Supplementary Materials for
|
|
- Duane Watson
- 6 years ago
- Views:
Transcription
1 Supplementary Materials for Neuronal heparan sulfates promote amyloid pathology by modulating brain amyloid- clearance and aggregation in Alzheimer s disease Chia-Chen Liu, Na Zhao, Yu Yamaguchi, John R. Cirrito, Takahisa Kanekiyo, David M. Holtzman, Guojun Bu* The PDF file includes: *Corresponding author. bu.guojun@mayo.edu Published 30 March 2016, Sci. Transl. Med. 8, 332ra44 (2016) DOI: /scitranslmed.aad3650 Materials and Methods Fig. S1. Characterization of neuronal HS-deficient mice. Fig. S2. The mrna expression of HSPG subfamily in APP/PS1 and APP/PS1; next1 CKO mice. Fig. S3. HSPG core proteins codeposit with amyloid plaques in the brain parenchyma and leptomeningeal arteries. Fig. S4. Deficiency of neuronal HS leads to a decrease in amyloid-associated astrogliosis. Fig. S5. Deficiency of neuronal HS increases the clearance of ISF A 42 in the hippocampus of APP/PS1 mice. Fig. S6. A 40 and A 42 deposition is reduced in brain parenchyma, but enhanced along the cerebral vasculature in neuronal HS-deficient mice. Fig. S7. Proposed mechanism by which neuronal HS/HSPGs may regulate brain A clearance and aggregation. Table S1. Demographic characteristics of examined controls and individuals with AD. Table S2. A concentration in the cortex and hippocampus in APP/PS1 and APP/PS1; next1 CKO mice.
2 SUPPLEMENTARY MATERIALS Materials and Methods Animals Ext1 forebrain neuronal knockout mice were generated by breeding the Ext1 flox/flox mice with CaMKII-Cre mice (Jackson Labs) in which the Cre recombinase is expressed broadly in excitatory neurons of the forebrain, including the hippocampus and the cortex (28). Ext1 flox/flox mice were bred to CaMKII-Cre mice to generate HS neuronal deficient (next1 CKO ) mice. To generate APP/PS1 mice with neuronal HS deficiency, APP/PS1; Ext1 flox/flox mice were bred with Ext1 flox/flox, CaMKII-Cre mice. Both male and female APP/PS1; Ext1 flox/flox, CaMKII-Cre (APP/PS1; next1 CKO mice) and littermate control APP/PS1; Ext1 flox/flox (APP/PS1) mice were used for analysis. For tissue preparation, mice were transcardially perfused with PBS. Different regions of brain tissues (cortex, hippocampus and cerebellum) were snap-frozen in liquid nitrogen and stored at -80 C until processing. RNA isolation and real-time PCR analysis Total RNA was isolated by using Trizol (QIAGEN) followed by RNeasy Mini kit (QIAGEN). For real-time PCR analysis, cdna was synthesized from total RNA by SuperScript III reverse transcriptase (Invitrogen). The primer sequences were as follows: IL-1β: 5'- CCTGCAGCTGGAGAGTGTGGAT-3'; 5'-TGTGCTCTGCTTGTGAGGTGCT-3'; TNF-α: 5'- AGCCCACGTCGTAGCAAACCAC-3'; 5'-AGGTACAACCCATCGGCTGGCA-3'; β-actin: 5'- AGTGTGACGTTGACATCCGTA-3'; 5'-GCCAGAGCAGTAATCTCCTTC-3'; IL-6: 5'-CTCT GGGAAATCGTGGAAAT-3'; 5'-CCAGTTTGGTAGCATCCATC-3'; MMP2: 5'-GTCGCCCC TAAAACAGACAA-3'; 5'-GGTCTCGATGGTGTTCTGGT-3'; MMP9: 5'-CGTCGTGATCCC
3 CACTTACT-3'; 5'-AACACACAGGGTTTGCCTTC-3'; IDE: 5'-ACTAACCTGGTGGTGAAG- 3'; 5'-GGTCTGGTATGGGAAATG-3'; NEP: 5'-GCAGCCTCAGCCGAAACTAC-3'; 5'-CACC GTCTCCATGTTGCAGT-3'; Ext1: 5 -GCCCTTTTGTTTTATTTTGG-3 ; 5 -TCTTGCCTTTGT AGATGCTC-3 glypican-1: 5'-GAGCACAGTAGACCAACTTCT-3'; 5'-TGGCTGCACGTTCC TTT-3'; glypican-3: 5'-CTATATTGGCGTTGCTGGGA-3'; 5'-CTACCATCCATGATTCCATC CAG-3'; syndecan-1: 5'-TGTGTTCTCCCCAGATGTTTC-3'; 5'-CATCAAAGAGGTTGTCGA GGA-3'; syndecan-3: 5'-CACTTACTGGCACCTCTGG-3'; 5'-CCAGTCACCACCCAGGA-3'; agrin: 5'-CACAGCTTTCCCATTCTTCAC-3'; 5'-TCGACAACAGCAGACCATTC-3'; perlecan: 5'-TCGATCTGCAGCTGGGT-3'; 5'-CCAGATCCGACTGAGCTTTG-3'. Triplicate reactions were prepared using a 25- l mixture containing universal SYBR Green Supermix (Bio-Rad). Real-time quantification was performed on icycle iq system (Bio-Rad). Immunofluorescence staining Paraffin-embedded sections were blocked with PBS containing 5% of normal serum (goat or rabbit) and 0.3% Triton-X-100 for 30 min at room temperature. When mouse monoclonal antibody was used, brain sections were blocked with M.O.M. IgG blocking reagent (Vector Labs) for 1 hr. For Aβ staining, antigen retrieval was performed by incubating the slides with 88% formic acid for 30 min, followed by 30 min of steam at 95 C in dh2o. Sections were incubated with primary antibody anti-hs (10E4; Seikagaku America, Amsbio), anti-syndecan-3 (R&D), anti-glypican-1 (M95; Santa Cruz), anti-agrin (Santa Cruz) or anti-perlecan (A7L6; Millipore) overnight at 4 C. To verify the specificity of HS antibody, slides were treated with Heparinase III (Sigma) [10 miu/ml in PBS containing sodium and magnesium chloride for 2 hr at 37 C], which eliminated the HS epitope recognized by 10E4 antibody. For frozen
