Received 21 June 2009/Returned for modification 3 September 2009/Accepted 16 November 2009

Transcription

1 ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Feb. 2010, p Vol. 54, No /10/$12.00 doi: /aac Copyright 2010, American Society for Microbiology. All Rights Reserved. Activity of a New Antipseudomonal Cephalosporin, CXA-101 (FR264205), against Carbapenem-Resistant and Multidrug-Resistant Pseudomonas aeruginosa Clinical Strains Carlos Juan, 1 Laura Zamorano, 1 José L.Pérez, 1 Yigong Ge, 2 and Antonio Oliver 1 * on Behalf of the Spanish Group for the Study of Pseudomonas and the Spanish Network for Research in Infectious Diseases Servicio de Microbiología and Unidad de Investigación, Hospital Son Dureta, Instituto Universitario de Investigación en Ciencias de la Salud, Palma de Mallorca, Spain, 1 and Calixa Therapeutics, San Diego, California 2 Received 21 June 2009/Returned for modification 3 September 2009/Accepted 16 November 2009 The activity of the new cephalosporin CXA-101 (CXA), previously designated FR264205, was evaluated against a collection of 236 carbapenem-resistant P. aeruginosa isolates, including 165 different clonal types, from a Spanish multicenter (127-hospital) study. The MICs of CXA were compared to the susceptibility results for antipseudomonal penicillins, cephalosporins, carbapenems, aminoglycosides, and fluoroquinolones. The MIC of CXA in combination with tazobactam (4 and 8 g/ml) was determined for strains with high CXA MICs. The presence of acquired -lactamases was investigated by isoelectric focusing and PCR amplification followed by sequencing. Additional -lactamase genes were identified by cloning and sequencing. The CXA MIC 50 /MIC 90 for the complete collection of carbapenem-resistant P. aeruginosa isolates was 1/4 g/ml, with 95.3% of the isolates showing an MIC of <8 g/ml. Crossresistance with any of the antibiotics tested was not observed; the MIC 50 /MIC 90 of CXA-101 was still 1/4 when multidrug-resistant (MDR) strains (42% of all tested isolates) or AmpC-hyperproducing clones (53%) were analyzed. Almost all (10/11) of the strains showing a CXA MIC of >8 g/ml produced a horizontally acquired -lactamase, including the metallo- -lactamase (MBL) VIM-2 (one strain), the extended-spectrum -lactamase (ESBL) PER-1 (one strain), several extended-spectrum OXA enzymes (OXA-101 [one strain], OXA-17 [two strains], and a newly described OXA-2 derivative [W159R] designated OXA-144 [four strains]), and a new BEL variant (BEL-3) ESBL (one strain), as identified by cloning and sequencing. Synergy with tazobactam in these 11 strains was limited, although 8 g/ml reduced the mean CXA MIC by 2-fold. CXA is highly active against carbapenem-resistant P. aeruginosa isolates, including MDR strains. Resistance was restricted to still-uncommon strains producing an acquired MBL or ESBL. * Corresponding author. Mailing address: Servicio de Microbiología, Hospital Son Dureta, C. Andrea Doria no. 55, Palma de Mallorca, Spain. Phone: Fax: antonio.oliver@ssib.es. Published ahead of print on 23 November The increasing prevalence of nosocomial infections caused by multidrug-resistant (MDR) Pseudomonas aeruginosa strains severely compromises the selection of appropriate antibacterial treatments and is therefore associated with significant morbidity and mortality (13, 20). The growing threat of antimicrobial resistance in P. aeruginosa results from the extraordinary capacity of this microorganism to develop resistance to almost any available antibiotic by the selection of mutations in chromosomal genes and from the increasing prevalence of transferable resistance determinants, particularly those encoding class B carbapenemases (or metallo- -lactamases [MBLs]) or extended-spectrum -lactamases (ESBLs) (14, 18). VIM and IMP MBLs and OXA and PER ESBLs have disseminated among P. aeruginosa strains from diverse geographic areas (6, 11, 16, 22, 29, 32, 39). These resistance genes are frequently carried in integrons, together with aminoglycoside resistance determinants that are often located in transferable elements such as plasmids or transposons (12, 24, 25, 26, 31). Noteworthy among the mutation-mediated resistance mechanisms are those leading to the repression or inactivation of the porin OprD, conferring resistance to carbapenems (5, 8, 23, 30, 41), or those leading