The plasmid for the HLY production was constructed by using the MutliSite Gateway TM

Size: px

Start display at page:

Download "The plasmid for the HLY production was constructed by using the MutliSite Gateway TM"

Bernice Franklin
6 years ago
Views:

1 Supplementary methods and table The plasmid for the HLY production The plasmid for the HLY production was constructed by using the MutliSite Gateway TM system (Mabashi et al. 00). The HLY gene was amplified with two combinations of the primers [primer and primer, primer and primer (Supplementary table 1)] and pmar-hly (Tsuchiya et al. ) as a template. The two DNA fragments were cloned as center and entry clones (pgchly' and pg'hly, respectively) and then mixed with the entry clone, pg'pfa, and the destination vector, pgdsn (Mabashi et al. 00), for LR clonase reaction. The resulting plasmid, pals, contains the amyb-hly-hly fusion gene under the control of the amyb promoter along with the Aspergillus nidulans sc marker (Yamada et al. ). The Kex cleavage site (-Lys-Arg-) was placed at the upstream of HLY. 1 The plasmid for pepa gene disruption 0 1 The plasmid for pepa gene disruption was constructed by fusion PCR. Using the genomic DNA of the A. oryzae RIB0 strain as a template, PCR was carried out with the primers [pepa-a and pepa-b for the flanking region of the pepa gene (1. kb), pepa-c and pepa-d for the flanking region of the pepa gene (1. kb), adea-f and adea-r for the adea gene (.0 kb) (Supplementary table 1)] using Pfx DNA polymerase (Invitrogen, San Diego, CA, USA). The three DNA fragments were mixed, and fusion 1

2 PCR was performed by LA Taq DNA polymerase (TaKaRa, Kyoto, Japan). This reaction was performed as follows: denaturation at C for min; followed by 0 cycles of C for 0 sec, C for 0 sec and C for min (The temperature was gradually raised from C to C at 1 C/ sec). The amplified DNA fragment was cloned into ptblue vector (Novagen, Madison, WI, USA), generating the plasmid, pdpepa. Using the resulting plasmid as a template, the DNA fragment for pepa gene disruption was amplified and introduced into the HLY producing strain. The plasmid for pepe gene disruption The plasmid for pepe gene disruption was constructed by the MultiSite Gateway TM system. Using the genomic DNA of the RIB0 strain as a template, PCR was carried out with the primers [attbf-ppepe and attb1r-ppepe for the flanking region of the pepe gene (.0 kb), attbf-tpepe and attbr-tpepe for the flanking region of the pepe gene (.0 kb), attb1f-adea and attbr-adea for the adea gene (.0 kb) (Supplementary table 1)]. The three DNA fragments were inserted into entry donor vectors of the MultiSite Gateway TM system to generate three types of entry clones. Subsequently, these entry clones and the destination vector (pdest TM R-R; Invitrogen) were connected by LR recombination reaction. The resultant plasmid (pgdestforδpepe) was used as a template for PCR to amplify the DNA fragment for pepe gene disruption in the HLY producing strain.

3 The plasmid for alpa gene disruption The plasmid, pdalpa, for alpa gene disruption was constructed by fusion PCR. Using the genomic DNA of the RIB0 strain as a template, PCR was carried out with the primers [alpa-a and alpa-b for the flanking region of the pepa gene (1. kb), pepa-c and pepa-d for the flanking region of the pepa gene (1. kb), adea-f (alpa) and adea-r (alpa) for the adea gene (1. kb) (Supplementary table 1)]. The fusion PCR and subsequent procedures were performed as described for pepa gene disruption. 1 The plasmid for tppa gene disruption with the adea marker The plasmid, pdtppa, for tppa gene disruption was constructed by fusion PCR. Using the genomic DNA of A. oryzae RIB0 as a template, PCR was carried out with the primers [tppa-a and tppa-b for the flanking region of the tppa gene (1. kb), tppa-c and tppa-d for the flanking region of the tppa gene (1. kb), adea-f(tppa) and adea-r(tppa) for the adea gene (1. kb) (Supplementary table 1)]. The fusion PCR and the subsequent procedures were performed as described for pepa gene disruption. 0 1 The plasmid for palb gene disruption The plasmid, pgdpab, for palb gene disruption was constructed by using the MultiSite

4 Gateway TM system. Using the genomic DNA of RIB0 strain as a template, PCR was carried out with primers [palb-f and palb-b for the flanking region of the palb gene (1. kb), palb-c and palb-r for the flanking region of the pepe gene (.0 kb) (Supplementary table 1)]. The amplified DNA fragments were inserted into entry donor vectors to generate entry clones. The following experiments were carried out as described for pepe gene disruption. The plasmid for tppa gene disruption with the argb marker The plasmid, pgdtpa, for tppa gene disruption was constructed by using the MultiSite Gateway TM system. Using the genomic DNA of the RIB0 strain as a template, PCR was carried out with the primers [tppa-f and tppa-b for the flanking region of the tppa gene (1. kb), tppa-c and tppa-r for the flanking region of the pepe gene (1. kb), argb-f() and argb-r() for the argb gene (.1 kb) (Supplementary table 1)]. The amplified DNA fragments were inserted into entry donor vectors to generate entry clones. The subsequent experiments were as described for pepe gene disruption.

