Regulation and Function of the IL-1 Family Cytokine IL-1F9 in Human Bronchial Epithelial Cells
|
|
- Rafe Greer
- 6 years ago
- Views:
Transcription
1 Online Data Supplement Regulation and Function of the IL-1 Family Cytokine IL-1F9 in Human Bronchial Epithelial Cells Regina T. Chustz 1, Deepti R. Nagarkar 1, Julie A. Poposki 1, Silvio Favoreto, Jr 1, Pedro C. Avila 1, Robert P. Schleimer 1, Atsushi Kato 1 1. Division of Allergy and Immunology, Department of Medicine, Northwestern University Feinberg School of Medicine, Chicago, IL 60611, USA Materials and Methods Reagents Recombinant human TNF, IL-1β, IL-1F6, IL-4, IL-6, IL-13, IL-17A (IL-17), IFN-λ1 (IL-29), oncostatin M (OSM) and IFN-γ were purchased from R&D systems (Minneapolis, MN). Recombinant human IL-1F9 was purchased from Axxora (San Diego, CA). Recombinant human IFN-β, synthetic bacterial lipoprotein Pam3CSK4, poly(i:c) (dsrna), LPS from Escherichia coli, serotype 0111:B4, recombinant flagellin from Salmonella typhimurium, synthetic diacylated lipoprotein FSL-1, R-837, CpG oligodeoxynucleotide M362 (CpG-C) and polymyxin B were purchased from InvivoGen (San Diego, CA). The small interfering RNAs (sirnas) against RELA (Hs_RELA_5), IRF-3 (Hs_IRF3_1), IL-1RL2 (Hs_IL1RL2_3 and Hs_IL1RL2_6), IL-1RAP (Hs_IL1RAP_5) and the no effect control (AllStars negative control sirna) were obtained from Qiagen (Valencia, CA). Cell culture, treatments and transfection Primary normal human bronchial epithelial cells (NHBE) were obtained from Lonza (Walkersville, MD). NHBE were maintained in serum-free bronchial epithelial cell growth medium (BEGM, Lonza). NHBE were plated in 24-well culture plates coated with collagen (Vitrogen; Collagen Biomaterials, Palo Alto, CA). Before stimulation, NHBE were cultured in BEGM without hydrocortisone for at least 24 h. Submerged NHBE were stimulated with one or more of the following at the indicated concentration: 100 ng/ml TNF, 100 ng/ml IL-1β, 100 ng/ml IL-4, 100 ng/ml IL-6, 100 ng/ml IL-13, 100 ng/ml IL-17, 100 ng/ml OSM, 1000 U/ml IFN-β, 10 ng/ml IFN-γ, 100 ng/ml IL-29, 1 μg/ml Pam3CSK4 (TLR2 ligand), 5 μg/ml dsrna (TLR3 ligand), 1 μg/ml LPS (TLR4 ligand) with 1% human AB serum (MP Biomedicals (Solon, OH)), 10 ng/ml Flagellin (TLR5 ligand), 1 μg/ml FSL-1 (TLR2/6 ligand), 10 μg/ml R-837 (TLR7 ligand) and 2 μg/ml CpG-C (TLR9 ligand) for 6 h. NHBE were preincubated with 0.01% DMSO (vehicle control) or 1 10 μg/ml cycloheximide (CHX) for 1 hour, and then stimulated with 50 ng/ml IL-17 or 5 μg/ml dsrna for 24 h. For sirna experiments, NHBE were seeded at 3*10 4 cells/well in 24-well culture plates and were cultured for 2 days. At 40-60% confluence, cells were transfected with sirna against RELA, IRF-3 or control RNA (AllStars negative control sirna) at 5 nm using HiPerFect transfection reagent (Qiagen) following the manufacturer s instructions. Viability of the cells was usually 80% in sirna transfected cells. The transfected cells were further grown for 48 h, and then stimulated with 5 μg/ml dsrna for 6 h. Rhinovirus serotype 16 (RV16) was a gift from W. Busse and E. Dick (University of Wisconsin, Madison). Submerged NHBE were infected with RV16 at a multiplicity of infection (MOI) of 2 at 33 C. After 6 h post infection, NHBE were washed with PBS to remove excess RV16, and then cells were further cultured for 18 h. In some experiments, NHBE were differentiated at an air-liquid interface (ALI) on