to the hyperproduction of the chromosomal cephalosporinase AmpC, such as AmpD or PBP4 inactivation (10, 19), determining resistance to penicillins and cephalosporins. In addition, mutations leading to the upregulation of one of several efflux pumps encoded in the P. aeruginosa genome may confer resistance or reduced susceptibility to multiple agents, including almost all -lactams, fluoroquinolones, and aminoglycosides (2, 17, 28). The accumulation of these chromosomal mutations can lead to the emergence of MDR (or even panantibiotic-resistant) strains which eventually may be responsible for outbreaks in the hospital setting (4, 9). Unfortunately, in the last 2 decades, little progress has occurred in developing novel antipseudomonal agents that can overcome MDR in P. aeruginosa. CXA-101, previously designated FR264205, is a new promising cephalosporin intended for the treatment of P. aeruginosa infections that appears to be stable against the most common resistance mechanisms driven by mutation in this species (35, 36). The objective of this study was to evaluate the activity of CXA-101 against a collection of well characterized carbapenem-resistant and MDR P. aeruginosa isolates obtained in a large multicenter study in Spain (8, 846

2 VOL. 54, 2010 CXA-101 ACTIVITY AGAINST RESISTANT P. AERUGINOSA 847 FIG. 1. Distribution of CXA-101, CAZ, and FEP MICs for the collection of 236 carbapenem-resistant P. aeruginosa isolates from Spanish hospitals. MIC 50 s and MIC 90 s are also indicated. 33). Additionally, this study also aimed to investigate the possible mechanisms of resistance to CXA-101. (This study was presented in part at the 49th Interscience Conference on Antimicrobial Agents and Chemotherapy, San Francisco, CA, September 2009.) MATERIALS AND METHODS Strains. A total of 1,250 nonduplicate P. aeruginosa isolates were collected from 127 Spanish hospitals during 1 week in November 2003 as part of the second national study of the evolution of antimicrobial resistance in P. aeruginosa in Spain. The general antimicrobial susceptibility results for this collection of strains were recently published (33). This study is focused on the characterization of the 236 (18.9%) isolates from that collection that were nonsusceptible to imipenem (MIC of 8 g/ml) and/or meropenem (MIC of 8 g/ml). This collection of 236 isolates has also been analyzed in a recent study (8), and its characteristics are summarized as follows: up to 46% of the isolates were MDR, there was a remarkable clonal diversity (165 different clones were identified by pulsed-field gel electrophoresis [PFGE]), carbapenem resistance was driven mainly by the mutational inactivation of OprD (MBLs detected in a single isolate), and up to 53% of the clones additionally hyperproduced AmpC, showing a pattern of pan- -lactam resistance. Susceptibility testing. The MICs of CXA-101 were determined by standard CLSI broth microdilution (M100-S18) using a to 64- g/ml concentration range. CXA-101 (lot 3F02) was provided by Calixa Therapeutics Inc. The MICs of imipenem (IMP), meropenem (MER), ceftazidime (CAZ), cefepime (FEP), piperacillin (PIP), piperacillin-tazobactam (PIP-TZ), aztreonam (ATM), gentamicin (GEN), tobramycin (TOB), amikacin (AMK), and ciprofloxacin (CIP) were also determined by broth microdilution as part of the previous studies (8, 33). Additionally, MICs of CAZ and FEP were determined again in this study by broth microdilution using the same full concentration range (0.12 to 64 g/ml) for comparative purposes. The breakpoints defined by the CLSI were used for all comparator antibiotics. Pseudomonas aeruginosa reference strains PAO1 and ATCC were run in parallel for quality control. MDR strains were defined as those nonsusceptible to at least three of the following four antibiotics: CAZ, IMP, CIP, and TOB (20). The MICs of CXA-101 in combination with TZ (4 and 8 g/ml) were determined by broth microdilution for selected strains. Characterization of horizontally acquired -lactamases in CXA-101-nonsusceptible strains. The presence of horizontally acquired -lactamases in CXA- 101-nonsusceptible isolates was explored through phenotypic, biochemical, and genetic approaches. The phenotypic tests included Etest MBL strips (AB Biodisk, Solna, Sweden) for detection of class B carbapenemases and the doubledisk synergy test (DDST) for the detection of ESBLs, using amoxicillin-clavulanate and CAZ, FEP, and ATM disks (distance from 10 to 30 mm). The biochemical detection of the production of non-class C -lactamases included two different approaches: (i) a cloxacillin inhibition test in which the -lactamase activity was determined after incubation of crude sonic extracts in 50 M cloxacillin (a class C -lactamase inhibitor) for 15 min as previously described (10) and (ii) isoelectric focusing (IEF) of crude sonic extracts using Phast gels (ph gradient of 3 to 9) in a Phast System apparatus (Pharmacia AB, Uppsala, Sweden). According to the preliminary phenotypic and biochemical tests, the potential presence of genes encoding acquired -lactamases was explored by PCR and sequencing. Previously described primers and conditions were used to amplify the genes encoding VIM-, IMP-, PER-, CTX-M-, SHV-, TEM-, OXA-, and PSE-type -lactamases (3, 8, 21). After PCR amplification, sequencing reactions were performed with the BigDye Terminator kit (PE Applied Biosystems, Foster City, CA), and sequences were analyzed on an ABI Prism 3100 DNA sequencer (PE Applied Biosystems). The resulting sequences were then compared with those available at GenBank ( Cloning of ESBL-encoding genes. When all sets of PCRs for acquired enzymes were negative, despite non-class C -lactamases being documented by the cloxacillin inhibition test and IEF, cloning of the corresponding -lactamases was attempted. For this purpose, genomic DNA was digested with EcoRI or BamHI and ligated (in a 10:1 proportion) to plasmid pucp24 (40) linearized with the same enzymes. Ligation products were then transformed into Escherichia coli XL1 Blue, made competent by CaCl 2, and transformants were selected in LB agar plates containing 5 g/ml gentamicin and 30 g/ml ampicillin. The DNA fragments containing the cloned -lactamases were then fully sequenced, and their phenotypes were checked by susceptibility testing and IEF. Additionally, to demonstrate the ESBL phenotype of the OXA-2 variant OXA-144 described here, bla OXA-2 and bla OXA-144 were cloned in parallel. bla OXA-2 and bla OXA-144 were PCR amplified using primers OXA-2F-SmaI (TCCCCGGGATGGCAAT CCGAATCTTCGC) and OXA-2R-BamHI (TCGGATCCTTATCGCGCAGC GTCCGAG) and cloned in pucp24. The resulting plasmids, pucpoxa-2 and pucpoxa-144, were then electroporated into P. aeruginosa PAO1 following previously described procedures (34). MICs of CAZ, FEP, IMP, MER, PIP-TZ, CXA-101, and CXA-101-TZ were determined with selected transformants. Nucleotide sequence accession numbers. The nucleotide sequences first described in this work have been deposited in the GenBank database under accession numbers GQ (bla BEL-3 ) and FJ (bla OXA-144 ). RESULTS The distribution of CXA-101 MICs, compared with those of CAZ and FEP, in the collection of carbapenem-nonsusceptible strains is shown in Fig. 1. CXA-101 MICs ranged from 0.12 g/ml to 64 g/ml, with a modal value of 1 g/ml, a MIC 50 of 1 g/ml, and a MIC 90 of 4 g/ml. On the other hand, the CAZ and FEP MIC 50 /MIC 90 were 8/64 g/ml and 8/32 g/ml, respectively (Fig. 1). Table 1 shows the numbers and percentages of strains that were nonsusceptible to all the comparator antibiotics tested. Only 11 isolates (4.7%) showed CXA-101 MICs of 8 g/ml (the current CLSI susceptibility breakpoint for all antipseudomonal cephalosporins). In sharp contrast, cross-resistance of the carbapenem-resistant strains to all other -lactam and non- -lactam antibiotics was very frequent, ranging from 19% for AMK to 59% for GEN (Table 1). Moreover, TABLE 1. Numbers and percentages of P. aeruginosa isolates nonsusceptible to -lactam and non- -lactam antibiotics Antibiotic CLSI susceptibility breakpoint ( g/ml) No. (%) of nonsusceptible isolates IMP (95.4) MER (68.2) CAZ (46.2) FEP (52.1) TIC (33.9) PIP (28.4) PIP-TZ (24.2) ATM (53.0) GEN (58.9) TOB 4 80 (33.9) AMK (18.6) CIP (53.4)

