Nature Immunology: doi: /ni Supplementary Figure 1
|
|
- Michael Nichols
- 6 years ago
- Views:
Transcription
1 Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact hypersensitivity model, with tracking of endogenous DCs (1) labeled by fluorescein skin painting, which was carried out at the same time as topical application of oxazolone. Alternatively, mice were pre-sensitized to oxazolone, prior to intradermal injection of CMFDA-labeled BMDCs (2) and further topical application of oxazolone. (b-c) Inguinal and axillary draining LNs from sensitized mice were harvested 6-48 h following application of oxazolone and FITC and analyzed by flow cytometry, with plots showing gating strategy for CD45 + CD11c + FITC + live cells (b), measuring numbers of CD45 + leukocytes and CD45 + CD11c + FITC + MHCclII + DC subsets (c). Data represent the mean ± s.e. (n = 5) from one experiment of three. n.s., not significant; *P < 0.05, **P < 0.01, Mann-Whitney U test.
2 Supplementary Figure 2 No overt differences were observed in lymphoid DC populations in naive Lyve / and Lyve +/+ BALB/c mice. (a-d) DC populations in inguinal LNs of naïve BALB/c Lyve -/- and Lyve +/+ littermates as assessed by flow cytometry, by total number of live cells (a), number of CD11c + MHCclII + DCs shown by representative density plots (b) and bar-and-whiskers graphs (c), or numbers of CD11c + MHCclII + subsets (d). Data are the mean ± s.e. from one representative experiment of three.
3 Supplementary Figure 3 C57BL/6 Lyve1 / mice exhibited a transient reduction in lymphatic trafficking of DCs after oxazolone-induced sensitization. Inguinal and axillary draining LNs from C57BL/6 Lyve1 -/- and Lyve1 +/+ mice were harvested at 6 h (a), 24 h (b) and 48 h (c) following skin sensitization with oxazolone and FITC and analyzed by flow cytometry, measuring numbers of CD45 + leukocytes and CD45 + CD11c + FITC + MHCclII + DC subsets. Data represent the mean ± s.e. (n = 5) from one experiment of three, * p < 0.05, ** p < 0.01, Mann-Whitney U test.
4 Supplementary Figure 4 Receptor-binding characteristics of LYVE-1 HA-blocking mabs, and effects on DC trafficking in BALB/c mice. (a, b) Binding affinity of rat anti-mouse LYVE-1 mabs B1/10, C1/8 and mab2125 to mouse LYVE-1 (a) or Jurkat cells transfectants (b), assessed by ELISA and flow cytometry respectively. (c) Relative potency of LYVE-1 mabs as inhibitors of bha binding to mouse LYVE-1 measured using transfected Jurkat cells and flow cytometry. Data are the mean fluorescence intensity (MFI) ± s.e. (n = 3), one experiment of three. (d) Partial epitope mapping of the mouse HABD, using single residue mutagenesis of recombinant receptor in transfected Jurkat cells. Location of residues contributing to mab epitopes (as identified by a reduction in mab binding of > 25% relative to wild-type receptor) plotted on individual space-filling models of the LYVE-1 HABD and colored red, blue or green. Residues forming the epitope for the human LYVE-1 HA blocking mab 3A are shown in a corresponding model of human LYVE-1 HABD, colored magenta. The conserved Cys84-Cys105 disulfide is highlighted in yellow and mutation of a predicted N-glycosylation site in tan. (e-i) Numbers of CD45 + leukocytes and CD45 + CD11c + FITC + MHCclII + DC subsets recovered from draining LNs of BALB/c mice immunized with anti-lyve-1 mabs, 24 h after oxazolone/fitc painting, assessed by flow cytometry. Data represent the mean ± s.e. (n = 5), one representative experiment of two. n.s., not significant; *P < 0.05; **P < 0.01, Mann-Whitney U test.
5 Supplementary Figure 5 Characterization of mouse BMDCs. (a-b) Bone marrow cells were extracted from wild-type BALB/c mice and cultured for 7 days in the presence of IL-4 and GM-CSF, then inducing maturation by addition of LPS prior to analysis of nonadherent cells by flow cytometry. Plots show gating strategy (a) with almost 90% of cells CD11c + MHCclII +. (b) Detection of surface HA using bvg1 and streptavidin-647 (grey shaded histogram), with hyaluronidase-treated cells as a control for non-specific binding (dark grey), revealed that HA was present on CD11c + MHCclII + cells (i) but largely absent from the minor population of CD11c - MHCclII + cells (ii). (c) Assessment of BMDC viability using LiveDead780 dye exclusion and analysis by FACS, following treatment for 72 h with 4-MU ( mm). 0.1 mm 4-MU was used in subsequent experiments. (d-e) Expression of the activation marker CD86 following treatment of BMDCs with 4-MU for 72 h (d) and then again at 24 h following removal of 4-MU from the medium (e). Data represent the mean ± s.e. (BMDCs prepared from 5 mice) from one representative experiment of three, **** p < , Mann-Whitney U test.