4 cryosections, brain tissue was fixed with acetone and incubated with 5% normal serum from the host species of the secondary antibody, followed by primary antibody. After washing with PBS, brain sections were incubated with Alexa488-conjugated or Alexa568-conjugated IgG secondary antibodies against mouse, rabbit, goat or rat species (1:400; Invitrogen) for 2 hr at room temperature. Alexa488-conjugated goat anti-mouse IgM secondary antibody was used for detecting HS. Sections were mounted with Vector Vectashield fluorescence mounting medium (Vector Labs) containing DAPI for counterstaining of nuclei. To examine the amyloid deposits by Congo red staining, tissue slides were immersed in 0.5% Congo red fluorescent dye (in 50% alcohol) for 20 min, rinsed in distilled water and quickly dipped in alkaline alcohol solution (1% Sodium hydroxide and 50% alcohol). For each HSPG staining, the numbers of amyloid plaques and HSPG-positive plaques from twelve microscopical fields (magnification x100) were manually counted. The percentage of amyloid plaques stained for a specific HSPG was calculated. ELISA quantification Human syndecan-3, syndecan-4 and glypican-3 were measured using a DuoSet ELISA kit (R&D Systems) according to manufacturer s instructions. Human glypican-1 was examined using commercial ELISA (USCN Business Co.) according to manufacturer s instructions. Syndecan-1, perlecan and agrin were analyzed using the Meso Scale Discovery (MSD) SECTOR Imager system. The 96-well plates were coated overnight at 4 C with capture antibody in TBS. After blocking, plates were incubated overnight at 4 C with samples in assay buffer (5 mm NaH2PO4, 20 mm Na2HPO4, 0.1% NaN3, 0.4 M NaCl, 2 mm EDTA, 0.4% Block Ace, 0.5 g/l CHAPS). After washes, plates were incubated for 1 hr at room temperature with detection antibody,
5 followed by SULFO-TAG-labeled anti-mouse, anti-rabbit, or secondary antibodies (Meso Scale Discovery). The signals were measured using the Meso Scale Discovery SECTOR Imager 2400 reader. The amount of syndecan-1 was measured by MSD assay using a polyclonal goat antihuman syndecan-1 as capture antibody (R&D) and biotin-conjugated anti-human syndecan-1 as detection antibody (R&D). The recombinant human syndecan-1 protein (R&D) was used a standard. The amount of perlecan was measured by MSD assay using a mouse monoclonal antihuman perlecan as capture antibody (Thermo Scientific) and a biotin-conjugated anti-human perlecan as detection antibody (R&D). The recombinant human perlecan protein (R&D) was used a standard. The amount of agrin was measured by MSD assay using a rabbit polyclonal anti-agrin (USCN Business Co.) as capture antibody and goat polyclonal anti-agrin (Santa Cruz) as detection antibody. The recombinant human agrin protein (R&D) was used a standard. The quantitation of heparan sulfate was performed as previously described (30). Briefly, tissues were homogenized in buffer (50 mm Tris-HCl, 1 mm CaCl2 and 1% Triton X-100), incubated with pronase (1 mg/ml) at 55 C for 24 hr, and centrifuged. The amount of heparan sulfate in the supernatant was determined by commercial ELISA (Seikagaku America, Amsbio). Western blot analysis Samples were homogenized and incubated in PBS containing 1% Triton X-100, supplemented with protease inhibitor mix and PhosSTOP (Roche). Equal amounts of protein (by Bradford assay) were resolved by SDS/PAGE and transferred to PVDF membranes. After the membranes were blocked, proteins were detected with primary antibody. The membrane was probed with LI- COR IRDye secondary antibodies and detected using the Odyssey infrared imaging system (LI- COR). For Western blot analysis, the following antibodies were used in this study: anti-gfap
6 (Millipore), 6E10 (Covance) for total APP and sapp, anti-human sapp (IBL), anti-app C- terminal antibody (IBL) for APP-CTFs and anti- -actin (Sigma) antibodies.
