Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice
|
|
- Chloe Cooper
- 6 years ago
- Views:
Transcription
1 Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice Belal A. Mohamed, Amal Z. Barakat, Torsten Held, Manar Elkenani, Christian Mühlfeld, Jörg Männer, and Ibrahim M. Adham ONLINE DATA SUPPLEMENT E1
2 Supplemental Materials and Methods Histology Lung sections at indicated developmental stage were isolated from wild-type, Hspa4l -/-, Hspa4 -/-, and Hspa4l -/- Hspa4 -/- embryos and stained with hematoxylin and eosin (H&E). Average saccular size (µm 2 ) and mesenchymal septal thickness (µm) were measured using NIH Image J software (National Institutes of Health, Bethesda, MD). These measurements were performed on 6 sections from each of 4 different lung samples/embryonic stage/genotype. Sections were also stained with periodic acid-schiff (PAS) (Sigma- Aldrich, Munich, Germany) according to the manufacturer s instructions. PAS-positive cells were counted in 3 sections of each lung from 4 different pups at E18.5 of each genotype. Immunofluorescence Embryonic lung sections from different genotypes were incubated with the following primary rabbit antibodies: prosp-c (1:1000; Chemicon, Hofheim, Germany), SP-B (1:300; Santa Cruz Biotechnology, Santa Cruz, CA), Aquaporin 5 (AQP5) (1:200; Alomone Labs, Israel), cleaved caspase-3 (1:200; Cell Signaling Technology, Danvers, MA), HSPA4L (1:200; Santa Cruz) and HSPA4 (1:100; Santa Cruz) followed by secondary Alexa Fluor 488 conjugated IgG antibody (1:500; Invitrogen, Karlsruhe, Germany). Caspase-3-positive cells were counted at 20X magnification from 5-8 fields per each lung from 4 different embryos at E18.5 of each genotype. Terminal deoxynucleotidyl transferase dutp nick end labeling (TUNEL) assay Lungs from E18.5 of different genotypes were subjected to TUNEL assay using an ApopTag peroxidase in situ apoptosis detection kit (Qbiogene, Heidelberg, Germany) according to manufacturer's instructions. TUNEL-positive cells were counted in 20x images from 5-8 fields per each lung from 4 different pups of each genotype. Proliferation assay Pregnant females were injected i.p. with 5-bromo-2 -deoxyuridine (BrdU) (50 µg/g body weight; Sigma- Aldrich) and killed 2 h later. Sections of E18.5 lungs from different genotypes were incubated with rat anti- E2
3 BrdU antibody (1:500; Abcam, Cambridge, MA, USA). BrdU-positive cells were counted in 5 fields per each lung from 4 different pups of each genotype. Immunoblotting For proteins extraction, the lungs and hearts of E18.5 pups were homogenized in cold RIPA lysis buffer, 10X (0.5M Tris-HCl, ph 7.4, 1.5M NaCl, 2.5% deoxycholic acid, 10% NP-40, 10mM EDTA) supplemented just before running the assay with protease inhibitor cocktail (Roche Diagnostics Corp., Mannheim, Germany) and PMSF (1mM; Sigma-Aldrich). The homogenates were sonicated and then centrifuged at 12,000 g at 4 C for 20 min. Supernatants (20 µg of protein concentration) were combined at least 1:1 with sample buffer (62.5 mm Tris, ph 6.8, 2% SDS, 25% glycerol, 0.01% bromophenol blue, 200 mm β-mercaptoethanol), heated at 95 C for 5 minutes, resolved on 4 12% SDS-PAGE (Invitrogen), and transferred onto nitrocellulose membrane (Amersham Pharmacia, Freiburg, Germany). Membranes were then blocked for 1 h with 5% non-fat milk in 0.1% Tween 20 in Tris-buffered saline. Blots were probed at 4 o C overnight with antibodies against HSPA4L (1:2000), HSPA4 (1:2000), Ubiquitin (1:4000; DakoCytomation, CA, USA), ProSP-C (1:4000), SP-B (1:1000), AQP5 (1:1000), rabbit anti HSPH1 (1:5000; Sigma-Aldrich), goat anti HSP90α (1:1000; Santa Cruz), mouse anti HSP70 (1:2000; Sigma- Aldrich), rabbit anti BCL-2 (1:1000; Cell Signaling Technology) mouse anti α-tubulin (1:5000; Sigma- Aldrich) and followed by incubation with a secondary peroxidase-conjugated antibody (1:5000; Sigma- Aldrich). Signals were detected using a chemiluminescent kit (Santa Cruz). Signals were quantified by AlphaView software; Version: (Cell Bioeciences. Inc, Santa. Clara, USA). 