3 848 JUAN ET AL. ANTIMICROB. AGENTS CHEMOTHER. TABLE 2. Activity of CXA-101 against P. aeruginosa isolates resistant to -lactam and non- -lactam antibiotics, as well as MDR, ICU, and AmpC-hyperproducing isolates P. aeruginosa isolates a (no. % ) MIC ( g/ml) MIC 50 MIC 90 All ( ) 1 4 IMP S (11 5 )/R ( ) 1/1 4/4 MER S (75 32 )/R ( ) 1/1 2/4 TIC S ( )/R (80 34 ) 1/1 2/8 PIP S ( )/R (67 28 ) 1/1 2/4 PIP-TZ S ( )/R (57 24 ) 1/1 2/4 CAZ S ( )/R ( ) 1/1 2/4 FEP S ( )/R ( ) 0.5/1 2/4 ATM S ( )/R ( ) 1/1 2/4 GEN S (97 41 )/R ( ) 1/1 2/4 TOB S ( )/R (80 34 ) 1/1 2/4 AMK S ( )/R (44 19 ) 1/1 2/64 CIP S ( )/R ( ) 1/1 2/4 Non-MDR (138 58)/MDR (98 42 ) 1/1 2/4 Non-ICU ( )/ICU (83 35 ) 1/1 2/4 AmpC L (67 47 )/AmpC H (77 53 ) b 1/1 2/4 a S, susceptible; R, resistant. b AmpC expression in one random isolate from each of the different clones detected in previous studies (8) was determined. A total of 144 clones were analyzed, and 77 (53%) showed AmpC hyperproduction. AmpC L, wild-type (basal) AmpC expression; AmpC H, AmpC hyperproduction ( 10-fold increase in AmpC expression with respect to the PAO1 reference strain). around 50% of the carbapenem-resistant strains were nonsusceptible to the classical antipseudomonal cephalosporins CAZ (46%) and FEP (52%). Resistance to PIP-TZ (24.2%) was lower according to CLSI breakpoints. However, the major differences between U.S. and European breakpoints for PIP-TZ should be noted: if the EUCAST (European Society of Clinical Microbiology and Infectious Diseases; breakpoint for PIP-TZ ( 16 g/ml for the resistant category) were used instead of that of CLSI ( 64 g/ml for the resistant category), resistance rates would increase to 46.2%. Table 2 and Table 3 show the activity of CXA-101 against isolates resistant to each of the antibiotics tested, as well as the activity of CXA-101 against particularly relevant subgroups of isolates such as MDR isolates, isolates from intensive care Isolates a (n) units (ICU), or those hyperproducing AmpC. CXA-101 did not show cross-resistance with any of the antibiotics tested, since the MIC 50 remained 1 g/ml for all subgroups of resistant isolates (Table 2). Although the CXA-101 MIC 90 was higher for AMK-resistant isolates, 84% of strains still had MICs of 8 g/ml (Table 3). Furthermore, the MIC 50 /MIC 90 was still 1/4 g/ml when MDR isolates (42%), ICU isolates (35%), or AmpC-hyperproducing clones (53%) were analyzed (Table 2). The underlying resistance mechanisms for the 11 (4.7%) isolates showing CXA-101 MICs of 8 g/ml were further investigated, and the results are summarized in Table 4. As shown, almost all (9/11) of them met the criteria for MDR, and all of them were also resistant to CAZ. Interestingly, almost all (10/11) of the strains showing a CXA-101 MIC of 8 g/ml produced horizontally acquired -lactamases, including one isolate that produced the MBL VIM-2, one that produced the ESBL PER-1, and seven that produced several extended-spectrum OXA enzymes. Three isolates produced OXA-10 ESBL derivatives, including OXA-17 (two isolates) and OXA-101 (one isolate). Interestingly, four isolates belonging to two different clonal lineages produced a previously undescribed new OXA-2 derivative (W159R, designated OXA-144). Finally, one of the isolates produced and ESBL with a pi of 7.5 that could not be initially identified through the different sets of PCRs performed. Cloning experiments revealed the production of a new variant of the recently described BEL-1 ESBL (27) in this isolate (Table 3). This new ESBL variant, designated BEL-3, had a single amino acid substitution (P160S) with respect to BEL-1 (27). Synergy of tazobactam with CXA- 101 in these strains was limited, although cotesting with 8 g/ml of tazobactam reduced the mean CXA-101 MICs from 47 to 22 g/ml; a 2-fold or greater MIC reduction was observed in 6 of the 11 isolates and in 3 of 11 isolates the MICs were decreased to 8 g/ml (Table 4). To demonstrate the ESBL phenotype of the newly described OXA-2 variant OXA-144, bla OXA-2 and bla OXA-144 were cloned in pucp24 and then electroporated into P. aeruginosa PAO1. -Lactam MICs were then determined with selected transformants, and the results are shown in Table 5. While the TABLE 3. Cumulative number of isolates inhibited by increasing concentrations of CXA-101 No. (%) with CXA-101 MIC ( g/ml) of b : All (236) 2 (0.8) 10 (4.2) 74 (31.4) 174 (73.7) 210 (89.0) 222 (94.1) 225 (95.3) 225 (95.3) 228 (96.6) 232 (98.3) 236 (100) IMP R (225) 2 (0.9) 10 (4.4) 70 (31.1) 167 (74.2) 201 (89.3) 213 (94.7) 216 (96.0) 216 (96.0) 219 (97.3) 222 (98.7) 225 (100) MER R (161) 2 (1.2) 6 (3.7) 41 (25.5) 110 (68.3) 138 (85.7) 149 (92.5) 151 (93.8) 151 (93.8) 154 (95.7) 158 (98.1) 161 (100) TIC R (80) 0 (0.0) 1 (1.3) 11 (13.8) 48 (60.0) 62 (77.5) 70 (87.5) 