7 Fig. S1. Characterization of neuronal HS-deficient mice. (A) The mrna expression of Ext1 in the cortex (n=8/group) and cerebellum (n=5/group) of APP/PS1 and APP/PS1; next1 CKO mice examined by real-time PCR. N.S., not significant; **P < (B) The amount of HS in the cortex, hippocampus (Hippo) and cerebellum (Cereb) of APP/PS1 and APP/PS1; next1 CKO mice (n=4/group) evaluated by HS ELISA. Data represent mean ± SEM. N.S., not significant; **P < (C, D) Amyloid deposits and HS in the brain parenchyma (C) and leptomeningeal arteries (D) stained with anti-hs (green) antibody and Congo red for amyloid fibrils, the amyloid core of mature plaques. HS reactivity is abolished by treatment with heparinase III. Scale bar, 50 µm.
8 Fig. S2. The mrna expression of HSPG subfamily in APP/PS1 and APP/PS1; next1 CKO mice. The amounts of glypican-1, glypican-3, syndecan-1, syndecan-3, agrin and perlecan in the cortex of APP/PS1 and APP/PS1; next1 CKO mice (n=6-8/group) evaluated by real-time PCR. Note that neuronal HS deficiency did not significantly affect the expression of HSPG core proteins. Data represent mean ± SEM. N.S., not significant. Statistical analysis was performed using Student s t test.
9 Fig. S3. HSPG core proteins codeposit with amyloid plaques in the brain parenchyma and leptomeningeal arteries. (A) Brain sections from APP/PS1 and APP/PS1; next1 CKO mice at 12 months of age were co-immunostained for syndecan-3 (SDC-3), glypican-1 (GPC-1), agrin or perlecan (red) together with Aβ (green), and counterstained with DAPI (blue) for nuclei. Representative images of co-staining are shown. Scale bar, 50 µm. (B) The numbers of amyloid plaques and HSPG-positive plaques were counted, and the percentages of plaques positive for GPC-1, SDC-3, and agrin are shown. Data represent mean ± SEM. **P < (C) Brain
10 sections from APP/PS1 and APP/PS1; next1 CKO mice at 12 months of age were coimmunostained for SDC-3, agrin or perlecan (red) with Aβ (green), and counterstained with DAPI (blue). Representative images of the leptomeningeal arteries are shown. Scale bar, 50 m.
11 Fig. S4. Deficiency of neuronal HS leads to a decrease in amyloid-associated astrogliosis. (A) Brain sections from APP/PS1 and APP/PS1; next1 CKO mice at 12 months of age were coimmunostained with GFAP (red) and Aβ (green) antibodies. Scale bar, 100 µm. (B) Brain sections from APP/PS1 and APP/PS1; next1 CKO mice at 12 months of age were coimmunostained with Iba1 (red) and Aβ (green) antibodies. Scale bar, 100 µm.
12 Fig. S5. Deficiency of neuronal HS increases the clearance of ISF Aβ42 in the hippocampus of APP/PS1 mice. APP/PS1 and APP/PS1; next1 CKO mice (n= 5-7/group) were analyzed at the age of 3-4 months. (A) To assess Aβ42 half-life, the mice were treated with a -secretase inhibitor, and the hippocampal ISF A 42 amount was monitored. The ISF Aβ concentration during the hours of 9-16 after probe implantation were averaged and served as the basal amount of Aβ (shown as -1~0 hr) prior to -secretase injection. (B) The common logarithm of percentage baseline ISF Aβ42 concentrations versus time is plotted. Data represent mean ± SEM. (C) The slope from the individual linear regressions from log (% ISF Aβ42) versus time for each mouse was used to calculate the mean half-life (t1/2) of elimination for Aβ42 from the ISF. Data represent mean ± SEM. *P < 0.05.
13
14 Fig. S6. Aβ40 and Aβ42 deposition is reduced in brain parenchyma, but enhanced along the cerebral vasculature in neuronal HS-deficient mice. (A) Brain sections from APP/PS1 and APP/PS1; next1 CKO mice at 12 months of age were immunostained for Aβ40 (red) antibody and counterstained with DAPI (blue). Representative images of Aβ40 staining in the cortex and hippocampus are shown. Scale bar, 100 m. (B) Brain sections from APP/PS1 and APP/PS1; next1 CKO mice at 12 months of age were immunostained for Aβ42 (red) antibody, and counterstained with DAPI (blue). Representative images of Aβ42 staining in the cortex and hippocampus are shown. Scale bar, 100 m. (C) Representative images of Aβ40 and Aβ42 staining in the leptomeningeal arteries are shown. Scale bar, 50 m.
15 Fig. S7. Proposed mechanism by which neuronal HS/HSPGs may regulate brain A clearance and aggregation. The major A clearance pathways include receptor-mediated lysosomal clearance by cells (neurons and glia) along the ISF drainage pathway or through BBB, and proteolytic degradation by neprilysin (NEP) and insulin degrading enzyme (IDE) (6, 46, 58-60). An impaired clearance of A results in A accumulation in the brain, leading to the formation of toxic A oligomers and amyloid plaques. Binding of A to neuronal HSPGs on the cell surface hinders proteolytic degradation of Aβ, and functions as a catalyst that promotes Aβ oligomerization/aggregation. Thus, in the presence of neuronal HS, Aβ aggregation is accelerated at the neuronal surface or intracellular compartments, leading to eventual formation of extracellular soluble Aβ oligomers. Depletion of neuronal HS leads to more efficient clearance of Aβ through neuronal LRP1, astrocytes/microglia, and extracellular proteolysis, leading to reduced Aβ aggregation in the brain parenchyma and redistribution of Aβ to the cerebrovascular compartments.
16 Table S1. Demographic characteristics of controls and individuals with AD.
17 Table S2. Aβ concentration in the cortex and hippocampus in APP/PS1 and APP/PS1; next1 CKO mice (Data shown in Fig. 1B-E). Aβ40 in cortex Aβ42 in cortex TBS (pg/mg) TBSX (pg/mg) GDN (ng/mg) TBS (pg/mg) TBSX (pg/mg) GDN (ng/mg) Ctrl KO Ctrl KO Ctrl KO Ctrl KO Ctrl KO Ctrl KO Aβ40 in hippocampus Aβ42 in hippocampus TBS (pg/mg) TBSX (pg/mg) GDN (ng/mg) TBS (pg/mg) TBSX (pg/mg) GDN (ng/mg) Ctrl KO Ctrl KO Ctrl KO Ctrl KO Ctrl KO Ctrl KO
Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationSensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*
Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein
More informationIsolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
More informationSmooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation
Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang
More informationSupplemental information
Supplemental information - Control samples (200 subjects) - Immunohistochemistry of rat brain - Immunocytochemistry on neuronal cultures - Immunocompetition assay - Immunoprecipitation - Immunocytochemistry
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationTechnical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
More informationMouse TNF alpha ELISA Kit
Mouse TNF alpha ELISA Kit Catalog No. GWB-ZZD049 Size 96 wells/kit Sandwich ELISA kit for quantitative detection of mouse TNF alpha in cell culture supernates, serum and plasma(heparin, EDTA). Typical
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationRat α-melanocyte stimulating hormone (α-msh) ELISA Kit
Rat α-melanocyte stimulating hormone (α-msh) ELISA Kit For the quantitative determination of rat α-melanocyte stimulating hormone (α-msh) concentrations in serum, plasma, tissue homogenates. This package
More informationab TripleStain IHC Kit: M&M&R on human tissue (DAB, Red/AP & DAB/Ni)
ab183287 TripleStain IHC Kit: M&M&R on human tissue (DAB, Red/AP & DAB/Ni) Instructions for Use For the detection of Rabbit and Mouse Primary antibodies on Human tissue or cell samples. This product is
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationFigure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining.
Supplementary information Supplementary figures Figure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining. Figure S2. Induction of Nur77 in
More informationRat IGF-1 ELISA Kit (rigf-1-elisa)
Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationHuman BDNF ELISA. For the precise measurement of BDNF in human serum, plasma, body fluids, tissue homogenate or cell culture supernates.
Product information User s Manual Human BDNF ELISA For the precise measurement of BDNF in human serum, plasma, body fluids, tissue homogenate or cell culture supernates. BE69099 Storage: 96 2-8 C RUO For
More informationTrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by
Supplemental Information Cell Culture TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by transducing BBM1 or 361 cells with a lentivirus encoding shrna for TrkB. Transduction was
More informationIn-Gel Western Detection Using Near-Infrared Fluorescence
In-Gel Western Detection Using Near-Infrared Fluorescence Developed for: Aerius, and Odyssey Family of Imagers Please refer to your manual to confirm that this protocol is appropriate for the applications
More informationThis Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
More informationSupporting Information
Supporting Information Jiao et al. 10.1073/pnas.1422998112 SI Materials and Methods Aggregation Inhibiting Test and Disaggregation Test. To test the inhibitory effect of Edaravone on Aβ aggregation, 1
More informationWeek 1: Protein isolation and quantification
Week 1: Protein isolation and quantification Objective The objective of this lab exercise is to obtain protein samples from fruit fly larvae, BCS and FBS, all of which are then quantitated in the preparation
More informationHow to run Alpha assay: How to setup an Alpha assay Make your own assay!