20S Proteasome activity Lung protein lysates from E18.5 wild-type and Hspa4l -/- Hspa4 -/- pups were isolated, and 20S Proteasome activity was measured using 20S Proteasome Assay Kit ( ; Biomol, Hamburg, Germany) according to the manufacturer s instructions. In short, a synthetic 20S substrate, SUC-LLVY-AMC was used which, upon cleavage by the active enzyme, generates a highly fluorescent product that can be measured using excitation and emission wavelengths of 360 nm and 480 nm, respectively. Assay was E3
4 carried out with and without a specific 20S inhibitor, epigallocatechin gallate (EGCG). The difference between the two fluorescence readings was attributed to proteasomal activity. Transmission electron microscopy (TEM) TEM analysis was performed as described previously (1) using a TEM (EM 902, Zeiss, Oberkochen, Germany). Statistical analysis Data were expressed as mean ± S.D. Differences among groups were tested by Student s t test. A P value < 0.05 was considered to be significantly different. E4
5 Reference E1. Peng X, Kraus MS, Wei H, Shen TL, Pariaut R, Alcaraz A, Ji G, Cheng L, Yang Q, Kotlikoff MI, Chen J, Chien K, Gu H, Guan JL. Inactivation of focal adhesion kinase in cardiomyocytes promotes eccentric cardiac hypertrophy and fibrosis in mice. J Clin Invest 2006;116: E5
6 Supplemental figure legends Supplemental figure E1. Expression of HSPA4L and HSPA4 in embryonic and adult murine lungs. Total protein lysates were isolated from wild-type lungs at different developmental stages. Immunoblotting was performed with the indicated antibodies. α-tubulin (TUB) was used as a loading control, n = 3 per developmental stage. Supplemental figure E2. Cellular distribution of HSPA4L and HSPA4 in the lung. Paraffin sections of lungs from wild-type (E16.5, E18.5 and adult) and E18.5 Hspa4l -/- Hspa4 -/- pups were immunostained with antibodies against HSPA4L or HSPA4. Nuclei were stained blue with 4,6-diamidino-2-phenylindole (DAPI). Scale bar: 30 µm. DKO, double knockout. E6
7 Figure E1 80x42mm (300 x 300 DPI)
8 Figure E2 122x63mm (300 x 300 DPI)
Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationIgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only
IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective
More informationMethods Western blot analysis of plg Quantification of plasminogen accumulation by ELISA Immunohistochemical analysis
Methods Western blot analysis of plg Wild-type mice first received a standardized burn wound and then were intravenously administered 2 mg of human plg (Omnio AB, Umeå, Sweden). 24 hours after wounding
More informationLung Cell Apoptosis. Man Yi, Rosetta Belcastro, Samuel Shek, Daochun Luo, Martin Post, A Keith Tanswell ON-LINE DATA SUPPLEMENT
Fibroblast Growth Factor-2 and Receptor-1α(ΙΙΙc) Regulate Postnatal Rat Lung Cell Apoptosis Man Yi, Rosetta Belcastro, Samuel Shek, Daochun Luo, Martin Post, A Keith Tanswell ON-LINE DATA SUPPLEMENT SUPPLEMENT
More informationSupplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
More informationSUPPLEMENTAL INFROMATION
SUPPLEMENTAL INFROMATION SUPPLEMENTAL EXPERIMENTAL PROCEDURES IP 1 accumulation - IP 1 accumulation was quantified using the HTRF IP-One kit (Cisbio Bioassys, Bedford, MA, USA) according to the manufacturer
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More informationB. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.