2 0.4 μm pore membrane 12 well transwell plates (Costar, Corning, NY). NHBE were cultured with BEGM on the collagen-coated membrane. When confluent, they were shifted to ALI culture by removing all of the apical medium, and maintaining 500 μl of ALI medium containing BEBM/Dulbecco's modified Eagle's medium (DMEM) supplemented with BEGM SingleQuot Kit (Lonza) and additional bovine serum albumin (1.5 μg/ml, Sigma-Aldrich (St. Louis, MO)) and retinoic acid (5 x 10-8 M, Sigma-Aldrich) in the basal chamber. The ALI medium was changed every other day for 3 weeks. Before stimulation, differentiated NHBE were cultured in ALI medium without hydrocortisone for 2 days. Differentiated NHBE were stimulated with 50 ng/ml TNF, 50 ng/ml IL-17, 2.5 μg/ml dsrna or their combination for 24 and 48 h on the apical side (100 μl) and basolateral side (500 μl). After 6 hours stimulation, medium was removed from the apical side. After 48 h stimulation, cells were washed with 500 μl of PBS from the apical side to collect all secreted protein in the apical area. Primary normal human lung fibroblasts (NHLF, Lonza) were maintained in fibroblast growth medium 2 (FGM2, Lonza). NHLF were seeded at 3*10 4 cells/well in 12-well culture plates and were cultured for 2 days. At 40-60% confluence, cells were transfected with sirna against IL-1RL2, IL-1RAP or control sirna at 20 nm using HiPerFect transfection reagent following the manufacturer's instructions. Viability of the cells was usually greater than 90% in sirna transfected cells. The transfected cells were further grown for 48 h and then stimulated with 250 ng/ml IL-1F9 or 1 ng/ml IL-1β for 3 h. Real-time PCR Total RNA was extracted using RNeasy (Qiagen) or NucleoSpin RNA II (Clontech, Mountain Vies, CA) and was treated with DNase I according to the manufacturer's instructions. Single-strand cdna was synthesized with SuperScript II reverse transcriptase (Invitrogen) and random primers. Real-time RT-PCR was performed with a TaqMan method using an Applied Biosystems 7500 Sequence Detection System (Applied Biosystems, Foster City, CA) in 15 μl reactions (7.5 μl of 2x TaqMan Master mix (Applied Biosystems), 400 nm each primer, and 200 nm TaqMan probe plus cdna). Primer and probe sets for eight genes, IL-1β (sense, 5'-TTCTTCGACACATGGGATAACG-3'; 5'- TCCCGGAGCGTGCAGTT-3'; FAM/black hole quencher 1 (BHQ1) labeled probe, 5'-TGTGCACGATGCACCTGTACGATCA-3' ), IL-1F6 (sense, 5'-CAGCTGAAGGAAAAGGATATAATGGA T-3'; 5'-GCCACTCTGGCTGTGGTAGAA-3'; FAM/BHQ1 labeled probe, 5'-CAACCAACCCGAGCCTGTGAAGTCC-3' ), IL-1F9 (sense, 5'-GCCCACATTGCAGCTAAAAGAG-3'; 5'-CAACCCGAGCCCGTGAAACCCTT-3'; FAM/BHQ1 labeled probe, 5'-CAACCAACCCGAGCCTGTGAAGTCC-3' ), IL-33 (sense, 5'-AGCTCTCTGAAACTTAGTTGATGGAA A-3'; 5'-TTCCTTCTCCAGTGGTAGCATTTG-3'; FAM/MGB labeled probe, 5'-CTGTGAGTCTTGGGTTGAGTA-3'), IL-8 (sense, 5'-CCACACTGCGCCAACACAGAAATTAT TG-3'; 5'-GCCCTCTTCAAAAACTTCTCCACAACC C-3'; FAM/BHQ1 labeled probe, 5'-AAGCTTTCTGATGGAAGAGAGCTCTG TC-3'), CXCL3 (sense, 5'-CTGCGCTGCCAGTGCTT-3'; 5'-ACCTTACATTCACACTTTGGATGTTC-3 '; FAM/BHQ1 labeled probe, 5'-CAGACACTGCAGGGAATTCACCTCA-3' ), CCL20 (sense, 5'-GCTCCTGGCTGCTTTGATG-3'; 5'-CAAAGTTGCTTGCTGCTTCTGA-3'; FAM/MGB labeled probe, 5'-CTGCTACTCCACCTCTGCGGCGA-3')
3 and β-actin (ACTB; sense, 5'-CTGGCCGGGACCTGACT-3'; 5'-GCAGCCGTGGCCATCTC-3'; FAM/MGB labeled probe, 5'-CACCACCACGGCCGA-3') were synthesized by Integrated DNA Technologies (Coralville, Iowa) or Applied Biosystems. Primer and probe sets for IL-1F5 (Hs _m1), IL-1F7 (Hs _m1), IL-1F8 (Hs _m1), IL-1F10 (Hs _m1), IL-1RL2 (Hs _m1), IL-1RAP (Hs _m1), RELA (Hs _m1), IRF-3 (Hs _m1) and G-CSF (Hs _m1) were purchased from Applied Biosystems. To determine the exact copy number of the target genes, quantified aliquots of purified PCR fragments of the target genes were serially diluted and used as standards in each experiment. Aliquots of cdna equivalent to 10 ng of total RNA were used for real-time PCR. The mrna expression levels were normalized to the median expression of a housekeeping gene (ACTB). Western blot analysis NHBE were stimulated with 50 ng/ml TNF, 50 ng/ml IL-17, 5 μg/ml dsrna or their combinations for 48 h. The supernatant was concentrated 20 times using Amicon Ultra-4 10,000 MWCO filters (Millipore). Cells were harvested in cell lysis buffer (Cell Signaling Technology, Beverly, MA) supplemented with halt protease inhibitor cocktail (Thermo Fisher Scientific, Rockford, IL). Whole cell lysates and concentrated supernatants were dissolved in lane marker sample buffer (Thermo Fisher Scientific). To detect IL-1F6 and IL-1F9, 30 μg of whole cell lysates or 20 μl of supernatants were resolved on a 4-12% NuPAGE Bis-Tris Gel (Invitrogen) in an MES buffer system and then proteins were transferred onto a PVDF membrane (Bio-Rad, Hercules, CA). The membranes were blocked in blocking buffer for fluorescent western blotting (Rockland, Gilbertsville, PA) for 2 h and subsequently incubated overnight at 4 C with 0.5 μg/ml rat anti-human IL-1F9 mab (clone: , R&D systems) or 0.1 μg/ml biotinylated goat anti-human IL-1F6 antibody (R&D systems). Following primary antibody incubation, the membranes were washed repeatedly in PBS/0.1% Tween 20 and then labeled by 45 min incubation at room temperature with infrared secondary antibody IRDye 700DX-conjugated goat anti-rat IgG (1:5,000, Rockland) or IRDye 700DX-conjugated streptavidin (1:100,000, Rockland). Protein was detected on an Odyssey Infrared Imaging System (Li-Cor Biosciences, Lincoln, NE). NHLF were harvested at the indicated time points and then whole cell lysates were dissolved in cell lysis buffer supplemented with halt protease inhibitor cocktail and halt phosphatase inhibitor cocktail (Thermo Fisher Scientific). The cell lysates were then dissolved in NuPAGE LDS Sample Buffer (Invitrogen). To detect p38, JNK, ERK, NF-κB p65 and CREB, 30 μg of whole cell lysates were resolved on a 4-12% NuPAGE Bis-Tris Gel and then proteins were transferred onto a PVDF membrane. Blocked-membranes were incubated overnight at 4 C with primary antibodies (Cell Signaling Technology) and then were labeled with infrared secondary antibodies IRDye 700DX-conjugated donkey anti-rabbit IgG (1:10,000, Rockland), IRDye 800-conjugated donkey anti-mouse IgG (1:10,000, Rockland), AlexaFluor 680-conjugated goat anti-mouse IgG (1:10,000, Invitrogen) or IRDye 800-conjugated goat anti-rabbit IgG (1:10,000, Rockland). ELISA and cytometric bead array The concentrations of IL-1F6 and IL-1F9 protein in cell-free supernatants were measured using sandwich ELISAs. Plates were coated with 0.5 µg/ml mouse anti-human IL-1F6 mab (clone; , R&D systems) or 2 µg/ml rat anti-human IL-1F9 mab (clone; , R&D systems) and then 0.1 µg/ml biotinylated goat anti-human IL-1F6 (R&D systems) or 0.5 µg/ml biotinylated goat anti-human IL-1F9 (R&D systems) were used as a detection reagent. The minimal detection limits are 62.5 pg/ml and 750 pg/ml, respectively. The concentrations of IL-33 were measured using a commercial IL-33 ELISA kit (Invitrogen). The
4 minimal detection limit is 15.6 pg/ml. The concentrations of IL-8 and G-CSF were measured using a cytometric bead array assay (CBA, BD Biosciences, San Jose, CA). The minimal detection limit is 5 pg/ml. Statistical Analysis All data are reported as the mean ± SEM unless otherwise noted. Differences between groups were analyzed using the paired Student's t test and considered to be significant if p < Figure E1. Effect of sirna on the expression of target molecules in human bronchial epithelial cells. NHBE were transfected with sirna against control RNA, RELA, or IRF-3 at 5 nm for 48 hours and then stimulated with 5 μg/ml dsrna for 6 hours. The levels of mrnas were determined by real-time PCR. Efficiency of sirna against target molecules was expressed as a percentage of non-sirna transfected cells. The results are shown as the mean ± SEM of five independent experiments. * p < Figure E2. IL-1F9 induces the activation of MAPKs, NF-κB and CREB in human lung fibroblasts. NHLF were harvested at the indicated time points. To detect p38, JNK, ERK, NF-κB p65 and CREB, 30 μg of whole cell lysates were resolved on a 4-12% NuPAGE Bis-Tris Gel then proteins were transferred onto a PVDF membrane. Blocked-membranes were incubated over night at 4 C with primary antibodies and then were labeled with infrared secondary antibodies. Protein was detected on an Odyssey Infrared Imaging System. The results are representative of three separate experiments.