5 Supplementary table 1 Primers used in this study Name Sequence (' to ') Directions HLY production Primer ggggacaagtttgtacaaaaaagcaggcttgaagcgcaaggttttcgaacgttgtgaattg *1, Forward Primer ggggaccactttgtacaagaaagctgggttgacaccacaaccttgaacgtattg Reverse Primer ggggacagctttcttgtacaaagtgggtaagcgcaaggttttcgaacgttgtgaattg Forward Primer ggggacaactttgtataataaagttgttagacaccacaaccttgaacgta Reverse Disruption of the pepa gene pepa-a ggactgatttcgttgattgagccg Forward pepa-b ctgacctatcttcctggacatgacggagcacaagcctagacgaactcaga * Reverse pepa-c ggactcgtatgctgttgcgcagcatctactaacacctctctccag Forward pepa-d cgatcaattcttcaacagctccac Reverse adea-f ccgtcatgtccaggaagataggtcag Forward adea-r ctgcgcaacagcatacgagtccacag Reverse Disruption of the pepe gene attbf-ppepe ggggacaactttgtatagaaaagttggtcgtccggattctatccac Forward attb1r-ppepe ggggactgctttttttgacaaacttgtgggcgacaacggcgacaaa Reverse attbf-tpepe ggggacagctttcttgtacaaagtggtacatgatagcctgcctcgg Forward attbr-tpepe ggggacaactttgtataataaagttgcccaagcccaatctctagct Reverse attb1f-adea ggggacaagtttgtacaaaaaagcaggcttgcgcaacagcatacgagtc Forward attbr-adea ggggaccactttgtacaagaaagctgggtcatgccgtcatgtccaggaa Reverse Disruption of alpa gene alpa-a gggccattcaggttgtgcctaa Forward alpa-b ttcctggacatgacggcatgagggtacgcttgatggactgcatg Reverse alpa-c gtcgtatatataacgctcaattgtccaccaggagtacgtcgcaggatt Forward alpa-d ctccgggttttctcccttacac Reverse adea-f(alpa) catgcagtccatcaagcgtaccctcatgccgtcatgtccaggaa Forward adea-r(alpa) aatcctgcgacgtactcctggtggacaattgagcgttatatatacgac Reverse Disruption of the tppa gene tppa-a gcgagacaacagctacaacacag Forward tppa-b ttcctggacatgacggcatgagctttggaacggcagacagcttc Reverse tppa-c gtcgtatatataacgctcaattgtccacgtgagggtaaactatggggt Forward tppa-d tcgatcttcctggcctctgtca Reverse adea-f(tppa) gaagctgtctgccgttccaaagctcatgccgtcatgtccaggaa Forward adea-r(tppa) accccatagtttaccctcacgtggacaattgagcgttatatatacgac Reverse tppa-f ggggacaactttgtatagaaaagttggcgagacaacagctacaacacag Forward tppa-b ggggactgcttttttgtacaaacttgctttggaacggcagacagcttc Reverse tppa-c ggggacagctttcttgtacaaagtggacgtgagggtaaactatggggt Forward tppa-r ggggacaactttgtataataaagttgtcgatcttcctggcctctgtca Reverse argb-f() ggggacaagtttgtacaaaaaagcaggctgaggagtaaaggggtggattcgga Forward argb-r() ggggaccactttgtacaagaaagctgggtgggttgttggccttgttttgtcgg Reverse Disruption of the palb gene palb-f ggggacaactttgtatagaaaagttgagcccgggtgggagcgacatctatttcagg * Forward palb-b ggggactgcttttttgtacaaacttgacccgggttcggtctagacatactggcag Reverse palb-c ggggacagctttcttgtacaaagtggagcccgggtgcttgatctcttatcctgcag Forward palb-r ggggacaactttgtataataaagttgacccgggaagaggtcttgagtgaagctcc Reverse *1 The attb sequences are underlined. * The Kex cleavage sites are shown in italic letters. * The nucleotide sequences of the adea gene are shown in bold letters. * The SmaI sites are shown in capital letters.

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna