On the sequence specificity of apoptotic nucleases. Haifa-NP 2012

Transcription

1 Max Planck Institute of Psychiatry Munich Germany On the sequence specificity of apoptotic nucleases Haifa-NP 2012 Thomas ettecken

2 Nucleosomes and Chromatin DNA in the nucleus is packaged into nucleosomes

3 Human Karyotype 46 XY Giemsa (etc) banding pattern is characteristic for each chromosome. anding pattern is depending on chromatin density, associated proteins,... and probably also on nucleosome positioning/density.

4 Our today s knowledge on nucleosome positioning: Nucleosome positioning is more not random than random There is at least some evident DNA sequence dependence (strong/weak nucleosomes, nucleosome free regions) Methylated cytosines modulate/attenuate nucleosomal strength There are positioning factors (proteins), probably preferably located at specific DNA sequences

5 efore going to apoptotic nucleases: Small bioinformatic excursion to the 10.4 bp dinucleotide periodicity

6 from Trifonov and Sussman PNAS 1980

7 Autocorrelation calculations, here for AA dinucleotides, in a window of 50 bases: GACGAAGTGCTAATCGTAGATAGTAAGCTAGCTAAGCGATGTCGATCAAGCTAGC Smoothing over 3 bases = Averaging over 3 consecutive entries (sliding window)

8 Data calculated from ~ bases of sequence from ~25 different eukaryotic organisms

9 Positional Autocorrelation of Dinucleotides in Several Genomes S. cerevisiae C. elegans A. thaliana D. rerio C. albicans D. melanogaster A. mellifera A. gambiae C. reinhardthii G. gallus D. discoideum H. sapiens M. musculus AA AC AG AT CA CC CG CT GA GC GG GT TA TC TG TT Calculation of the positional autocorrelation of all 16 dinucleotides on the generic genomic sequence (as deposited in the database) For H. sapiens only: Repeats masked (hg18, masked ) In a window of 150 bases Smoothing over 3 bases

10 Autocorrelation of dinucleotides in selected eukaryotic organisms

11 Autocorrelation of dinucleotides in several eukaryotic organisms

12 Each one of the 16 dinucleotides has been found at least once to be positioned with a periodicity of 10.4 bases

13 ApiMel N all CG distances in interval, smoothened (3 bases)

14 CG dinucleotide periodicities in the human genome hg18 hg18 masked (repeats masked)

15 Summary 10.4 bp Dinucleotide Periodicities Each one of the 16 dinucleotides shows a 10.4 base periodicity in at least one of the 13 genomes. CG in A. mellifera shows the most prominent signal of all. CG is the only dinucleotide showing a 10.4 base periodicity in H. sapiens (only on the sequence with repeats masked). New aspect of SNPs: Every SNP is part of 2 dinucleotides (.T[C/A]G...), modulating the dinucleotides' periodicities.

16 Apoptosis Short definition: Programmed cell death and debris clearance, essential for development and maintenance of an organism. thb A definition a little longer: Apoptosis is an evolutionarily conserved type of programmed cell death that is essential for development, homeostasis and self-defence against virus infection. Apoptosis is characterized by biochemical and morphological changes that include cellular and nuclear shrinkage, chromatin condensation, formation of apoptotic bodies, loss of microvilli and DNA fragmentation. Long from: Samejima Nature Rev Mol Cell iol (2005)

17 Apoptosis from: Samejima Nature Rev Mol Cell iol (2005)

18 _ DNA ladder, from DNA fragments produced by spontaneous apoptosis in human peripheral blood leukocytes Marker: Lambda/HindIII+EcoRI (21226, 5148/4973/4268, 3530, 2027, 1904, 1584, 1375, 947, 831 bp) + ~ 200 bp

19 Steps in Sample Preparation for Next Generation Sequencing 1. DNA Fragmentation to bp (or even more) 2. Adaptor Ligation 3. Size Selection of Ligated Products ( bp) 4. PCR Amplification ( cycles) 5. Sequencing