6 Supplementary Figure 6 In situ detection of HA on dermal DCs. (a) Whole-mount preparations of mouse ear tissue from CD11c-GFP (green) reporter mice, freshly resected then incubated for 2 h at 37 o C in either the absence (mock) or presence of hyaluronidase (HAase) prior to immunostaining using anti-mhcclii mab and anti-rat AlexaFluor568 (red), and bvg1 with streptavidin647 (blue). Bar = 10 m in upper panels, bar = 20 m in lower panels. (b) In parallel, ex vivo culturing of mouse ear tissue from CD11c-GFP (green) reporter mice was carried out for 24 h, prior to incubation in either absence or presence of hyaluronidase, then whole-mount immunostaining as above. Bar = 10 m. (c-e) Cells that had egressed from the skin explants during culture were fixed to microscope slide by cytospin before staining for immunofluorescence microscopy (e) HAase-treated egressed cells were also stained for bvg1, to show specificity of binding. Images captured by confocal microscope at magnification: 250X, (c, e) and 630X (a, b, d). (c) Bar = 20 m; (d) bar = 5 m; (e) bar = 10 m. Representative images from three separate repeated experiments are shown.
7 Supplementary Figure 7 LYVE-1 HA adhesive interactions are critical for endothelial transmigratory cup formation. (a, b) Confocal imaging of LYVE-1 + cup formation (red, AlexaFluor546) around DCs (green, CMFDA, either mouse BMDCs (a) or human MDDCs (b)) adhering to mouse (a) or human (b) LEC monolayers, incubated (3 h) in the presence of either the indicated rat anti-mouse LYVE-1-HA blocking mabs or control rat IgG (blue, AlexaFluor594), (a), or the anti-human HA blocking mab891, with HA detected by bvg1 and streptavidin647, (blue), (b). LYVE-1-enriched cups, indicated by arrows, are absent around murine DCs adhering to mlecs treated with mabs C1/8, mab2125 or mab891. (c) Mouse BMDCs and/or mlec monolayers were treated with hyaluronidase (HAase) prior to co-incubation (3 h) and then imaging by confocal microscopy. Cells were immunostained with bvg1 (green), with anti-cd44 (blue, as a marker for the leukocyte cell surface) and anti-lyve-1 (red). Magnification: 630X. (a) Bar = 10 m in Rat IgG, B1/10 and C1/8 panels; Bar = 20 m in mab2125 panels; (b) bar = 10 m; (c) bar = 20 m. Representative images from three separate repeated experiments are shown.
8 Supplementary Figure 8 Detection of LYVE-1-enriched transmigratory cups within mouse lymphatic capillaries in vivo. Confocal imaging of whole mount sections of mouse dermis, immunostained with rabbit anti-lyve-1 and goat anti-rabbit AlexaFluor 546 (red), 24 h following topical application of oxazolone and intradermal injection of CMFDA-labeled BMDCs (green). Images show LYVE-1 + endothelial cup-like structures surrounding individual DCs (indicated by arrows) at the basolateral surface of lymphatic vessels, with digital zoom images of selected z-stacks in panels on right. Magnification: 630X, bar = 20 m.