5 Supplemental Figure 1 Figure E1. Effect of sirna on the expression of target molecules in human bronchial epithelial cells.
6 Supplemental Figure 2 Figure E2. IL-1F9 induces the activation of MAPKs, NF-κB and CREB in human lung fibroblasts.
Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK)
SUPPLEMENTAL MATERIAL Supplemental Methods Flow cytometry Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK) and anti-human CD68 (Dako, Denmark), anti-human smooth muscle cell α-actin
More informationSupporting Information
Supporting Information Casson et al. 10.1073/pnas.1421699112 Sl Materials and Methods Macrophage Infections. In experiments where macrophages were primed with LPS, cells were pretreated with 0.5 μg/ml
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More informationSupplemental Figure 1
Supplemental Figure 1 A IL-12p7 (pg/ml) 7 6 4 3 2 1 Medium then TLR ligands MDP then TLR ligands Medium then TLR ligands + MDP MDP then TLR ligands + MDP B IL-12p4 (ng/ml) 1.2 1..8.6.4.2. Medium MDP Medium
More informationMammosphere formation assay. Mammosphere culture was performed as previously described (13,
Supplemental Text Materials and Methods Mammosphere formation assay. Mammosphere culture was performed as previously described (13, 17). For co-culture with fibroblasts and treatment with CM or CCL2, fibroblasts
More informationSupplemental Information
Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai
More information(Supplementary Methods online)
(Supplementary Methods online) Production and purification of either LC-antisense or control molecules Recombinant phagemids and the phagemid vector were transformed into XL-1 Blue competent bacterial
More informationSupplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1
Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1
More informationSupplementary Material
Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated
More informationFig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of
Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and
More informationFlow-cytometry assessment of parasitemia in cell parasite co-culture assay using hydroethidine staining Western blotting RT-PCR
Flow-cytometry assessment of parasitemia in cell parasite co-culture assay using hydroethidine staining The capability of cells, either PBMC or purified T- cell lines, to inhibit parasite growth or merozoite
More informationB. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.
A. - Figure.S1,Li et al. B. : - + - + - + E-cadherin CK19 α-sma vimentin β -actin C. D. Apoptosis: 1.68% 2.99% 1.31% - : - + - + - + Apoptosis: 48.33% 45.32% 44.59% E. invaded cells number 400 300 200
More informationused at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies were
1 Supplemental Methods Reagents and chemicals: TGFβ was a generous gift from Genzyme Inc. (Cambridge, MA) and was used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies
More informationHuman skin punch biopsies were obtained under informed consent from normal healthy
SUPPLEMENTAL METHODS Acquisition of human skin specimens. Human skin punch biopsies were obtained under informed consent from normal healthy volunteers (n = 30) and psoriasis patients (n = 45) under a
More informationSUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION
SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,
More informationCell viability. Cell viability was examined by MTT assay (Sigma-Aldrich).
Supplementary Materials Supplementary materials and methods Cell culture. Primary human dermal fibroblasts (DFs) were isolated from full-thickness skin samples. Tissue samples were dissected into small
More informationTechnical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
More informationsirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
More informationRayBio Phospho-ERK/JNK/P38α ELISA Kit
RayBio Phospho-ERK/JNK/P38α ELISA Kit For measuring ERK1/2 (T202/Y204), JNK (T183/Y185), P38α (T180/Y182) and Total ERK1/2, JNK, P38α in Human, Mouse and Rat Cell Lysates. User Manual (Revised Aug. 26
More informationSingle cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor
SUPPLEMENTARY INFORMATION Single cell imaging of Bruton's Tyrosine Kinase using an irreversible inhibitor Anna Turetsky 1,a, Eunha Kim 1,a, Rainer H. Kohler 1, Miles A. Miller 1, Ralph Weissleder 1,2,
More informationSpironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice
Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice Supplementary Material Supplementary Methods Materials Spironolactone, aldosterone and β-glycerophosphate were
More informationSupplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured
Supplementary Figure 1. Co-localization of GLUT1 and DNAL4 in BeWo cells cultured under static conditions. Cells were seeded in the chamber area of the device and cultured overnight without medium perfusion.
More informationTranscriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex
POSTER PRESENTATION Transcriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex Hai-Chon Lee *, Je-In Youn, Kyungwha Lee, Hwanyul Yong, Seung-Yong
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationFigureS1NodegradationofRNA wasobservedby
FigureS1NodegradationofRNA wasobservedby recombinantgasdnasesda1.rna wasisolatedfrom GAS andco-incubatedwitheitherthednasebuferaloneorwith 365ngoftherecombinantSda1inDNasebuferfor10minutesat 37uC.Visualisationfolowedby1.5%
More informationThis Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
More informationDNA methylation analysis was carried out using the Epityper system from Sequenom
Supplemental methods Quantitative DNA methylation analysis DNA methylation analysis was carried out using the Epityper system from Sequenom (San Diego, CA). The EpiTYPER assay is a tool for the detection
More informationIn-Cell Western Assay
In-Cell Western Assay Complete Sample Protocol for Measuring IC 50 of Inhibitor U0126 in NIH3T3 Responding to Acidic Fibroblast Growth Factor (afgf-1) Developed for: Aerius, Odyssey Classic, Odyssey CLx,
More informationmouse IL-6 Catalog Number: DY406
mouse IL-6 Catalog Number: DY406 This DuoSet ELISA Development kit contains the basic components required for the development of sandwich ELISAs to measure natural and recombinant mouse Interleukin 6 (IL-6).
More informationLINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS.
Supplemental Data: LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Scott Jepson, Bryan Vought, Christian H.
More informationCell death analysis using the high content bioimager BD PathwayTM 855 instrument (BD
Supplemental information Materials and Methods: Cell lines, reagents and antibodies: Wild type (A3) and caspase-8 -/- (I9.2) Jurkat cells were cultured in RPMI 164 medium (Life Technologies) supplemented
More informationSupporting Information
Supporting Information Liu et al. 10.1073/pnas.0901216106 SI Materials and Methods Reagents. Thioglycolate and LPS from Escherichia coli 0111:B4 were from Sigma-Aldrich. PAM3CSK4 and poly(i:c) were from
More informationQuantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript;
Supplemental Methods Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript; Bio-Rad, Hercules, CA, USA) and standard RT-PCR experiments were carried out using the 2X GoTaq
More informationMeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132
Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP
More informationIgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only
IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective
More informationData Supplement Plasmin Triggers Cytokine Induction in Human Monocyte-Derived Macrophages
Data Supplement Plasmin Triggers Cytokine Induction in Human Monocyte-Derived Macrophages Qun Li, Yves Laumonnier, Tatiana Syrovets, and Thomas Simmet Methods Antibodies and Reagents Antibodies for immunoblotting:
More informationCALCUTTA UNIVERSITY University College of science 35, Ballygunge Circular Road, Kolkata , India
35, Ballygunge Circular Road, Kolkata 700 09, India Residence :Udayan Flat A-0 25/2B/ Jheel Road, Dhakuria Anindita Ukil,Ph.D Kolkata 700 03 Ref No. BIOCHEM/AU/UGC-IC/Consumable/si RNA/8-9 Dated:23-07-8
More informationSegments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationHuman/Mouse/Rat Phospho-CREB (S133) Immunoassay. An ELISA-based assay using fluorogenic substrates to measure phosphorylated CREB in whole cells.
Cell-Based ELISA Human/Mouse/Rat Phospho-CREB (S133) Immunoassay Catalog Number KCB2510 An ELISA-based assay using fluorogenic substrates to measure phosphorylated CREB in whole cells. This package insert
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationHeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid
SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured
More informationSupplementary Methods
Supplementary Methods Mice injections. C57BL/6 female mice 6-10 weeks of age were purchased from the Jackson Laboratory. Soluble rapamycin (Sigma) was diluted in PBS and administered i.p. to mice at 1.5
More informationSupplementary Material & Methods
Supplementary Material & Methods Affymetrix micro-array Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, USA). RNA concentration and quality was determined using the ND-1000 spectrophotometer
More informationBD Biosciences BD Cytometric Bead Array (CBA) Product List. For Research Use Only. Not for use in diagnostic or therapeutic procedures.