72 (90.0) 72 (90.0) 74 (92.5) 77 (96.3) 80 (100) PIP R (67) 1 (1.5) 1 (1.5) 10 (14.9) 38 (56.7) 53 (79.1) 61 (91.9) 62 (92.5) 62 (92.5) 64 (95.5) 66 (98.5) 67 (100) PIP/TZ R (57) 1 (1.8) 3 (5.3) 10 (17.5) 31 (54.4) 43 (75.4) 51 (89.5) 52 (91.2) 52 (91.2) 54 (94.7) 56 (98.2) 57 (100) CAZ R (109) 1 (0.9) 3 (2.8) 13 (11.9) 61 (56.0) 89 (81.7) 98 (89.9) 100 (91.7) 100 (91.8) 103 (94.5) 106 (97.2) 109 (100) FEP R (123) 1 (0.8) 2 (1.6) 14 (11.4) 74 (60.2) 104 (84.6) 114 (92.7) 116 (94.3) 116 (94.3) 118 (95.9) 120 (97.6) 123 (100) ATM R (125) 1 (0.8) 4 (3.2) 26 (20.8) 85 (68.0) 106 (84.8) 116 (92.8) 118 (94.4) 118 (94.4) 120 (96.0) 123 (98.4) 125 (100) GEN R (139) 0 (0.0) 2 (1.4) 29 (20.9) 90 (64.7) 117 (84.2) 129 (92.8) 130 (93.5) 130 (93.5) 133 (95.7) 136 (97.8) 139 (100) TOB R (80) 0 (0.0) 1 (1.3) 10 (12.5) 45 (56.3) 67 (83.8) 72 (90.0) 73 (91.3) 73 (91.3) 75 (93.8) 78 (97.5) 80 (100) AMK R (44) 0 (0.0) 0 (0.0) 8 (18.2) 25 (56.8) 33 (75.0) 37 (84.1) 37 (84.1) 37 (84.1) 39 (88.6) 42 (95.5) 44 (100) CIP (126) 0 (0.0) 1 (0.8) 25 (19.8) 80 (63.5) 108 (85.7) 117 (92.9) 119 (94.4) 119 (94.4) 120 (95.2) 124 (98.4) 126 (100) MDR (98) 0 (0.0) 0 (0.0) 10 (10.2) 55 (56.1) 81 (82.7) 90 (91.8) 91 (92.9) 91 (92.9) 93 (94.9) 96 (98.0) 98 (100) a R, resistant. b MIC 50 and MIC 90 are in italic and bold, respectively.

4 VOL. 54, 2010 CXA-101 ACTIVITY AGAINST RESISTANT P. AERUGINOSA 849 Isolate TABLE 4. Characterization of the 11 isolates showing CXA-101MICs of 8 g/ml from the Spanish multicenter study of carbapenemresistant P. aeruginosa isolates Clone (PFGE) Etest MBL DDST Acquired lactamase pi MIC( g/ml) AMK TOB CIP IMP MER FEP CAZ PIP-TZ CXA CXA-TZ4 CXA-TZ8 1C2 PTOL1 Negative Negative OXA C3 PTOL1 Negative Negative OXA E1 PpA1 Negative Negative OXA E2 PpA1 Negative Negative OXA E3 PpA2 Negative Negative OXA B2 RCA2 Negative Positive PER D5 SA1 Positive Negative VIM C1 VAL6 Negative Negative None detected C8 GM1 Negative Positive OXA C9 GM1 Negative Positive OXA D2 GM2 Negative Positive BEL expression of the cloned OXA-2 did not significantly raise the MICs of antipseudomonal cephalosporins for PAO1, OXA- 144, containing a single W159R substitution, conferred highlevel resistance to CAZ and CXA-101, demonstrating that this mutation determines the origination of an extended-spectrum OXA enzyme. As documented for the clinical strains, moderate synergy of tazobactam was observed, decreasing the CXA- 101 MIC from 32 to 8 g/ml. DISCUSSION MDR P. aeruginosa is a growing problem with major clinical consequences. Resistance to all first-line antipseudomonal agents, including carbapenems, penicillins, cephalosporins, fluoroquinolones, and aminoglycosides, is no longer infrequent. This growing threat results from the extraordinary capacity of this microorganism to develop resistance to all these first-line antibiotics, mainly by the selection of mutations in chromosomal genes, and also from the increasing prevalence of transferable resistance determinants. Therefore, there is a growing unmet medical need for the development of new antipseudomonal agents that can overcome MDR in P. aeruginosa. CXA-101, previously designated FR264205, is a new promising cephalosporin intended for the treatment of P. aeruginosa infections that appears to be stable against the most common resistance mechanisms driven by mutation in this species, including the hyperexpression of AmpC and efflux pumps or the repression of porin OprD (15, 35, 36). Very recent data suggest that the activity of CXA-101 against Enterobacteriaceae and Gram-positive cocci might be similar to that of other extendedspectrum cephalosporins (1). A limited number of studies have evaluated the activity of CXA-101 against collections of P. aeruginosa clinical strains. Takeda et al. (36) tested 193 P. aeruginosa isolates from Japan, documenting excellent activity for FR (MIC 50 /MIC /1 g/ml), although the collection included a very limited number of cephalosporin (CAZ)-resistant isolates (13 of 193). Livermore et al. (15) recently tested a highly challenged panel of 56 MDR P. aeruginosa isolates from cystic fibrosis (CF) patients and found that CXA-101 was the most active drug, although up to 36% of the isolates showed an MIC of 8 g/ml. In this study we have evaluated the activity of CXA-101 against a large collection of well-characterized non-cf