Nature Immunology: doi: /ni.3101
Supplementary Figure 1 Generation of Plvap / mice. (a) Schematic presentation of the targeting construct as well as the wild-type and targeted Plvap alleles]. PuroR, puromycin resistance. The location
More informationSUPPLEMENTARY INFORMATION
VOLUME: 1 ARTICLE NUMBER: 0011 In the format provided by the authors and unedited. In situ Activation of Platelets with Checkpoint Inhibitors for Post-Surgical Cancer Immunotherapy Chao Wang 1, 2, Wujin
More informationNature Biotechnology: doi: /nbt.4086
Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3
More informationMeasurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer
SUPPLEMENTAL METHODS Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer For Celigo experiments, 0.1 ml containing 5 x 10 4 cells was seeded into 96 well plates for 30 min
More informationisolated from ctr and pictreated mice. Activation of effector CD4 +
Supplementary Figure 1 Bystander inflammation conditioned T reg cells have normal functional suppressive activity and ex vivo phenotype. WT Balb/c mice were treated with polyi:c (pic) or PBS (ctr) via
More informationSupporting Information
Supporting Information Tomura et al. 1.173/pnas.8227815 WT CFSE Con A stimulation Before After 2 3 1 CFSE Kaede- Tg No photoconversion Photoconversion Kaede Red Fig. S1. Dilution of photoconverted Kaede
More informationFigure S1 is related to Figure 1B, showing more details of outer segment of
Supplemental Information Supplementary Figure legends and Figures Figure S1. Electron microscopic images in Sema4A +/+ and Sema4A / retinas Figure S1 is related to Figure 1B, showing more details of outer
More informationSupporting information. Supplementary figures.
Supporting information. Supplementary figures. Figure S1. Vacuolar parasite content is independent of the number of vacuoles per cell. The datasets employed for Fig. 1B were examined to determine the number
More informationSupplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating
Supplemental Figure Legend: Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating strategy for mouse MDSC. CD11b + Ly6C high Ly6G - cells are defined as M-MDSC. CD11b + Ly6C low
More informationSupplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM
Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM of Cx3cr1 GFP/+ mice related to Fig. 1a. MDP was defined
More informationDC enriched CD103. CD11b. CD11c. Spleen. DC enriched. CD11c. DC enriched. CD11c MLN
CD CD11 + CD + CD11 d g CD CD11 + CD + CD11 CD + CD11 + Events (% of max) Events (% of max) CD + CD11 Events (% of max) Spleen CLN MLN Irf fl/fl e Irf fl/fl h Irf fl/fl DC enriched CD CD11 Spleen DC enriched
More informationAIP1 functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis
SUPPLEMENTAL MATERIALS functions as an endogenous inhibitor of VEGFR2-mediated signaling and inflammatory angiogenesis Haifeng Zhang 1*, Yun He 1*, Shengchuan Dai 1*, Zhe Xu 2*, Yan Luo 2, Ting Wan 2,
More informationBeta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand
SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin
More informationNature Immunology: doi: /ni.3694
Supplementary Figure 1 Expression of Bhlhe41 and Bhlhe40 in B cell development and mature B cell subsets. (a) Scatter plot showing differential expression of genes between splenic B-1a cells and follicular
More informationSupplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP +
Supplementary Figure 1 Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP + haematopoietic cells in the intestine. GFP + cells from E15.5 intestines were obtained after collagenase
More informationInterferon- -producing immature myeloid cells confer protection. against severe invasive group A Streptococcus infections. Supplementary Information
Supplementary Information Interferon- -producing immature myeloid cells confer protection against severe invasive group A Streptococcus infections Takayuki Matsumura, Manabu Ato, Tadayoshi Ikebe, Makoto
More information15h. 24h. Blander & Medzhitov supplementary Figure 1. Apoptotic cells. Apoptotic LPS blasts 30% 32% 32% + Exogenous LPS 0.1% 31% 21% 20% 48% 60% 53%
a None Apoptotic cells Apoptotic LPS blasts 30% 32% 32% Apoptotic cells + Exogenous LPS 6h 0.1% 31% 21% 20% 48% 60% 53% 15h 0% 7% 5% 4% 30% 32% 32% 24h CD11c 0% 8% 2% 2% CFSE Blander & Medzhitov supplementary
More informationSupplementary Figure 1. Effect of FRC-specific ablation of Myd88 on PP and mln organization.