BD Biosciences BD Cytometric Bead Array (CBA) Product List For Research Use Only. Not for use in diagnostic or therapeutic procedures. Highlights of BD CBA Products Reagents with Superior Quality and Reproducibility
More informationDuoSet IC. Human Total p21. Catalog Number DYC Catalog Number DYC Catalog Number DYC1047E
DuoSet IC Human Total p21 Catalog Number DYC1047-2 Catalog Number DYC1047-5 Catalog Number DYC1047E For the development of sandwich ELISAs to measure p21 in cell lysates. This package insert must be read
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationBlimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling
1 2 3 4 5 6 7 8 9 10 11 Supplementary Methods Antibodies Blimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling (Danvers, MA) and used at 1:1000 to detect the total PRDM1 protein
More informationSupplementary Table 1. PCR amplification conditions for each primer pair. Primer sequence
- 1 - Supplementary Tables Supplementary Table 1. PCR amplification conditions for each primer pair Primer sequence FN1 S - CAAAGCAAGCCCGGTTGT AS - CGCTCCCACTGTTGATTTATCTG ITGα2 S - TTAGGTTACTCTGTGGCTGCAATT
More informationCell extracts and western blotting RNA isolation and real-time PCR Chromatin immunoprecipitation (ChIP)
Cell extracts and western blotting Cells were washed with ice-cold phosphate-buffered saline (PBS) and lysed with lysis buffer. 1 Total cell extracts were separated by SDS-PAGE and transferred to nitrocellulose
More informationELISA antibody pair Technical Data Sheet
ELISA antibody pair Technical Data Sheet 10-plate and 20-plate format For research use only. Not for use in diagnostic or therapeutic procedures. This Technical Data Sheet applies for the following U-CyTech
More informationNTM486-04, NTM174-04,
Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.
More informationPE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence
PE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence Parul Singh 1,2, Rameshwaram Nagender Rao 1, Jala Ram Chandra Reddy 3, R.B.N. Prasad 3, Sandeep
More informationDuoSet IC. Human Phospho-DDR1. Catalog Number DYC Catalog Number DYC5859-5
DuoSet IC Human Phospho-DDR1 Catalog Number DYC5859-2 Catalog Number DYC5859-5 For the development of sandwich ELISAs to measure phosphorylated human Discoidin Domain Receptor 1 (DDR1) in cell lysates.
More informationPlease read manual carefully before starting experiment
RayBio Cell-Based Human/Mouse/Rat ERK1/2, JNK, p38 MAPK Phosphorylation ELISA Sampler Kit For the semi-quantitative detection of phosphorylated human, mouse, or rat ERK1/2 (Thr202/Tyr204), JNK (Thr183/Tyr185),
More informationTECHNICAL BULLETIN. Color. Fig.1. Cell-Based protein phosphorylation procedure
Cell-Based ELISA Sampler Kit for detecting phospho-erk1/2 (pthr 202 /ptyr 204 ), phospho-jnk (pthr 183 /ptyr 185 ), and phospho-p38 MAPK (pthr 180 /ptyr 182 ) in cultured cell lines adequate for 192 assays
More informationIKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα
More informationELISPOT and FLUOROSPOT kits
ELISPOT and FLUOROSPOT kits Interleukins Interferons Granzymes and perforins TNF superfamily ligands and receptors Apoptosis markers And many more... ELISPOT and FLUOROSPOT: a cell-based assay to assess
More informationArf6 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Arf6 Activation Assay Kit Catalog Number: 82401 20 assays NewEast Biosciences 1 Table of Content Product
More informationApoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells
Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells Ryosuke Horie. Kagawa University of medecine, Kita-gun, Japan. Disclosures: R. Horie: None.
More informationData Sheet GITR / NF-ĸB-Luciferase Reporter (Luc) - Jurkat Cell Line Catalog #60546
Data Sheet GITR / NF-ĸB-Luciferase Reporter (Luc) - Jurkat Cell Line Catalog #60546 Description This cell line expresses a surface human GITR (glucocorticoid-induced TNFR family related gene; TNFRSF18;
More informationAn ELISA-based assay using fluorogenic substrates to measure total inducible Nitric Oxide Synthase (inos) in whole cells.
Cell-Based ELISA Human Total inos Immunoassay Catalog Number KCB9502 An ELISA-based assay using fluorogenic substrates to measure total inducible Nitric Oxide Synthase (inos) in whole cells. This package
More informationAn ELISA-based assay using fluorogenic substrates to measure total Cyclooxygenase-2 (COX-2) in whole cells.
Cell-Based ELISA Human/Mouse Total COX-2 Immunoassay Catalog Number KCB4198 An ELISA-based assay using fluorogenic substrates to measure total Cyclooxygenase-2 (COX-2) in whole cells. This package insert
More informationSupplemental methods:
Supplemental methods: ASC-J9 treatment ASC-J9 was patented by the University of Rochester, the University of North Carolina, and AndroScience Corp., and then licensed to AndroScience Corp. Both the University
More informationSensoLyte FDP Alkaline Phosphatase ELISA Assay Kit *Fluorimetric*
SensoLyte FDP Alkaline Phosphatase ELISA Assay Kit *Fluorimetric* Catalog # 71101-M Unit Size Kit Size 1 Kit 500 Assays This kit is optimized to detect alkaline phosphatase-labeled secondary antibody or
More informationSupplementary Information for
Supplementary Information for Siglec-7 Engagement by GBS -protein Suppresses Pyroptotic Cell Death of Natural Killer Cells Jerry J. Fong a,b, Chih-Ming Tsai a,b, Sudeshna Saha a,b, Victor Nizet a,c,d Ajit
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationSupporting Information
Supporting Information DNA Crystals as Vehicles for Biocatalysis. Chun Geng and Paul J. Paukstelis* *Email: paukstel@umd.edu Recombinant MBP-tagged RNase inhibitor expression and purification. The porcine
More informationSupporting Information
Supporting Information Groschwitz et al. 10.1073/pnas.0906372106 SI Methods In vitro permeability. Caco2-bbe human intestinal adenocarcinoma cells (ATCC) were maintained in DMEM supplemented with 10% FCS,
More informationDIY Human IFN Lambda 3/1/2 (IL-28B/29/28A) ELISA Catalog No
DIY Human IFN Lambda 3/1/2 (IL-28B/29/28A) ELISA Catalog No. 61840 Assay Range: 62.5-4000 pg/ml Store all components at 2-8 C The standard in this kit is Lambda 1 and 3. This kit detects Lambda 1, 2, and
More informationBmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone
Generation and culture of bone marrow-derived dendritic cells (bmdcs) BmDCs were generated as described by a modified protocol of Inaba et al S1. Briefly, bone marrow cells from murine tibias and femurs
More informationSupplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered
Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl
More informationSupplementary Figures S1-S5. a b c
Supplementary Figures S1-S5 a b c Supplementary Figure S1. Generation of IL-17RD-deficient mice. (a) Schematic shows the murine il-17rd gene and the genetrap targeting vector, containing a promoter-less
More informationRayBio Human Hydroxylated-HIF-1alpha (Pro402) and HIF-1alpha ELISA Kit
RayBio Human Hydroxylated-HIF-1alpha (Pro402) and HIF-1alpha ELISA Kit For Measuring Hydroxylated HIF-1alpha (Pro402) and HIF-1alpha in Human Cell Lysates User Manual (Revised Aug 26 th, 2016) RayBio Hydroxylated-HIF-1alpha
More informationDuoSet IC. Human/Mouse Phospho-STAT3 (Y705) Catalog Number DYC4607B-2 Catalog Number DYC4607B-5 Catalog Number DYC4607BE
DuoSet IC Human/Mouse Phospho-STAT3 (Y705) Catalog Number DYC4607B-2 Catalog Number DYC4607B-5 Catalog Number DYC4607BE For the development of sandwich ELISAs to measure Signal Transducer and Activator
More informationRheB Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based RheB Activation Assay Kit Catalog Number: 81201 20 assays NewEast Biosciences 1 FAX: 610-945-2008 Table
More informationCdc42 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay
More informationProtocol for induction of expression and cell lysate production
Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected
More informationRab5 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Rab5 Activation Assay Kit Catalog Number: 83701 20 assays 24 Whitewoods Lane 1 Table of Content Product
More informationHuman RIG-1 ELISA kit
Human RIG-1 ELISA kit Cat. No.:DEIA6479 Pkg.Size:96T Intended use The RIG-1 (human), ELISA kit is to be used for the quantitative determination of human RIG-1 in cell extracts. General Description The
More informationRNP-IP (Modified Method)-Getting Majority RNA from RNA Binding Protein in the Cytoplasm Fengzhi Liu *
RNP-IP (Modified Method)-Getting Majority RNA from RNA Binding Protein in the Cytoplasm Fengzhi Liu * School of Biomedical Sciences, Thomas Jefferson University, Philadelphia, USA *For correspondence:
More informationDiscover more with FluoroSpot
Discover more with FluoroSpot FluoroSpot combines the sensitivity of ELISpot with the capacity to analyze secretion of several analytes simultaneously. This highly sensitive cellular assay is robust, easy
More information8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and
1 Supplemental information 2 3 Materials and Methods 4 Reagents and animals 5 8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and 6 Silencer Select Pre-designed sirna
More informationElectronic Supplementary Information. and purified according to previously published procedures(1). GlcNAc and Phos-FLAG were
Electronic Supplementary Information Experimental details: Synthesis and purification of sugars. GlcN, 4 GlcN, and 4 GlcN were synthesized and purified according to previously published procedures(1).