A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200
More informationSupplementary Material - Methods
Novel Protein-Protein Interactions in the Schizophrenia interactome Supplementary Material - Methods Experimental validations of predicted interactions Table S1-1: Protein pairs that were validated by
More information1. Goat Anti-Caspase-3 (CPP32) Antibody, R&D systems (cat #AF-605-NA), 0.5ug/ml
Western Blot Antibodies: 1. Goat Anti-Caspase-3 (CPP32) Antibody, R&D systems (cat #AF-605-NA), 0.5ug/ml 2. Goat Anti-human LAP (TGF-b1) Antibody, R&D Systems (cat #AF-246-NA), 0.1-0.2 ug/ml 3. Rabbit
More informationStefanie C Hummler, Min Rong, Shaoyi Chen, Dorothy Hehre, Deepthi Alapati, Shu Wu. Online Data Supplement
Targeting GSK-3 to Prevent Hyperoxia-induced Lung Injury in Neonatal Rats Stefanie C Hummler, Min Rong, Shaoyi Chen, Dorothy Hehre, Deepthi Alapati, Shu Wu Online Data Supplement Human Lung Specimens Paraffin
More informationGα 13 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα 13 Activation Assay Kit Catalog Number: 80401 20 assays NewEast Biosciences 1 Table of Content Product
More informationElectrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were. oligonucleotide spanning the NF-kB site (5 -GATCC-
SUPPLEMENTARY MATERIALS AND METHODS Electrophoretic Mobility Shift Assay (EMSA). Nuclear extracts were prepared as previously described. (1) A [ 32 P] datp-labeled doublestranded oligonucleotide spanning
More informationSupplementary Figure 1. CHOP-HA is broadly expressed on the vertical and horizontal axis of the intestine. (A) Ki-67 and E-Cadherin protein
Supplementary Figure 1. CHOP-HA is broadly expressed on the vertical and horizontal axis of the intestine. (A) Ki-67 and E-Cadherin protein expression was analyzed by performing immunofluorescence staining
More informationSpironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were
More informationFor Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab
Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab CODE No. M200-3 CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 1F2 Mouse IgG1 100 L,
More informationSupplemental Information
Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai
More informationAt E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
More informationAnti-HB-EGF (Human) mab
Page 1 For Research Use Only. Not for use in diagnostic procedures. CODE No. D308-3 Anti-HB-EGF (Human) mab CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 3H4 Mouse IgG1
More informationCdc42 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay
More informationSupplemental Information. Materials and methods.
Supplemental Information Materials and methods. Cell culture. hmscs were isolated from bone marrow of 3 male donors, undergoing orthopedic surgery (mean age 69.7). Cells were cultured in high glucose DMEM
More informationRab5 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Rab5 Activation Assay Kit Catalog Number: 83701 20 assays 24 Whitewoods Lane 1 Table of Content Product
More informationSupplemental Figure 1 (Figure S1), related to Figure 1 Figure S1 provides evidence to demonstrate Nfatc1Cre is a mouse line that directed gene
Developmental Cell, Volume 25 Supplemental Information Brg1 Governs a Positive Feedback Circuit in the Hair Follicle for Tissue Regeneration and Repair Yiqin Xiong, Wei Li, Ching Shang, Richard M. Chen,
More informationFor Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab
Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab CODE No. M200-3 CLONALITY CLONE ISOTYPE QUANTITY SOURCE IMMUNOGEN FORMURATION STORAGE Monoclonal 1F2 Mouse IgG1 κ 100 µl,
More informationDivision of Molecular Cardiology, Department of Medicine, College of Medicine,
ONLINE SUPPLEMENT Inhibition of NF-κB in the lungs prevents monocrotaline-induced pulmonary hypertension in mice Li Li 1, Chuanyu Wei 1, Il-Kwon Kim 3, Yvonne Janssen-Heininger 2 and Sudhiranjan Gupta
More informationSUPPLEMENTARY INFORMATION
The Supplementary Information (SI) Methods Cell culture and transfections H1299, U2OS, 293, HeLa cells were maintained in DMEM medium supplemented with 10% fetal bovine serum. H1299 and 293 cells were
More informationSupplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered
Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl
More informationRheB Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based RheB Activation Assay Kit Catalog Number: 81201 20 assays NewEast Biosciences 1 FAX: 610-945-2008 Table
More informationFig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of
Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and
More informationSupplemental material
Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.