Supplementary Figure 1 Effect of FRC-specific ablation of Myd88 on PP and mln organization. (a) PP numbers in 8 10 week old Cre-negative littermate (Ctrl) and Myd88-cKO mice (n = 11 mice; each dot represents
More informationSupplementary Figure 1. Two activation pathways and four conformations of β 2 integrins. KIM127 (red) can specifically detect
Supplementary Figure 1 Two activation pathways and four conformations of β 2 integrins. KIM127 (red) can specifically detect integrin extension (E + ) and mab24 (green) can specifically detect headpiece-opening
More informationSupplementary Figures
Supplementary Figures Fig. S1. Specificity of perilipin antibody in SAT compared to various organs. (A) Images of SAT at E18.5 stained with perilipin and CD31 antibody. Scale bars: 100 μm. SAT stained
More informationTable S1. Nucleotide sequences of synthesized oligonucleotides for quantitative
Table S1. Nucleotide sequences of synthesized oligonucleotides for quantitative RT-PCR For CD8-1 transcript, forward primer CD8-1F 5 -TAGTAACCAGAGGCCGCAAGA-3 reverse primer CD8-1R 5 -TCTACTAAGGTGTCCCATAGCATGAT-3
More informationMayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama
Immunity, Volume 38 Supplemental Information Inflammatory Monocytes Recruited to Allergic Skin Acquire an Anti-inflammatory M2 Phenotype via Basophil-Derived Interleukin-4 Mayumi Egawa, Kaori Mukai, Soichiro
More informationProduct datasheet. ARG30119 Pro-B Cell Marker Antibody panel (CD19, CD34, CD38, CD40, CD45)(FACS)
Product datasheet info@arigobio.com Package: 1 kit ARG30119 Pro-B Cell Marker Antibody panel (CD19, CD34, CD38, CD40, CD45)(FACS) Component Cat. No. Component Name ARG62820 anti-cd34 antibody [4H11(APG)]
More informationSupplementary Methods
Supplementary Methods Antibodies Rabbit polyclonal VEGFR-1, VEGFR-2, Angiopoietin-1, Angiopoietin- 2 and GAPDH specific antibodies were from Santa Cruz Biotechnology. Rabbit polyclonal Akt1, Akt2, ps473
More informationKazuki N. Sugahara, Tambet Teesalu, Priya Prakash Karmali, Venkata Ramana Kotamraju, Lilach
Cancer Cell, Volume 16 Supplemental Data Tissue-Penetrating Delivery of Compounds and Nanoparticles into Tumors Kazuki N. Sugahara, Tambet Teesalu, Priya Prakash Karmali, Venkata Ramana Kotamraju, Lilach
More informationNature Immunology: doi: /ni Supplementary Figure 1. Time course of OT-II T reg cell development in thymic slices.
Supplementary Figure 1 Time course of OT-II T reg cell development in thymic slices. Time course of T reg cell development following addition of OT-II TCR transgenic Rag2 -/- mice (OT-II) thymocytes to
More informationSupporting Information for. Bongseo Choi, 1, Hyojin Moon, 1, Sung Joon Hong, 1 Changsik Shin, 1 Yoonkyung Do, 1 Seongho Ryu, 2,* Sebyung Kang 1,*
Supporting Information for Effective Delivery of Antigen-Encapsulin Nanoparticle Fusions to Dendritic Cells Leads to Antigen-Specific Cytotoxic T Cell Activation and Tumor Rejection Bongseo Choi, 1, Hyojin
More informationPhagocytosis Assay Kit (IgG PE)
Phagocytosis Assay Kit (IgG PE) Item No. 600540 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION
More informationBmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone
Generation and culture of bone marrow-derived dendritic cells (bmdcs) BmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone marrow cells from murine tibias and femurs
More informationSupporting Information
Supporting Information of Laser Immunotherapy in Combination with Perdurable PD-1 Blocking for Treatment of Metastatic Tumor Lihua Luo, Chunqi Zhu, Hang Yin, Mengshi Jiang, Junlei Zhang, Bing Qin, Zhenyu
More informationThe presence of T cell epitopes is important for induction of antibody
The presence of T cell epitopes is important for induction of antibody responses against antigens directed to DEC25 + dendritic cells Kelly N. S. Amorim, Eline V. Rampazo, Renan Antonialli, Marcio M. Yamamoto,
More informationSupplementary Fig. 5
Supplementary Fig. 5 Supplemental Figures legends Supplementary Figure 1 (A) Additional dot plots from CyTOF analysis from untreated group. (B) Gating strategy for assessment of CD11c + NK cells frequency
More informationSupporting Information
Supporting Information Cieslewicz et al. 10.1073/pnas.1312197110 SI Results Human and mouse lesions of atherosclerosis contain both M1 and M2 macrophage phenotypes (1, 2). Previous work has suggested the
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Validation of the monoclonal antibody to mouse ACKR1 and expression of ACKR1 by BM hematopoietic cells. (a to d) Comparison of immunostaining of BM cells by anti-mouse ACKR1 antibodies:
More informationSupplementary Figure 1. Xbp1 deficiency does not alter hematopoietic cellularity.