carbapenem-resistant and MDR P. aeruginosa isolates obtained in a large multicenter study in Spain (8, 33). The collection included up to 165 different P. aeruginosa clones from a large number of different hospitals and therefore should be highly representative. CXA-101 showed good activity against this collection of isolates (MIC 50 /MIC 90 of 1/4 g/ml and 95% MICs of 8 g/ml). Moreover, CXA-101 was the most potent antipseudomonal agent tested, and significant cross-resistance with any other -lactam or non- -lactam antibiotic was not detected. Furthermore, the activity of CXA-101 was not decreased in MDR (42% of all isolates) or ICU (35%) isolates or among AmpC-hyperproducing clones (53%). Interestingly, almost all of the CXA-101-resistant isolates produced a horizontally acquired -lactamase, consistent with recent findings showing that CXA-101 does not overcome MBL- or ESBL-mediated resistance (7, 15). Overall, these data strongly support the conclusion that CXA-101 is not markedly affected by any of the chromosomal resistance mechanisms in P. aeruginosa. Since the prevalence of acquired -lactamases such as MBLs or ESBLs in P. aeruginosa is still low in most hospitals worldwide, CXA-101 could be a useful therapeutic option for the treat- TABLE 5. -Lactam MICs for strain PAO1 producing OXA-2 (pucpoxa-2) or the new extended-spectrum variant OXA-144 (pucpoxa-144) Plasmid MIC( g/ml) PIP PIP-TZ CAZ FEP IMP MER CXA-101 CXA-101-TZ4 CXA-101-TZ8 pucp pucpoxa pucpoxa

5 850 JUAN ET AL. ANTIMICROB. AGENTS CHEMOTHER. ment of nosocomial infections caused by P. aeruginosa. Indeed, new therapeutic options for the treatment of infections caused by MDR P. aeruginosa are urgently needed, and therefore the documented high activity against MDR isolates is particularly encouraging. Finally, in addition of being a promising antipseudomonal agent, CXA-101 appears to be an excellent screening tool for the laboratory detection of the still-infrequent but highly concerning acquired -lactamases, such as MBLs or ESBLs, in P. aeruginosa. Only a limited number of ESBL-producing P. aeruginosa isolates have been detected so far in Spain (11, 37, 38), but it is noteworthy that none of the ESBLs described here were detected in a previous study (8) using conventional phenotypic tests for screening. Furthermore, this study is the first to describe several OXA or BEL ESBLs in Spain. These data suggest that, although they are still infrequent, ESBL-producing P. aeruginosa strains might be more prevalent than we anticipated. Whether the situation is similar in other geographic areas still must be elucidated, since extensive studies using phenotypic, biochemical, and genetic approaches for the detection of ESBLs in P. aeruginosa are very scarce in the literature so far. Although synergy of CXA-101 with -lactamase inhibitors, such as TZ, is limited against strains producing some of these acquired enzymes, combination with TZ slightly enhanced the overall good activity of CXA-101. In conclusion, CXA-101, a new cephalosporin antibiotic in phase 2 clinical development, demonstrated potent in vitro antipseudomonal activity, including against carbapenem-resistant and MDR isolates. ACKNOWLEDGMENTS We are grateful to the members of the Spanish Group for the Study of Pseudomonas (a complete list is available in reference 33) for providing the tested strains and particularly to E. Bouza and E. Cercenado, from H. Gregorio Marañón in Madrid, for their contribution to this project. This work was supported by a grant from Calixa Therapeutics and by the Ministerio de Sanidad y Consumo, Instituto de Salud Carlos III, through the Spanish Network for Research in Infectious Diseases (REIPI C03/14 and RD06/0008). REFERENCES 1. Brown, N. P., C. M. Pillar, D. F. Sham, and Y. Ge Activity profile of CXA-101 and CXA-101/tazobactam against target Gram-positive and Gramnegative pathogens, abstr. F Abstr. 49th Intersci. Conf. Antimicrob. Agents Chemother., San Francisco, CA. 2. Cavallo, J. D., D. Hocquet, P. Plesiat, R. Fabre, and M. Roussel-Delvallez Susceptibility of Pseudomonas aeruginosa to antimicrobials: a 2004 French multicentre hospital study. J. Antimicrob. Chemother. 59: Coque, T. M., A. Oliver, J. C. Perez-Diaz, F. Baquero, and R. Canton Genes encoding TEM-4, SHV-2, and CTX-M-10 extended-spectrum betalactamases are carried by multiple Klebsiella pneumoniae clones in a single hospital (Madrid, 1989 to 2000). Antimicrob. Agents Chemother. 