More informationArf6 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Arf6 Activation Assay Kit Catalog Number: 82401 20 assays NewEast Biosciences 1 Table of Content Product
More informationSUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION
SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,
More informationImmunoprecipitation Protocol
Immunoprecipitation Protocol Immunoprecipitation is a general method to obtain the enrichment of a specific protein from tissue lysate and cell lysate. It can be used to purify a specific protein, to identify
More informationSupplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP)
Supplementary Figure S1. Alterations in Fzr1( / );Nestin-Cre brains. (a) P10 Cdh1-deficient brains display low levels of Myelin basic protein (MBP) in the cortex (area 1 as defined in Fig. 2a), and corpus
More informationFour different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and
SUPPLEMENTARY MATERIALS AND METHODS Chromatin Immunoprecipitation for qpcr analysis Four different active promoter genes were chosen, ATXN7L2, PSRC1, CELSR2 and IL24, all located on chromosome 1. Primer
More informationDescription of supplementary material file
Description of supplementary material file In the supplementary results we show that the VHL-fibronectin interaction is indirect, mediated by fibronectin binding to COL4A2. This provides additional information
More informationFirefly luciferase mutants as sensors of proteome stress
Nature Methods Firefly luciferase mutants as sensors of proteome stress Rajat Gupta, Prasad Kasturi, Andreas Bracher, Christian Loew, Min Zheng, Adriana Villella, Dan Garza, F Ulrich Hartl & Swasti Raychaudhuri
More informationApoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium
Apoptosis assay: Apoptotic cells were identified by Annexin V-Alexa Fluor 488 and Propidium Iodide (Invitrogen, Carlsbad, CA) staining. Briefly, 2x10 5 cells were washed once in cold PBS and resuspended
More informationFlow cytometric determination of apoptosis by annexin V/propidium iodide double staining.
Supplementary materials and methods Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining. Cells were analyzed for phosphatidylserine exposure by an annexin-v FITC/propidium
More informationDCLK-immunopositive. Bars, 100 µm for B, 50 µm for C.
Supplementary Figure S1. Characterization of rabbit polyclonal anti-dclk antibody. (A) Immunoblotting of COS7 cells transfected with DCLK1-GFP and DCLK2-GFP expression plasmids probed with anti-dclk antibody
More informationSupplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.
Supplementary Figure 1 α-synuclein is truncated in PD and LBD brains. (a) Specificity of anti-n103 antibody. Anti-N103 antibody was coated on an ELISA plate and different concentrations of full-length
More informationSupporting Information
Supporting Information Groschwitz et al. 10.1073/pnas.0906372106 SI Methods In vitro permeability. Caco2-bbe human intestinal adenocarcinoma cells (ATCC) were maintained in DMEM supplemented with 10% FCS,
More informationSupplemental Material
Supplemental Material Supplemental Methods Hepatocyte ploidy analysis Kidney immunostaining Plasma and urine chemistry analysis Plasma and urine amino acid analysis Supplemental Figures Supplemental Figure
More informationGα i Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα i Activation Assay Kit Catalog Number 80301 20 assays NewEast Biosciences, Inc 1 Table of Content Product
More informationab Ran Activation Assay Kit
ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last
More informationThe following antibodies were used in this study: NuMA - rabbit-anti NuMA (gift from
Materials and Methods Antibodies: The following antibodies were used in this study: NuMA - rabbit-anti NuMA (gift from D. A. Compton); Dynein Intermediate Chain - 74.1 (Chemicon, Temecula, CA); Dynein
More informationSUPPLEMENTAL MATERIAL. Supplemental Methods:
SUPPLEMENTAL MATERIAL Supplemental Methods: Immunoprecipitation- As we described but with some modifications [22]. As part of another ongoing project, lysate from human umbilical vein endothelial cells
More informationSupplemental methods:
Supplemental methods: ASC-J9 treatment ASC-J9 was patented by the University of Rochester, the University of North Carolina, and AndroScience Corp., and then licensed to AndroScience Corp. Both the University
More informationMarilyn G. Rimando, Hao-Hsiang Wu, Yu-An Liu, Chien-Wei Lee, Shu-Wen Kuo, Yin-
Supplementary Information Glucocorticoid receptor and Histone Deacetylase 6 mediate the differential effect of dexamethasone during osteogenesis of Mesenchymal stromal cells (MSCs) Marilyn G. Rimando,
More informationSUPPLEMENTARY INFORMATION FIGURE 1 - 1
SUPPLEMENTARY INFORMATION FIGURE 1-1 SUPPLEMENTARY INFORMATION FIGURE 2-2 SUPPLEMENTARY INFORMATION METHODS GST-Pull-Down. Cultures of E. Coli (BL21) were transformed with pgex (Clontech) and pgex recombinant
More informationProteasome Activity Fluorometric Assay Kit II (Cat. # J4120)
Proteasome Activity Fluorometric Assay Kit II (Cat. # J4120) Each supplied substrate is sufficient for use in 250 X 100 µl reactions to monitor the chymotrypsin-like (Suc-LLVY- AMC), trypsin-like (Boc-LRR-AMC)
More informationRabbit (monoclonal) Anti-FAK [py 397 ] Phosphospecific Antibody, Unconjugated
Rabbit (monoclonal) Anti-FAK [py 397 ] Phosphospecific Antibody, Unconjugated PRODUCT ANALYSIS SHEET Catalog Number: Lot Number: Volume: 44-625G (10 mini-blot size) See product label 100 μl Clone Number:
More informationSupplementary Materials and Methods
Supplementary Materials and Methods sirna sequences used in this study The sequences of Stealth Select RNAi for ALK and FLOT-1 were as follows: ALK sense no.1 (ALK): 5 -AAUACUGACAGCCACAGGCAAUGUC-3 ; ALK
More informationSupplemental Table 1: Sequences of real time PCR primers. Primers were intronspanning
Symbol Accession Number Sense-primer (5-3 ) Antisense-primer (5-3 ) T a C ACTB NM_001101.3 CCAGAGGCGTACAGGGATAG CCAACCGCGAGAAGATGA 57 HSD3B2 NM_000198.3 CTTGGACAAGGCCTTCAGAC TCAAGTACAGTCAGCTTGGTCCT 60
More informationWestern Blot Tool Box
Western Blot Tool Box BOX12/BOX12-03 V1.1 Store at 2-8 C For research use only Introduction The Western Blot Tool Box is designed to conveniently provide reagents/buffers needed for Western blotting, from
More informationCD93 and dystroglycan cooperation in human endothelial cell adhesion and migration
/, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing
More informationHEK293A cells were cultured in high glucose (4.500 mg/l) Dulbecco s modified
Additional methods: HEK293A and C7 cell cultures HEK293A cells were cultured in high glucose (4.500 mg/l) Dulbecco s modified Eagle s medium (DMEM) with GlutaMAX I (Invitrogen, Cergy Pontoise, France),
More informationSupplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface.
Supplementary Figure 1 - Characterization of rbag3 binding on macrophages cell surface. (a) Human PDAC cell lines were treated as indicated in Figure 1 panel F. Cells were analyzed for FITC-rBAG3 binding
More informationSUPPLEMENTARY INFORMATION
VOLUME: 1 ARTICLE NUMBER: 0011 In the format provided by the authors and unedited. In situ Activation of Platelets with Checkpoint Inhibitors for Post-Surgical Cancer Immunotherapy Chao Wang 1, 2, Wujin
More informationPE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence
PE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence Parul Singh 1,2, Rameshwaram Nagender Rao 1, Jala Ram Chandra Reddy 3, R.B.N. Prasad 3, Sandeep
More informationbronchial epithelial cells (I). Bronchi are outlined with dashed line. Scale bars = 25 µm, if not
Supplemental Figure S1: ronchial epithelial cell polarity and integrity is maintained in bronchi. (A-E) Staining for selected markers of bronchial cell differentiation and intracellular compartments is
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationSupporting Information
Supporting Information Tal et al. 10.1073/pnas.0807694106 SI Materials and Methods VSV Infection and Quantification. Infection was carried out by seeding 5 10 5 MEF cells per well in a 6-well plate and
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Nakajima and Tanoue, http://www.jcb.org/cgi/content/full/jcb.201104118/dc1 Figure S1. DLD-1 cells exhibit the characteristic morphology
More informationSupporting Information
Supporting Information Gemcitabine and Antisense-microRNA Co-encapsulated PLGA-PEG Polymer Nanoparticles for Hepatocellular Carcinoma Therapy Rammohan Devulapally, Kira Foygel, Thillai V Sekar, Juergen
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Thompson et al., http://www.jcb.org/cgi/content/full/jcb.200909067/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Modification-specific antibodies do not detect unmodified
More informationAPO-BrdU TUNEL Assay Kit
USER GUIDE APO-BrdU TUNEL Assay Kit Catalog No. A23210 Pub. No. MAN0002269 Rev. A.0 Table 1. Contents and storage Material Amount Storage* Stability A35125 APO-BrdU TUNEL Assay Kit 20 C Components Positive
More informationElectronic Supplementary Information. and purified according to previously published procedures(1). GlcNAc and Phos-FLAG were
Electronic Supplementary Information Experimental details: Synthesis and purification of sugars. GlcN, 4 GlcN, and 4 GlcN were synthesized and purified according to previously published procedures(1).
More informationGel filtration PTP1B (5 μm) was incubated with 10 μm MSI-1436 in a final volume of 200 μl buffer (50
SUPPLEMENTARY INFORMATION METHODS Reagents All common reagents were obtained from Thermo Fisher Scientific (Waltham, MA) or Sigma-Aldrich (St. Louis, MO). Difluoro-4-methylumbelliferyl phosphate (DiFMUP)
More informationab Ubiquitylation Assay Kit (HeLa lysate-based)
ab139471 Ubiquitylation Assay Kit (HeLa lysate-based) Instructions for Use For the generation of ubiquitin-conjugated lysate proteins This product is for research use only and is not intended for diagnostic
More informationCell viability. Cell viability was examined by MTT assay (Sigma-Aldrich).
Supplementary Materials Supplementary materials and methods Cell culture. Primary human dermal fibroblasts (DFs) were isolated from full-thickness skin samples. Tissue samples were dissected into small
More informationGene Forward (5 to 3 ) Reverse (5 to 3 ) Accession # PKA C- TCTGAGGAAATGGGAGAACC CGAGGGTTTTCTTCCTCTCAA NM_011100
Supplementary Methods: Materials. BRL37344, insulin, 3-isobutyl-1-methylxanthine, dibutyryl camp (Bt2-cAMP) and 8-Bromoadenosine 3,5 -cyclic monophosphate sodium (8-br-cAMP), cilostamide, adenosine deaminase,
More informationSupplementary methods
Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into
More informationSupporting Information
Supporting Information Cheng et al. 10.1073/pnas.1207354109 SI Materials and Methods Generation of Stim1 Stim2 Double-KO Mice and Assessment of Saliva Secretion. T-cell specific deletion of Stim1 and Stim2
More informationSupplementary material and methods
Inhibitory effect of caffeic acid on ADP-induced thrombus formation and platelet activation involves mitogen-activated protein kinases Yu Lu 1,2,3,#, Quan Li 3,4,#, Yu-Ying Liu 3,4, Kai Sun 3,4, Jing-Yu
More informationReliaBLOT TM. IP/Western Blot Reagents Cat. No. WB120, rabbit
ReliaBLOT TM Introduction: IP/Western Blot Reagents Cat. No. WB120, rabbit ReliaBLOT TM IP/Western Blot Reagents and Procedures (patent pending) provide an improved method for the detection of immunoprecipitated
More informationSupplementary information
Supplementary information Table of Content: Supplementary Results... 2 Supplementary Figure S1: Experimental validation of AP-MS results by coimmunprecipitation Western blot analysis.... 3 Supplementary
More informationDolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system
Application Note 03 Dolphin-Chemi plus 8/22/2007 Dolphin-Chemi Plus Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system INTRODUCTION
More informationA549-luc mock cells, A549-luc/shCon cells and A549-luc/shYY1 cells were seeded onto 35 mm
Supplementary Material and Methods Real-time luciferase gene expression in A549-luc cells A549-luc mock cells, A549-luc/shCon cells and A549-luc/shYY1 cells were seeded onto 35 mm dishes (100,000 cells/dish),
More informationab G alpha i Activation Assay Kit
ab173234 G alpha i Activation Assay Kit Instructions for Use For the simple and fast measurement of G alpha i activation. This product is for research use only and is not intended for diagnostic use. Version
More informationMEFs were treated with the indicated concentrations of LLOMe for three hours, washed
Supplementary Materials and Methods Cell Fractionation MEFs were treated with the indicated concentrations of LLOMe for three hours, washed with ice-cold PBS, collected by centrifugation, and then homogenized
More informationAnti-p62 C-terminal pab
Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-p62 C-terminal pab CODE No. CLONALITY Polyclonal ISOTYPE Guinea pig Ig, affinity purified QUANTITY 100 µl SOURCE IMMUNOGEN FORMURATION