Supplementary Figure 1 Xbp1 deficiency does not alter hematopoietic cellularity. Absolute number of leukocytes obtained from bone marrow (BM, 2 tibias and 2 femurs per mouse) of Xbp1 f/f and Xbp1 Vav1
More informationFigure S1. Phenotypic characterization of transfected ECFC. (a) ECFC were transfected using a lentivirus with a vector encoding for either human EPO
Figure S1. Phenotypic characterization of transfected ECFC. (a) ECFC were transfected using a lentivirus with a vector encoding for either human EPO (epoecfc) or LacZ (laczecfc) under control of a cytomegalovirus
More informationAntibody used for FC Figure S1. Multimodal characterization of NIR dyes in vitro Figure S2. Ex vivo analysis of HL60 cells homing
Antibody used for FC The following antibodies were used following manufacturer s instructions: anti-human CD4 (clone HI3, IgG1, k - Becton Dickinson), anti-human CD33 (clone WM3, IgG1, k- Becton Dickinson),
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/1/494/eaak972/dc1 Supplementary Materials for Blockade of surface-bound TGF-β on regulatory T cells abrogates suppression of effector T cell function in the tumor
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune
More informationSupplemental Figure 1
Supplemental Figure 1 A IL-12p7 (pg/ml) 7 6 4 3 2 1 Medium then TLR ligands MDP then TLR ligands Medium then TLR ligands + MDP MDP then TLR ligands + MDP B IL-12p4 (ng/ml) 1.2 1..8.6.4.2. Medium MDP Medium
More informationRecruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells
SUPPLEMENTARY FIGURES Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells Niklas Engels, Lars Morten König, Christina Heemann, Johannes
More informationBcl-2 family member Bcl-G is not a pro-apoptotic BH3-only protein
Bcl-2 family member Bcl-G is not a pro-apoptotic BH3-only protein Maybelline Giam 1,2, Toru Okamoto 1,2,3, Justine D. Mintern 1,2,4, Andreas Strasser 1,2 and Philippe Bouillet 1, 2 1 The Walter and Eliza
More informationCD93 and dystroglycan cooperation in human endothelial cell adhesion and migration
/, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing
More information(B) Comparable expression of major integrin subunits and glycoproteins on the surface of resting WT and Lnk -/- platelets.
Supplemental Figure S1. Characteristics of Lnk -/- platelets. (A) Electron micrographs of resting platelets showing the normal intracellular structure of Lnk -/ platelets. Samples were fixed with 4% PFA
More informationFigure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.
LEGENDS TO SUPPLEMENTARY FIGURES Figure S1. Phenotypic characterization of AND-1_WASKO cell lines. AND- 1_WASKO_C1.1 (WASKO_C1.1) and AND-1_WASKO_C1.2 (WASKO_C1.2) were stained with the antibodies oct3/4
More informationSupplemental Figures Figure S1: Lymphatic vessel growth into the intestine is normal in Clec2 -/- embryos
Supplemental Figures Figure S1: Lymphatic vessel growth into the intestine is normal in Clec2 -/- embryos Staining of lymphatic vessels in E18.5 embryonic gut. Sections stained for lymphatic EC markers
More informationFemale 6-7-week-old BALB/c mice were purchased from Japan SLC (Hamamatsu, Japan).
Supplementary materials Materials and Methods Mice Female 6-7-week-old BALB/c mice were purchased from Japan SLC (Hamamatsu, Japan). All mice were maintained under specific pathogen free conditions, and
More informationSupplementary Figure 1. Botrocetin induces binding of human VWF to human
Supplementary Figure 1: Supplementary Figure 1. Botrocetin induces binding of human VWF to human platelets in the absence of elevated shear and induces platelet agglutination as detected by flow cytometry.
More informationFlowcytometry-based purity analysis of peritoneal macrophage culture.