20 Analyzing on an Illumina GA II Flow Cell 1 Lane of a Flow Cell (smallest unit)

21 Entire dataset ~ 2 x 43.9 Million reads (forward + reverse) After quality filtering q20p98 ~ 2 x 30.3 Million reads ~ 30.3 Mio x 170 bases = ~ 5.1 Gbases (nominally 1.6 x coverage of the human genome) Ideal (2 x coverage) 120 bases more realistic

22 Determining the Fragment Lengths There are 2 ways to calculate the fragment lengths: 1. from the mapping positions ( TLEN ) 2. from the overlap of forward and reverse reads, 120 bases each, SHERA ) ~145 - ~210 basepairs centered at about 170 basepairs

23 ase counts in the positions of reads

24 ase bias extending 5' to the reads

25 ase bias extending 5' to the reads

26 Consensus Consensus sequence at the cleavage site: TAAAgT ' AcTTTA

27 Nucleosome positioning patterns, species: C C C C C C GRAAA GGGGG TTTYC CCccc G G G G G G Y RRRRR YYYYY R species authors method C. elegans Gabdank, 2009 A C. elegans Rapoport, 2011 A. gambiae C. albicans D. melanogaster S. cerevisiae A. mellifera A. thaliana D. discoideum D. rerio G. gallus H. sapiens M. musculus C. reinhardtii consensus A signal regeneration, nucleosome database Shannon N-gram extension, whole genome Slide is courtesy of Ed Trifonov 2012

28 Nucleosome positioning patterns, species: C C C C C C GRAAA GGGGG TTTYC CCccc G G G G G G Y RRRRR YYYYY R species authors method C. elegans Gabdank, 2009 A C. elegans Rapoport, 2011 A. gambiae C. albicans D. melanogaster S. cerevisiae A. mellifera A. thaliana D. discoideum D. rerio G. gallus H. sapiens M. musculus C. reinhardtii consensus T AAAgT AcTTT A Consensus of cut sites Y RRRRY RYYYY R above, in RY

29 10 Most Frequent Hexanucleotides at the Cut Sites Hexanucleotide Count in Pos 1 to 6 Count in Pos 51 to 56 Ratio ACTTTA ,4 ACTTTT CATTTA ,4 ATTTTA ,6 ACTTTG ,6 CATTCA ,4 CATTTT CCTTTA ,1 ACTTTA ,2 ACTGCA ,8...

30 Confirmed Nucleosome Positioning Signals 1. Ins ide the nucleos ome 1.1 In eukaryotes...aannnnnnnaannnnnnnnnaa......acnnnnnnnnacnnnnnnnnac......agnnnnnnnnagnnnnnnnag......tgnnnnnnntgnnnnnnnnntg......ttnnnnnnnnttnnnnnnnntt In humans...cgnnnnnnnncgnnnnnnnncg Outs ide the nucleos ome 1.1 In humans...taaagtacttta bp...taaagtacttta... This list does not claim to be comprehensive

31 Summary Apoptotic Nucleases - Apoptotic DNAses seem to have a high sequence specificity, contrary to what has been reported before. - The base bias at the cut site is extending as the almost exact reverse complementary sequence into the 5' direction. - A consensus of TAAAgT'AcTTTA can be derived, reminding of a restriction endonuclease recognition site. - ut not a single hexanucleotide motif exceeds ~1% of frequency at the cut site. - Probably, the pattern we observe, is a superposition of several/many DNA motifs. The cleavage sites at different motifs, when packed in chromatin, maybe look highly similar to the nuclease(s). - Our findings may have impact on research in autoimmune diseases (e.g. Lupus/SLE, Rheumatoid Arthritis, ).

32 Thank you! I would like to acknowledge collaboration and help with sample preparation and DNA sequencing: Zakharia Frenkel Edward Trifonov MPIP Munich Stefan Darchinger Saleem Halteh Institute of Evolution Haifa Sagi Snir CCG-Cologne Center for Genomics, Köln Christian ecker Janine Altmüller Susanne Motameny Peter Frommolt Peter Nürnberg This work is in press in the Journal of iomolecular Structure and Dynamics