How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA
More informationToll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila
Cell Supplemental Information Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila Bo Liu, Yonggang Zheng, Feng Yin, Jianzhong Yu, Neal Silverman, and Duojia Pan Supplemental Experimental
More informationRespiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice
Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Belal A. Mohamed, Amal Z. Barakat, Torsten Held, Manar Elkenani, Christian Mühlfeld, Jörg Männer, and Ibrahim M. Adham
More informationMouse Luteinizing Hormone (LH) ELISA
Mouse Luteinizing Hormone (LH) ELISA For the quantitative determination of mouse LH in serum, plasma and tissue homogenates Cat. No. KU-222 For Research Use Only. Not for use in diagnostic procedures.
More informationHuman connective tissue growth factor (CTGF) ELISA Kit. MyBioSource.com. This package insert must be read in its entirety before using this product.
Human connective tissue growth factor (CTGF) ELISA Kit Catalog Number. For the quantitative determination of human connective tissue growth factor (CTGF) concentrations in serum, plasma, tissue homogenates.
More informationbiosensis Rat TNF-alpha (TNFα) /Tumor necrosis factor/cachectin/tumor necrosis factor ligand superfamily member 2 ELISA Kit Protocol
biosensis Rat TNF-alpha (TNFα) /Tumor necrosis factor/cachectin/tumor necrosis factor ligand superfamily member 2 ELISA Kit Protocol For the quantitative detection of rat TNFα in cell culture supernatants,
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More information*Corresponding author. Tel: ;
1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland
More informationSupporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
More informationLAMININ. For Immunohistochemical Demonstration of Laminin in Paraffin-embedded and Frozen Human Tissue Sections Stock No. IMMH-7
LAMININ For Immunohistochemical Demonstration of Laminin in Paraffin-embedded and Frozen Human Tissue Sections Stock No. IMMH-7 TABLE OF CONTENTS BACKGROUND AND PRINCIPLE... 4 REAGENTS AND EQUIPMENT PROVIDED...
More informationPurification Kits. Fast and Convenient PROSEP -A and PROSEP-G Spin Column Kits for Antibody Purification DATA SHEET
 Montage Antibody Purification Kits Fast and Convenient PROSEP -A and PROSEP-G Spin Column Kits for Antibody Purification DATA SHEET Available with immobilized Protein A or Protein G Easy-to-use Antibody
More informationBio Rad Itaq Manual For Western Blot Transfer System
Bio Rad Itaq Manual For Western Blot Transfer System Earn a FREE one year service contract on your Bio-Plex MAGPIX system when For a limited time, receive your third vial of itaq Univeral Supermix. Bio-Rad
More informationINOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807
INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended
More informationSupplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
More informationHuman IgG Antigen ELISA Kit
Human IgG Antigen ELISA Kit Catalog No: IHUIGGKT Lot No: SAMPLE INTENDED USE This human immunoglobulin G antigen assay is intended for the quantitative determination of total human IgG antigen in serum,
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and
More informationB-27 Plus Neuronal Culture System
USER GUIDE B-27 Plus Neuronal Culture System Catalog Number A3653401 Pub. No. MAN0017319 Rev. 1.0 WARNING! Read the Safety Data Sheets (SDSs) and follow the handling instructions. Wear appropriate protective
More information64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl
Number of DOTA per antibody The average number of DOTA chelators per antibody was measured using a reported procedure with modifications (1,2). Briefly, nonradioactive CuCl 2 (80-fold excess of DOTA antibodies)
More informationTo isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well
Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at
More informationBovine Prostaglandin E2 (PG-E2) ELISA Kit
Bovine Prostaglandin E2 (PG-E2) ELISA Kit Catalog Number. CSB-E14237B For the quantitative determination of endogenic bovine prostaglandin E2 (PG-E2) concentrations in serum, plasma, tissue homogenates.
More informationExperimental Protocol for Multiplex Fluorescent Blotting Using the ChemiDoc MP Imaging System
Experimental Protocol for Multiplex Fluorescent Blotting Using the ChemiDoc MP Imaging System Protocol Bulletin 6570 Stefanie L. Ritter and Donald G. Rainie, Deparment of Behavioral Neuroscience and Psychiatric
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationOrexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE,
Orexin A (HUMAN, MOUSE, RAT, PORCINE, OVINE, BOVINE) Western Blot Kit Protocol (Catalog #WBK-003-30) PHOENIX PHARMACEUTICALS, INC. TABLE OF CONTENTS 1. Kit Contents...2 2. Storage...2 3. Introduction...3
More informationHuman Amyloid Beta Peptide 1-42 (Aβ1-42) ELISA Kit
Human Amyloid Beta Peptide 1-42 (Aβ1-42) ELISA Kit Catalog Number. For the quantitative determination of human amyloid beta peptide 1-42 (Aβ1-42) concentrations in serum, plasma, tissue homogenates, cerebrospinal
More informationWhole Mount IHC Protocol
Whole Mount IHC Protocol Authors: Ruth Sullivan, Ryan Trevena and Kyle Wegner Creation Date: 03/17/2016 All steps should be conducted with gentle agitation on an orbital shaker, unless otherwise instructed.
More informationHuman IL-10 ELISA MAX Set Deluxe
Human IL-10 ELISA MAX Set Deluxe Cat. No. 430604 (5 plates) 430605 (10 plates) 430606 (20 plates) ELISA Set for Accurate Cytokine Quantification from Cell Culture Supernatant, Serum, Plasma or Other Body
More informationSTANDARD OPERATIONS PROCEDURES FOR THE COMMON FUND: PROTEIN CAPTURE REAGENTS PROGRAM (ELISA)
STANDARD OPERATIONS PROCEDURES FOR THE COMMON FUND: PROTEIN CAPTURE REAGENTS PROGRAM (ELISA) 1. PURPOSE This procedure is to be used for the characterization of purified monoclonal antibody. 2. SCOPE This
More informationMultiplex Fluorescent Western Blot Starter Kit for the Bio- Rad ChemiDoc MP
Page 1 of 7 INSTRUCTIONS: Z-310 Multiplex Fluorescent Western Blot Starter Kit for the Bio- Rad ChemiDoc MP Rockland Immunochemicals and Bio-Rad Laboratories have jointly developed an easy to use multiplex
More informationOdyssey Western Blotting Kits LT
Odyssey Western Blotting Kits LT Developed for: Odyssey Family of Imagers Please refer to your manual to confirm that this protocol is appropriate for the applications compatible with your Odyssey Imager
More informationHuman TGF-beta1 ELISA
K-ASSAY Human TGF-beta1 ELISA For the quantitative determination of TGF-beta1 in human cell culture supernates, serum, plasma (EDTA) and urine Cat. No. KT-1471 For Research Use Only. Not for diagnostic
More informationJust SNAP and go! SNAP i.d. 2.0 system for Western blotting and IHC
Just SNAP and go! SNAP i.d. 2.0 system for Western blotting and IHC EMD Millipore is a division of Merck KGaA, Darmstadt, Germany Multiple slides, multiple blots, multiple conditions. There s so much room
More informationProduct Information. Before you begin. Component A 1 vial of 30 ul vial of 300 ul each Glycerol. Tris
Glowing Products for Science Mix-n-Stain Antibody Labeling Kits Size: 1 labeling per kit Storage: -20 o C Stability: Stable for at least 1 year from date of receipt when stored as recommended. Components:
More informationMSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.
MSD Immuno-Dot-Blot Assays Example: High Throughput Western Blots Replacements Traditional Western Blots High content Molecular weight and immunoreactivity Labor and protein intensive Inherently low throughput
More informationImmunohistochemistry. How does it look like? When do we need IHC? When do we need IHC? In clinic: In research:
Introduction How does it look like? Immunohistochemistry Smooth muscle actin Parvalbumin Distrophyn Sandrine Bichet Head of Molecular Histology Platform Signal versus background 06.03.2012 IHC basics Introduction
More informationBrdU IHC Kit. For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells
K-ASSAY BrdU IHC Kit For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells Cat. No. KT-077 For Research Use Only. Not for Use in
More informationCF Dyes Next Generation Fluorescent Dyes Secondary antibody
CF Dyes Next Generation Fluorescent Dyes Secondary antibody OZYME 10 AVENUE AMPÈRE - CS 30268-78053 ST QUENTIN EN YVELINES CEDEX Tél. : 01 34 60 24 24 - Fax : 01 34 60 92 12 - www.ozyme.fr/info CF Dyes
More informationsirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
More informationMouse Factor XII Total ELISA Kit
Mouse Factor XII Total ELISA Kit Catalog No: IMFXIIKT-TOT Lot No: SAMPLE INTENDED USE This mouse coagulation Factor XII antigen assay is intended for the quantitative determination of total Factor XII
More informationEGFR (Phospho-Ser695)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely
More informationMitoBiogenesis In-Cell ELISA Kit (Colorimetric)
PROTOCOL MitoBiogenesis In-Cell ELISA Kit (Colorimetric) DESCRIPTION 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MS643 Rev.2 For identifying inhibitors and activators of mitochondrial biogenesis
More informationBovine prolactin/luteotropic hormone (PRL/LTH) ELISA Kit
Bovine prolactin/luteotropic hormone (PRL/LTH) ELISA Kit Catalog Number. MBS703224 For the quantitative determination of bovine prolactin/luteotropic hormone (PRL/LTH) concentrations in serum, plasma.