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationSupplementary Figure 1. The chemical structure of compound A. Compound A has an amino terminal methyl alanine and compound B has an
Supplemental Data IAP Antagonists Target ciap1 to Induce TNFα-Dependent Apoptosis James E. Vince, W. Wei-Lynn Wong, Nufail Khan, Rebecca Feltham, Diep Chau, Afsar U. Ahmed, Christopher A. Benetatos, Srinivas
More informationFigure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining.
Supplementary information Supplementary figures Figure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining. Figure S2. Induction of Nur77 in
More informationFor Research Use Only. Not for use in diagnostic procedures.
Printed December 13, 2011 Version 1.0 For Research Use Only. Not for use in diagnostic procedures. DDDDK-tagged Protein PURIFICATION GEL with Elution Peptide (MoAb. clone FLA-1) CODE No. 3326 / 3327 PURIFICATION
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationPositive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and
Determining positive selection gates for LRCs and nonlrcs Positive selection gates for the collection of LRCs or nonlrcs had to be drawn based on the location and shape of the Gaussian distributions. For
More informationCell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on
Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationProtocol(Research use only)
Immunohistochemistry (without pretreatment) p2 Immunohistochemistry (Microwave pretreatment) p3 Immunohistochemistry (Autoclave pretreatment) p4 Immunohistochemistry (Trypsin pretreatment) p5 Immunohistochemistry
More informationProtein A Agarose Immunoprecipitation Kit
Protein A Agarose Immunoprecipitation Kit Catalog Number KA0568 20 Reactions Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...
More informationSupplementary Figure Legends
Supplementary Figure Legends Figure S1 gene targeting strategy for disruption of chicken gene, related to Figure 1 (f)-(i). (a) The locus and the targeting constructs showing HpaI restriction sites. The
More informationTechnical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
More informationFor Western blot analyses, cells were lysed in RIPA buffer (50 mm Tris-HCl ph 7.2,
Western blot assay For Western blot analyses, cells were lysed in RIPA buffer (50 mm Tris-HCl ph 7.2, 150 mm NaCl, 1% NP40, 0.1% SDS, 0.5% DOC, 1 mm PMSF, 25 mm MgCl 2, and supplemented with a phosphatase
More informationModulation of the anti-tumor immune response by complement. Maciej M. Markiewski, Robert A. DeAngelis, Fabian Benencia, Salome K.
Modulation of the anti-tumor immune response by complement Maciej M. Markiewski, Robert A. DeAngelis, Fabian Benencia, Salome K. Ricklin- Lichtsteiner, Anna Koutoulaki, Craig Gerard, George Coukos & John
More informationSupplemental Materials and Methods
Supplemental Materials and Methods In situ hybridization In situ hybridization analysis of HFE2 and genin mrna in rat liver tissues was performed as previously described (1). Briefly, the digoxigenin-labeled
More informationab Ubiquitylation Assay Kit
ab139467 Ubiquitylation Assay Kit Instructions for Use For the activation of ubiquitin for use in ubiquitylation experiments This product is for research use only and is not intended for diagnostic use.
More informationSupporting Information
Supporting Information Üstün and Börnke, 2015 Figure S1: XopJ does not display acetyltransferase activity. Autoacetylation activity in vitro. Acetylation reactions using MBP, MBP-XopJ, GST and GST-HopZ1a
More information