Liao et al., KLF4 regulates macrophage polarization Revision of Manuscript 45444-RG- Supplementary Figure Legends Figure S Flowcytometry-based purity analysis of peritoneal macrophage culture. Thioglycollate
More informationSupplementary Figure 1 Pfn1, but not other Pfn isoforms are expressed in
Supplementary Figure 1 Pfn1, but not other Pfn isoforms are expressed in platelets. (a) RT-PCR of Pfn isoforms in control mouse platelets, Pfn1 -/- platelets and control heart. Expected band size for Pfn1
More informationsupplementary information
DOI: 10.1038/ncb1977 Figure S1 a. Immunofluorescence analysis of IFT20 localization in PBL costained with anti-β-tubulin antibodies. b. Immunofluorescence analysis of IFT20 localization in Jurkat cells,
More informationSupplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides
Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides targeting RCP (SMARTPool (RCP) or two individual oligos (RCP#1
More informationTitle. CitationThe Journal of clinical investigation, 124(5): Issue Date Doc URL. Type. Additional There Information
Title Laminins affect T cell trafficking and allograft fat Author(s)Warren, Kristi J.; Iwami, Daiki; Harris, Donald G.; CitationThe Journal of clinical investigation, 124(): 224- Issue Date 214--1 Doc
More informationFigure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse
Figure S1. Specificity of polyclonal anti stabilin-1 and anti stabilin-2 antibodies Lysates of 293T cells transfected with empty vector, mouse stabilin-1, or mouse stabilin-2 were immunoblotted using anti
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11809 Supplementary Figure 1. Antibiotic treatment reduces intestinal bacterial load and allows access of non-pathogenic bacteria to the MLN, inducing intestinal
More informationSupplementary Data Supplementary Figure 1. Knockdown of VentX with a different sirna sequence reduces terminal monocyte to macrophage
Supplementary Data Supplementary Figure 1. Knockdown of VentX with a different sirna sequence reduces terminal monocyte to macrophage differentiation. Monocytes were transfected with either a scrambled
More informationSUPPLEMENTARY INFORMATION FIGURE LEGENDS
SUPPLEMENTARY INFORMATION FIGURE LEGENDS Fig. S1. Radiation-induced phosphorylation of Rad50 at a specific site. A. Rad50 is an in vitro substrate for ATM. A series of Rad50-GSTs covering the entire molecule
More informationSupplemental Information. Inflammatory Ly6C high Monocytes Protect. against Candidiasis through IL-15-Driven. NK Cell/Neutrophil Activation
Immunity, Volume 46 Supplemental Information Inflammatory Ly6C high Monocytes Protect against Candidiasis through IL-15-Driven NK Cell/Neutrophil Activation Jorge Domínguez-Andrés, Lidia Feo-Lucas, María
More informationTable S1. Antibodies and recombinant proteins used in this study
Table S1. Antibodies and recombinant proteins used in this study Labeled Antibody Clone Cat. no. Streptavidin-PerCP BD Biosciences 554064 Biotin anti-mouse CD25 7D4 BD Biosciences 553070 PE anti-mouse
More informationSupplementary Figure 1
DOI: 1.138/ncb273 Supplementary Figure 1 a 1x DAPI field images 4x contoured cells 2µm 5µm b Tissue map Dot plot Histogram Y X antigen X DAPI antigen X Figure S1 Laser Scanning Cytometry of bone marrow
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2386 Figure 1 Src-containing puncta are not focal adhesions, podosomes or endosomes. (a) FAK-/- were stained with anti-py416 Src (green) and either (in red) the focal adhesion protein paxillin,
More informationSupplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence
1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for
More information7-amino actinomycin D (7ADD) was added to all samples 10 minutes prior to analysis on the flow cytometer in order to gate 7AAD viable cells.
Antibody staining for Ho uptake analyses For HSC staining, 10 7 BM cells from Ho perfused mice were stained with biotinylated lineage antibodies (CD3, CD5, B220, CD11b, Gr-1, CD41, Ter119), anti Sca-1-PECY7,
More informationCycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney
1 Supplementary text and data for: 2 3 4 5 Cycles of vascular plexus formation within the nephrogenic zone of the developing mouse kidney Authors: David A. D. Munro 1*, Peter Hohenstein 2, and Jamie A.
More informationSupplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin
Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin locus. The EcoRI restriction site between exons M1 and M2
More informationMultivalent bi-specific nanobioconjugate engager for targeted cancer immunotherapy
In the format provided by the authors and unedited. DOI: 10.1038/NNANO.2017.69 Multivalent bi-specific nanobioconjugate engager for targeted cancer immunotherapy Hengfeng Yuan, Wen Jiang,* Christina A.