More informationhfab Rhodamine Housekeeping Antibodies
hfab Rhodamine Housekeeping Antibodies Catalog # Description 12004163 Anti-Actin hfab Rhodamine Antibody, 200 µl 12004164 Anti-Actin hfab Rhodamine Antibody, 40 µl 12004165 Anti-Tubulin hfab Rhodamine
More informationModified Rapid MAIPA Protocol
Modified Rapid MAIPA Protocol This method is based on the following publication; K Campbell, K Rishi, G Howkins, D Gilby, R Mushens, C Ghevaert, P Metcalfe, WH Ouwehand, G Lucas. A modified fast MAIPA
More informationNori TM Canine TGFβ2 ELISA Kit DataSheet
TGF-β2 (Transforming growth factor-beta 2) is a secreted protein known as a cytokine that performs many cellular functions and has a vital role during embryonic development (alternative names: Glioblastoma-derived
More informationStore samples to be assayed within 24 hours at 2-8 C. For long-term storage, aliquot and freeze samples at -20 C. Avoid repeated freeze-thaw cycles.
Human Retinol Binding Protein 4, RBP4 ELISA Kit Preparation Plate Washing Discard the solution in the plate without touching the side walls. Blot the plate onto paper towels or other absorbent material.
More informationMaterials and Methods Materials Required for Fixing, Embedding and Sectioning. OCT embedding matrix (Thermo Scientific, LAMB/OCT)
Page 1 Introduction Tissue freezing and sectioning is a rapid method of generating tissue samples (cryosections) for histological analysis, and obviates the need for wax embedding. The method is popular
More informationUpdated April 27, PRODUCT INSERT
Updated April 27, 2009 1 PRODUCT INSERT Hypoxyprobe, Inc. 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Hypoxyprobe Gemini Kit Kit Contents: Solid pimonidazole HCl (Hypoxyprobe -1)
More informationGeneric DELFIA Reagents
AD0005P-12 (en) 1 Generic DELFIA Reagents For Research Use Only These instructions for use apply to the following reagents: AD0038 DELFIA Eu-N1 PY20 antibody 50 µg vial AD0039 DELFIA Eu-N1 PY20 antibody
More informationIn-Cell Western Kits I and II
Odyssey and Aerius Infrared Imaging Systems In-Cell Western Assay Kits I and II Published November, 2006. The most recent version of this protocol is posted at http://biosupport.licor.com/protocols.jsp
More informationImmunofluorescence Staining Protocol for 3 Well Chamber, removable
Immunofluorescence Staining Protocol for 3 Well Chamber, removable This Application Note presents a simple protocol for the cultivation, fixation, and staining of cells using the 3 Well Chamber, removable.
More informationab BrdU Immunohistochemistry Kit
ab125306 - BrdU Immunohistochemistry Kit Instructions for Use For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells. This product
More informationHuman Corticosterone ELISA Kit
Human Corticosterone ELISA Kit Catalog No: IRAPKT3002 Lot No: SAMPLE INTRODUCTION Corticosterone is the adrenal steroid, the major glucocorticoid. Glucocorticoid hormones are also known as corticosteroid
More informationMouse Monoclonal Antibody Isotyping Reagents
Mouse Monoclonal Antibody Isotyping Reagents Catalog Number: SEK003 Storage Temperature: 2-8 C Fax : +86-10-58628220 Tel : +86-400-890-9989 http://www.sinobiological.com Description Mouse Monoclonal Antibody
More informationMouse Gonadotropin Releasing Hormone (GnRH) ELISA
KAMIYA BIOMEDICAL COMPANY Mouse Gonadotropin Releasing Hormone (GnRH) ELISA For the quantitative determination of mouse GnRH in serum, plasma, cell culture fluid and other biological fluids Cat. No. KT-58182
More informationStrep-tag detection in Western blots
Strep-tag detection in Western blots General protocol for the detection of Strep-tag fusion proteins Last date of revision April 2012 Version PR07-0010 www.strep-tag.com For research use only Important
More informationHuman alpha-galactosidase A / GLA ELISA Pair Set
Human alpha-galactosidase A / GLA ELISA Pair Set Catalog Number : SEK12078 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized
More informationHuman Myostatin, ELISA Kit (MSTN)
Human Myostatin, ELISA Kit (MSTN) 96 Tests Catalog Number: MBS733837 Store all reagents at 2-8 C Valid Period: six months For samples: Cell culture fluid & body fluid & tissue homogenate Serum or blood
More informationOne-step split GFP staining for sensitive protein detection and localization in mammalian cells
Supplementary Materials For: One-step split GFP staining for sensitive protein detection and localization in mammalian cells Lara Kaddoum 1,3, Eddy Magdeleine 1,3, Geoffrey S. Waldo 4, Etienne Joly 1,3,
More informationA Comparison of AlphaLISA and TR-FRET Homogeneous Immunoassays in Serum-Containing Samples
application Note A Comparison of and Homogeneous Immunoassays in Serum-Containing Samples Authors Anuradha Prasad, PhD, Catherine Lautenschlager, PhD, Stephen Hurt, PhD, David Titus, PhD and Stéphane Parent,
More informationPost-expansion antibody delivery, after epitope-preserving homogenization.