46: Deplano, A., O. Denis, L. Poirel, D. Hocquet, C. Nonhoff, B. Byl, P. Nordmann, J. L. Vincent, and M. J. Struelens Molecular characterization of an epidemic clone of panantibiotic resistant Pseudomonas aeruginosa. J. Clin. Microbiol. 43: El Amin, N., C. G. Giske, S. Jalal, B. Keijser, G. Kronvall, and B. Wretlind Carbapenem resistance mechanisms in Pseudomonas aeruginosa: alterations of porin OprD and efflux proteins do not fully explain resistance patterns observed in clinical isolates. APMIS 113: Empel, J., K. Filczak, A. Mrowka, W. Hryniewicz, D. M. Livermore, and M. Gniadkowski Outbreak of Pseudomonas aeruginosa infections with PER-1 extended-spectrum -lactamase in Warsaw, Poland: further evidence for an internacional clonal complex. J. Clin. Microbiol. 45: Giske, C. G., J. Ge, and P. Nordmann Activity of cephalosporin CXA-101 (FR264205) and comparators against extended-spectrum- -lactamase-producing Pseudomonas aeruginosa. J. Antimicrob. Chemother. 64: Gutiérrez, O., C. Juan, E. Cercenado, F. Navarro, E. Bouza, P. Coll, J. L. Pérez, and A. Oliver Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa isolates from Spanish hospitals. Antimicrob. Agents Chemother. 51: Hocquet, D., P. Berthelot, M. Roussel-Delvallez, R. Favre, K. Jeannot, O. Bajolet, N. Marty, F. Grattard, P. Mariani-Kurkdjan, E. Bingen, M. O. Housson, G. Couetdic, and P. Plesiat Pseudomonas aeruginosa may accumulate drug resistance mechanisms without losing its ability to cause bloodstream infections. Antimicrob. Agents Chemother. 51: Juan, C., M. D. Maciá, O. Gutiérrez, C. Vidal, J. L. Pérez, and A. Oliver Molecular mechanisms of -lactam resistance mediated by AmpC hyperproduction in Pseudomonas aeruginosa clinical strains. Antimicrob. Agents Chemother. 49: Juan, C., X. Mulet, L. Zamorano, S. Alberti, J. L. Peréz, and A. Oliver Detection of the novel extended spectrum beta-lactamase OXA-161 from a plasmid-located integron in Pseudomonas aeruginosa clinical isolates in Spain. Antimicrob. Agents Chemother. 53: Lauretti, L., M. L. Riccio, A. Mazzariol, G. Cornaglia, G. Amicosante, R. Fontana, and G. M. Rossolini Cloning and characterization of bla VIM, a new integron-borne metallo-beta-lactamase gene from a Pseudomonas aeruginosa clinical isolate. Antimicrob. Agents Chemother. 43: Leibovici, L., I. Shraga, M. Drucker, H. Konigsberger, Z. Samra, and S. D. Pitliks The benefit of appropriate empirical antibiotic treatment in patients with bloodstream infection. J. Intern. Med. 244: Livermore, D. M Multiple mechanisms of antimicrobial resistance in Pseudomonas aeruginosa: our worst nightmare? Clin. Infect. Dis. 34: Livermore, D. M., S. Mushtaq, Y. Ge, and M. Wagner Activity of cephalosporin CXA-101 (FR264205) against Pseudomonas aeruginosa and Burkholderhia cepacia group strains and isolates. Int. J. Antimicrob. Agents. 34: Luzzaro, F., E. Mantengoli, M. Perilli, G. Lombardi, V. Orlandi, A. Orsatti, G. Amicosante, G. M. Rossolini, and A. Tolino Dynamics of a nosocomial outbreak of multidrug-resistant Pseudomonas aeruginosa producing the PER-1 extendend-spectrum -lactamase. J. Clin. Microbiol. 39: Masuda, N., E. Sakagawa, S. Ohya, N. Gotoh, H. Tsujimoto, and T. Nishino Substrate specificities of MexAB-OprM, MexCD-OprJ, and MexXY- OprM efflux pumps in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 44: Mesaros, N., P. Nordmann, P. Plesiat, M. Roussel-Delvallez, J. Van Eldere, Y. Glupczynski, Y. van Laethem, F. Jacobs, P. Lebesque, A. Malfroot, P. M. Tulkens, and F. van Bambeke Pseudomonas aeruginosa: resistance and therapeutics options in the turn of the new millennium. Clin. Microbiol. Infect. 13: Moya, B., A. Döstch, C. Juan, J. Blázquez, L. Zamorano, S. Haussler, and A. Oliver lactam resistance response triggered by inactivation of a nonessential penicillin-binding protein. PloS Pathog. 5:e Obritsch, M. D., D. N. Fish, R. MacLaren, and R. Jung National surveillance of antimicrobial resistance in Pseudomonas aeruginosa isolates obtained from intensive care unit patients from 1993 to Antimicrob. Agents Chemother. 48: Oliver, A., L. M. Weigel, J. K. Rasheed, J. E. McGowan, P. Raney, and F. C. Tenover Mechanisms of decreased susceptibility to cefpodoxime in Escherichia coli. Antimicrob. Agents Chemother. 46: Peña, C., C. Suárez, F. Tubau, O. Gutiérrez, A. Domínguez, A. Oliver, M. Pujol, F. Gudiol, and J. Ariza Nosocomial spread of Pseudomonas aeruginosa producing the metallo- -lactamase VIM-2 in a Spanish hospital: clinical and epidemiological implications. Clin. Microbiol. Infect. 13: Pirnay, J. P., D. de Vos, D. Mossialos, A. Vanderkelen, P. Cornelis, and M. Zizi Analysis of the Pseudomonas aeruginosa oprd gene from clinical and environmental isolates. Environ. Microbiol. 4: Poirel, L., T. Naas, D. Nicolas, L. Collet, S. Bellais, J. D. Cavallo, and P. Nordmann Characterization of VIM-2, a carbapenem-hydrolyzing metallo -lactamase and its plasmid- and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France. Antimicrob. Agents Chemother. 44: Poirel, L., D. Girlich, T. Nass, and P. Nordmann OXA-28, an extended-spectrum variant of OXA-10 -lactamase from Pseudomonas aeruginosa and its plasmid- and integron-located gene. Antimicrob. Agents Chemother. 45: Poirel, L., L. Cabanne, H. Vahaboglu, and P. Nordmann Genetic environment and expression of the extended-spectrum -lactamase bla PER-1 gene in gram-negative bacteria. Antimicrob. Agents Chemother. 49: Poirel, L., L. Brinas, A. Verlinde, L. Ide, and P. Nordmann BEL-1, a novel clavulanic acid-inhibited extendend-spectrum -lactamase, and the class 1 integron In20 in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 49:

6 VOL. 54, 2010 CXA-101 ACTIVITY AGAINST RESISTANT P. AERUGINOSA Poole, K Efflux-mediated multiresistance in Gram-negative bacteria. Clin. Microbiol. Infect. 10: Pournaras, S., M. Maniati, E. Petinaki, L. S. Tzouvelekis, A. Tsakiris, N. J. Legakis, and A. N. Maniatis Hospital outbreak of multiple clones of Pseudomonas aeruginosa carrying the unrelated metallo- -lactamase gene variants bla VIM-2 and bla VIM-4. J. Antimicrob. Chemother. 51: Quale, J., S. Bratu, J. Gupta, and D. Landman Interplay of efflux system, ampc, and oprd expression in carbapenem resistance of Pseudomonas aeruginosa clinical isolates. Antimicrob. Agents Chemother. 50: Riccio, M. L., L. Pallecchi, R. Fontana, and G. M. Rossolini In70 of plasmid pax22, a bla VIM-1 -containing integron carrying a new aminoglycoside phosphotransferase gene cassette. Antimicrob. Agents Chemother. 45: Rossolini, G. M., F. Luzzaro, R. Migliavacca, C. Mugnaioli, B. Pini, F. De Luca, M. Perilli, S. Pollini, M. Spalla, G. Amicosante, A. Toniolo, and L. Pagani First countrywide survey of acquired metallo- -lactamases in gram-negative pathogens in Italy. Antimicrob. Agents Chemother. 52: Sánchez-Romero, I., E. Cercenado, O. Cuevas, N. García-Escribano, J. García-Martínez, E. Bouza, and the Spanish Group for the Study of Pseudomonas aeruginosa Evolution of the antimicrobial resistance of Pseudomonas aeruginosa in Spain: second national study (2003). Rev. Esp. Quimioter. 20: Smith, A. W., and B. H. Iglewski Transformation of Pseudomonas aeruginosa by electroporation. Nucleic Acids Res. 17: Takeda, S., Y. Ishii, K. Hatano, K. Tateda, and K. Yamaguchi Stability of FR against AmpC -lactamase of Pseudomonas aeruginosa. Int. J. Antimicrob. Agents 30: Takeda, S., T. Nakai, Y. Wakai, F. Ikeda, and K. Hatano In vitro and In vivo activities of a new cephalosporin, FR264205, against Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 51: Tato, M., A. Valverde, T. M. Coque, and R. Cantón PER-1 multiresistant Pseudomonas aeruginosa strain in Spain. Enferm. Infecc. Microbiol. Clin. 24: Viedma, E., C. Juan, J. Acosta, L. Zamorano, J. Otero, F. Sanz, F. Chaves, and A. Oliver Nosocomial spread of colistin-only-sensitive ST235 Pseudomonas aeruginosa isolates producing the extended-spectrum -lactamases GES-1 and GES-5 in Spain. Antimicrob. Agents Chemother. 53: Walsh, T. R., M. A. Toleman, L. Poirel, and P. Nordmann Metallobeta-lactamases: the quiet before the storm? Clin. Microbiol. Rev. 18: West, S. E., H. P. Schweizer, C. Dall, A. K. Sample, and L. J. Runyen- Janecky Construction of improved Escherichia-Pseudomonas shuttle vectors derived from puc18/19 and sequence of the region required for their replication in Pseudomonas aeruginosa. Gene 148: Wolter, D. J., N. D. Hanson, and P. D. Lister Insertional inactivation of oprd in clinical isolates of Pseudomonas aeruginosa leading to carbapenem resistance. FEMS Microbiol. Lett. 236: Downloaded from on April 21, 2018 by guest