More informationNature Medicine: doi: /nm.4464
Supplementary Fig. 1. Amino acid transporters and substrates used for selectivity screening. (A) Common transporters and amino acid substrates shown. Amino acids designated by one-letter codes. Transporters
More informationSupplemental material and methods
Supplemental material and methods Antibodies: Primary antibodies used for these stainings were 174/2 1 (migg1 against PV-1), PAL-E 2 (migg2a; Abcam, Cambridge, UK), anti-nrp-1 (monoclonal migg2a or polyclonal
More informationTHE BASICS OF IMMUNOHISTOCHEMISTRY
THE BASICS OF IMMUNOHISTOCHEMISTRY Introduction Immunohistochemistry (IHC) identifies specific tissue components by means of a specific antigen/antibody reaction tagged with a visible label. IHC makes
More informationSupporting Information
Supporting Information Song et al. 10.1073/pnas.1218131110 SI Materials and Methods In Vivo Dislodgment Assays. In vivo dislodgement experiments were performed as previously described (1) using function
More informationA collection of 31 splenic specimens from patients (42.4±17.7 years old) with ITP
Supplemental Materials & Methods Patients and patient samples. A collection of 31 splenic specimens from patients (42.4±17.7 years old) with ITP requiring splenectomy and 36 splenic specimens obtained
More informationSupplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface.
Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface. (a) Human PDAC cell lines were treated as indicated in Figure 1 panel F. Cells were analyzed for FITC-rBAG3 binding
More informationSupplementary Figure 1.
9 8 5 6F12 IgG2a Isotype Control 5 1 15 Supplementary Figure 1. Passive treatment with isotype control mab does not affect viral challenge. Wild type mice were treated with 4 mg/kg of mouse IgG2a 6F12
More informationSupplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various
Supplementary Figure 1. APP cleavage assay. HEK293 cells were transfected with various GST-tagged N-terminal truncated APP fragments including GST-APP full-length (FL), APP (123-695), APP (189-695), or
More informationSupplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR
Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC
More informationSOM 1 *** *** *** * * n.s GFP + (NK 10 4 ) Naive DNFB OXA. Donor sensitization: Naive OXA DNFB 1,200 6,000 4,000
SOM 1 a n.s. 4. 3. GFP + (NK 1 4 ) 2. 1.. Naive DNFB OXA splenic NK hepatic NK b Donor sensitization: Naive OXA DNFB NK cells (% of CD45 + 1 5 ) 1,2 9 6 3 NK cells (% of CD45 + 1 5 ) 6, 4, 2, 24 48 72
More informationStargazin regulates AMPA receptor trafficking through adaptor protein. complexes during long term depression
Supplementary Information Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long term depression Shinji Matsuda, Wataru Kakegawa, Timotheus Budisantoso, Toshihiro Nomura,
More informationSupplemental Information. A Versatile Tool for Live-Cell Imaging. and Super-Resolution Nanoscopy Studies. of HIV-1 Env Distribution and Mobility
Cell Chemical Biology, Volume 24 Supplemental Information A Versatile Tool for Live-Cell Imaging and Super-Resolution Nanoscopy Studies of HIV-1 Env Distribution and Mobility Volkan Sakin, Janina Hanne,
More informationQuantitative Imaging of Tumor Associated Macrophages and Their Response to Therapy Using 64Cu-Labeled Macrin
Supporting Information for Quantitative Imaging of Tumor Associated Macrophages and Their Response to Therapy Using 64Cu-Labeled Macrin Hye-Yeong Kim 1,2+, Ran Li 1+, Thomas S.C. Ng 1, Gabriel Courties
More informationSUPPLEMENTAL MATERIAL. Supplemental Methods:
SUPPLEMENTAL MATERIAL Supplemental Methods: Immunoprecipitation- As we described but with some modifications [22]. As part of another ongoing project, lysate from human umbilical vein endothelial cells
More information(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower
Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that
More informationSupplementary Table-1: List of genes that were identically matched between the ST2 and
Supplementary data Supplementary Table-1: List of genes that were identically matched between the ST2 and ST3. Supplementary Table-2: List of genes that were differentially expressed in GD2 + cells compared
More informationSupplementary Information
1 2 Supplementary Information 3 4 5 6 7 8 Supplementary Figure 1. Loading of R837 into PLGA nanoparticles. The loading efficiency (a) and loading capacity (b) of R837 by PLGA nanoparticles obtained at
More informationImaging the immune system with a Two photon (2P) microscope
Imaging the immune system with a Two photon (2P) microscope QuickTime et un décompresseur Cinepak sont requis pour visionner cette image. Main advantages of 2P microscopy : 1/ Deep penetration into tissue
More informationDynamic NETosis is Carried Out by Live Neutrophils in Human and Mouse Bacterial Abscesses
Dynamic NETosis is Carried Out by Live Neutrophils in Human and Mouse Bacterial Abscesses and During Severe Gram-Positive Infection Bryan G. Yipp 1,2,9, Björn Petri 2,3,9, Davide Salina 4, Craig N. Jenne
More informationClustalW algorithm. The alignment statistics are 96.9% for both pairwise identity and percent identical sites.