Supplementary Figure 1 Post-expansion antibody delivery, after epitope-preserving homogenization. (a, b) Wide-field fluorescence images of Thy1-YFP-expressing mouse brain hemisphere slice before expansion
More informationImmunohistochemistry: Basics and Methods
Immunohistochemistry: Basics and Methods Igor B. Buchwalow l Werner Böcker Immunohistochemistry: Basics and Methods Prof. Dr. Igor B. Buchwalow Prof. Dr. Werner Böcker Gerhard-Domagk-Institut für Pathologie
More informationCanine Cortisol(COR)ELISA Kit
Tel. +39-02-92150794 - Fax. +39-02-92157285 Canine Cortisol(COR)ELISA Kit Instruction Sample Types Validated Serum, blood plasma,saliva, Urine, and other related tissue Liquid. Please read this insert
More informationab Ubiquitylation Assay Kit (HeLa lysate-based)
ab139471 Ubiquitylation Assay Kit (HeLa lysate-based) Instructions for Use For the generation of ubiquitin-conjugated lysate proteins This product is for research use only and is not intended for diagnostic
More informationRegulation and Function of the IL-1 Family Cytokine IL-1F9 in Human Bronchial Epithelial Cells
Online Data Supplement Regulation and Function of the IL-1 Family Cytokine IL-1F9 in Human Bronchial Epithelial Cells Regina T. Chustz 1, Deepti R. Nagarkar 1, Julie A. Poposki 1, Silvio Favoreto, Jr 1,
More informationManufactured by. Zyagen Barnes Canyon Road San Diego, CA 92121, USA
Alkaline Phosphatase Immunohistochemistry Detection kits For detection of mouse, rabbit, goat, rat, sheep, chicken, guinea pig, and human primary antibodies Size: 500 Tests Catalog #: AK-011, Mouse Kit
More informationImmunohistochemistry: Basics and Methods
Immunohistochemistry: Basics and Methods Bearbeitet von Igor B Buchwalow, Werner Böcker 1st Edition. 2010. Buch. x, 153 S. Hardcover ISBN 978 3 642 04608 7 Format (B x L): 15,5 x 23,5 cm Gewicht: 445 g
More informationab Mouse and Rabbit Specific HRP/DAB (ABC) Detection IHC Kit
ab64264 - Mouse and Rabbit Specific HRP/DAB (ABC) Detection IHC Kit Instructions for Use For the detection of a specific antibody bound to an antigen in tissue sections. This product is for research use
More informationMouse Peptide YY (PYY) ELISA
Mouse Peptide YY (PYY) ELISA For the quantitative determination of mouse PYY in serum, plasma, cell culture fluid and other biological fluids Cat. No. KT-58705 For Research Use Only. Not for use in diagnostic
More informationProtocol for induction of expression and cell lysate production
Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected
More informationIMMUNOPRECIPITATION (IP)
1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us
More informationab Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit
ab128967 - Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit Instructions for Use For the detection of a specific antibody bound to an antigen in tissue sections. This product is for research use only
More informationFor the development of sandwich ELISAs to measure phosphorylated Vascular Endothelial Growth Factor Receptor 1 (VEGF R1/Flt-1) in cell lysates.
DuoSet IC Human Phospho-VEGF R1/Flt-1 Catalog Number DYC4170-2 Catalog Number DYC4170-5 For the development of sandwich ELISAs to measure phosphorylated Vascular Endothelial Growth Factor Receptor 1 (VEGF
More informationPARP-1 (cleaved) Human In-Cell ELISA Kit (IR)
ab110215 PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) Instructions for Use For the quantitative measurement of Human PARP-1 (cleaved) concentrations in cultured adherent and suspension cells. This product
More informationHuman Connective Tissue Growth Factor (CTGF) Elisa Kit
Human Connective Tissue Growth Factor (CTGF) Elisa Kit Catalog No. CSB-E07875h (96 tests) This immunoassay kit allows for the in vitro quantitative determination of human CTGF concentrations in serum,
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
More informationbiosensis ApoE/β-Amyloid (ApoE/Aβ) Complex ELISA Kit Catalogue Number: BEK P/2P
biosensis ApoE/β-Amyloid (ApoE/Aβ) Complex ELISA Kit Catalogue Number: BEK-2224-1P/2P For the detection of human ApoE/Aβ complexes in human CSF, brain tissue extracts and human transgenic mouse tissue
More information