More informationSupporting Online Material. 3. Analysis of in vivo TLR4-mediated response in TRIF-deficient mice
Supporting Online Material 1. Materials and Methods 2. Generation of TRIF-deficient mice 3. Analysis of in vivo TLR4-mediated response in TRIF-deficient mice 4. Measurement of LPS-induced IRAK-1 kinase
More informationApplication Note AN001
Testing hybridoma supernatants with the Spots On Dots Antibody Screening Kit Application Note AN1 Table of Contents Overview... 2 Figure 1. Screening of hybridomas raised against peptide antigens... 3
More informationSupporting Information
Supporting Information Tal et al. 10.1073/pnas.0807694106 SI Materials and Methods VSV Infection and Quantification. Infection was carried out by seeding 5 10 5 MEF cells per well in a 6-well plate and
More informationSUPPLEMENTARY INFORMATION
(Supplementary Methods and Materials) GST pull-down assay GST-fusion proteins Fe65 365-533, and Fe65 538-700 were expressed in BL21 bacterial cells and purified with glutathione-agarose beads (Sigma).
More informationSupplementary Figure 1
Supplementary Figure 1 Virus infection induces RNF128 expression. (a,b) RT-PCR analysis of Rnf128 (RNF128) mrna expression in mouse peritoneal macrophages (a) and THP-1 cells (b) upon stimulation with
More informationTable S1. Nucleotide sequences of synthesized oligonucleotides for quantitative
Table S1. Nucleotide sequences of synthesized oligonucleotides for quantitative RT-PCR For CD8-1 transcript, forward primer CD8-1F 5 -TAGTAACCAGAGGCCGCAAGA-3 reverse primer CD8-1R 5 -TCTACTAAGGTGTCCCATAGCATGAT-3
More informationSupplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
More informationFor Western blot analyses, cells were lysed in RIPA buffer (50 mm Tris-HCl ph 7.2,
Western blot assay For Western blot analyses, cells were lysed in RIPA buffer (50 mm Tris-HCl ph 7.2, 150 mm NaCl, 1% NP40, 0.1% SDS, 0.5% DOC, 1 mm PMSF, 25 mm MgCl 2, and supplemented with a phosphatase
More informationExoCap TM Streptavidin Kit
CODE No. MEX-SA For Research Use Only. Not for use in diagnostic procedures. Printed July 5, 2017 Version 2.0 ExoCap TM Streptavidin Kit Exosome Isolation and Enrichment Kit PRODUCT DESCRIPTION ExoCap
More informationFor the development of sandwich ELISAs to measure phosphorylated Erythropoietin Receptor (Epo R) in cell lysates.
DuoSet IC Human Phospho-Epo R Catalog Number DYC5200-2 Catalog Number DYC5200-5 For the development of sandwich ELISAs to measure phosphorylated Erythropoietin Receptor (Epo R) in cell lysates. This package
More informationSupporting Information
Supporting Information He et al. 10.1073/pnas.1116302108 SI Methods Cell Culture. Mouse J774A.1 and RAW 264.7 macrophages were obtained from ATCC and were cultured in MEM supplemented with 10% FS (Sigma)
More informationRayBio Human and Mouse Cleaved-Caspase-7 (Asp198) and Caspase-7 ELISA Kit
RayBio Human and Mouse Cleaved-Caspase-7 (Asp198) and Caspase-7 ELISA Kit For Measuring Cleaved Caspase-7 (Asp198) and Caspase-7 in Human and Mouse Cell Lysates User Manual (Revised Aug 26 th, 2016) RayBio
More informationSupplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after
Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for
More informationFor the development of sandwich ELISAs to measure Heme Oxygenase 1 (HO-1/HMOX1) in cell lysates.
DuoSet IC Human Total HO-1/HMOX1 Catalog Number DYC3776-2 Catalog Number DYC3776-5 Catalog Number DYC3776E For the development of sandwich ELISAs to measure Heme Oxygenase 1 (HO-1/HMOX1) in cell lysates.
More informationGα 13 Activation Assay Kit
A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Gα 13 Activation Assay Kit Catalog Number: 80401 20 assays NewEast Biosciences 1 Table of Content Product
More informationUsing Sapphire700 Stain and DRAQ5 Stain for Cell Number Normalization
Using Sapphire700 Stain and DRAQ5 Stain for Cell Number Normalization Developed for: Aerius, Odyssey Classic, Odyssey CLx, and Odyssey Sa Infrared Imaging Systems Please refer to your manual to confirm
More informationHuman IgG ELISpot BASIC
Human IgG ELISpot BASIC Product Code: 3850-2H CONTENTS: Vial 1 (yellow top) Monoclonal antibodies MT91/145 (1.2 ml) Concentration: 0.5 mg/ml Vial 2 (green top) Biotinylated monoclonal antibodies MT78/145
More information