Identity Human Mouse Supplemental Figure 1. Amino acid sequence alignment of -MyHC. The alignment was created using the ClustalW algorithm. The alignment statistics are 96.9% for both pairwise identity
More informationinitial single-cell analysis, with a pragmatic focus on surface markers with the highest potential for
Supplementary Figure 1: Summary of the exclusionary approach to surface marker selection for initial single-cell analysis, with a pragmatic focus on surface markers with the highest potential for protein
More informationDistribution of human ILCs during chronic lung disease.
Supplementary Figure 1 Distribution of human ILCs during chronic lung disease. Quantification of flow cytometric analysis of lung tissue from patients with COPD or IPF identifying (a) frequencies of total
More informationSupplemental Information The Sensing of Environmental Stimuli by Follicular Dendritic Cells Promotes Immunoglobulin A Generation in the Gut
Immunity, Volume 33 Supplemental Information The Sensing of Environmental Stimuli by Follicular Dendritic Cells Promotes Immunoglobulin A Generation in the Gut Keiichiro Suzuki, Mikako Maruya, Shimpei
More informationSupplementary Information
Supplementary Information Figure S1. Transiently overexpressed ECFP-TIAF1/EYFP-TIAF1 causes apoptosis of Mv1Lu cells. Mv1Lu cells were transfected by electroporation with ECFP, EYFP, ECFP-TIAF1, EYFP-
More informationTF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting
Supplemental Material Supplemental Methods TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting In order to determine if the multi-parameter FACS approach would be successful
More informationSupplementary Figure 1 a
3 min PMA 45 min PMA AnnexinV-FITC Supplementary Figure 1 5 min PMA 15 min PMA a 9 min PMA 12 min PMA 5 min FGF7 15 min FGF7 3 min FGF7 6 min FGF7 9 min FGF7 12 min FGF7 5 min control 3 min control 6 min
More informationNature Medicine doi: /nm.2548
Supplementary Table 1: Genotypes of offspring and embryos from matings of Pmm2 WT/F118L mice with Pmm2 WT/R137H mice total events Pmm2 WT/WT Pmm2 WT/R137H Pmm2 WT/F118L Pmm2 R137H/F118L offspring 117 (100%)
More informationApplications of HTRF and Tag-lite Assays for HTP Antibody Screening
Applications of HTRF and Tag-lite Assays for HTP Antibody Screening Brigitte Devaux, PhD Bristol Myers Squibb, Redwood City CA HTRF Symposium April 25, 2013 1 Introduction Generate human therapeutic antibodies
More informationNanogel-Based Immunologically Stealth Vaccine Targets Macrophages in the Medulla of Lymph Node and Induces Potent Antitumor Immunity
Nanogel-Based Immunologically Stealth Vaccine Targets Macrophages in the Medulla of Lymph Node and Induces Potent Antitumor Immunity Daisuke Muraoka, Naozumi Harada,, Tae Hayashi, Yoshiro Tahara,, Fumiyasu
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Kanaani et al., http://www.jcb.org/cgi/content/full/jcb.200912101/dc1 Figure S1. The K2 rabbit polyclonal antibody is specific for GAD67,
More informationF4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated
SDC MATERIALS AND METHODS Flow Cytometric Detection of A-Antigen Expression Single cell suspensions were prepared from bone marrow, lymph node and spleen. Peripheral blood was obtained and erythrocytes
More informationSupplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy
Supplementary Figure 1. IFN-γ induces TRC dormancy. a, IFN-γ induced dormancy of various tumor type TRCs, including H22 (murine hepatocarcinoma) and CT26 (murine colon cancer). Bar, 50 µm. b, B16 cells
More informationReceptor Revision Diminishes the Autoreactive B Cell Response after Antigen. PNA Tet. Day 8. Day 16
Receptor Revision Diminishes the Autoreactive Cell Response after Antigen Activation Ying-Hua Wang and etty Diamond Supplemental data: PNA Tet 5 8 11 16 Supplemental Figure 1: Kinetic analysis of tetramer-binding
More informationFigure legend. The expression of BAFF and its receptors in macrophages was detected at lesion areas of atherosclerosis and arthritis.
Data supplement #1 Figure legend. The expression of BAFF and its receptors in macrophages was detected at lesion areas of atherosclerosis and arthritis. A. Consecutive sections of an atherosclerotic plaque
More information