardoel Department of Cellular
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Validation of CDK9-inhibitor treatment.
Supplementary Figure 1 Validation of CDK9-inhibitor treatment. (a) Schematic of GAPDH with the middle of the amplicons indicated in base pairs. The transcription start site (TSS) and the terminal polyadenylation
Supplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Design and sequence of system 1 for targeted demethylation.
Supplementary Figure 1 Design and sequence of system 1 for targeted demethylation. (a) Design of system 1 for targeted demethylation. TET1CD was fused to a catalytic inactive Cas9 nuclease (dcas9) and
Analyzing an individual sequence in the Sequence Editor
BioNumerics Tutorial: Analyzing an individual sequence in the Sequence Editor 1 Aim The Sequence editor window is a convenient tool implemented in BioNumerics to edit and analyze nucleotide and amino acid
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID mcf.2 transforming sequence-like Mcf2l Mouse Description Not Available C130040G20Rik,
LysoTracker Red DND-99 (Invitrogen) was used as a marker of lysosome or acidic
information MATERIAL AND METHODS Lysosome staining LysoTracker Red DND-99 (Invitrogen) was used as a marker of lysosome or acidic compartments, according to the manufacturer s protocol. Plasmid independent
797Trex megadomain(s) Per403 megadomain(s) chr1: chr1: chr12: chr12:
Table S1. Megadomains that overlap in all BRD4-NUT NMC cell lines and tissue. chromosome union region start union region end 797 megadomain(s) chr1 17197632 17247632 chr1:1721332-1724232 chr12 851264 8598264
Nature Genetics: doi: /ng Supplementary Figure 1. H3K27ac HiChIP enriches enhancer promoter-associated chromatin contacts.
Supplementary Figure 1 H3K27ac HiChIP enriches enhancer promoter-associated chromatin contacts. (a) Schematic of chromatin contacts captured in H3K27ac HiChIP. (b) Loop call overlap for cohesin HiChIP
Supplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
Supplemental Table S1. RT-PCR primers used in this study
Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------
A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase
A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase tag insertion at the 3 end using CRISPR-Cas9 genome editing technique Sambuddha Basu 1, 3, Levi Adams 1, 3, Subhrangshu
domain. Bottom panel: hybrid surface/ribbon structure (PDB ID: 4UN3) of SpCas9 in complex with sgrna and target DNA. The REC3
Supplementary Figure 1 Yeast screening for high-specificity SpCas9 variants (a) Top panel: scheme of SpCas9 domains. The REC3 domain is part of the recognition lobe. BH: bridge helix. PI: PAM-interacting
Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
Supplementary Information
Supplementary Information Supplementary Figure 1: The proportion of somatic SNVs in each tumor is shown in a trinucleotide context. The data represent 31 exome-sequenced osteosarcomas. Note that the mutation
Nature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1
INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot
CRISPR-dCas9 mediated TET1 targeting for selective DNA demethylation at BRCA1 promoter
CRISPR-dCas9 mediated TET1 targeting for selective DNA demethylation at BRCA1 promoter SUPPLEMENTARY DATA See Supplementary Sequence File: 1 Supplementary Figure S1: The total protein was extracted from
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of
Quick reference guide
Quick reference guide Our Invitrogen GeneArt CRISPR Search and Design Tool allows you to search our database of >600,000 predesigned CRISPR guide RNA (grna) sequences or analyze your sequence of interest
Gene Prediction in Eukaryotes
Gene Prediction in Eukaryotes Jan-Jaap Wesselink Biomol Informatics, S.L. jjw@biomol-informatics.com June 2010/Madrid jjw@biomol-informatics.com (BI) Gene Prediction June 2010/Madrid 1 / 34 Outline 1 Gene