Supplementary Materials for. Combinatory screening of DNA aptamers for molecular imaging of HER2 in cancer
|
|
- Shannon Flynn
- 6 years ago
- Views:
Transcription
1 Supplementary Materials for Combinatory screening of DNA aptamers for molecular imaging of HER2 in cancer Guizhi Zhu, Huimin Zhang,, Orit Jacobson, Zhantong Wang, Haojun Chen,, Xiangyu Yang, ǁ, Gang Niu, and Xiaoyuan Chen,* Laboratory of Molecular Imaging and Nanomedicine, National Institute of Biomedical Imaging and Bioengineering (NIBIB), National Institutes of Health (NIH), Bethesda, Maryland (MD), United States (USA) Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen , P. R. China Department of Nuclear Medicine, Xiamen Cancer Center, The First Affliated Hospital of Xiamen University, Xiamen, China, ǁ Jiangsu Key Laboratory of Molecular Imaging and Functional Imaging, Department of Radiology, Zhongda Hospital, Medical School of Southeast University, Nanjing , China * Corresponding Author: Dr. Xiaoyuan Chen Building 35A Rm GD937, 35A Convent Dr., Bethesda, MD Telephone: shawn.chen@nih.gov 1
2 1. Supplemental Methods DNA synthesis Cell lines and cell culture Cell-SELEX Table of Contents Deep sequencing and bioinformatics analysis Aptamer binding test by flow cytometry Cell staining using aptamers Tumor Model Statistical Analysis 2. Supplemental Figures Figure S1. An image of western blotting verifying HER2 ECD using a native PAGE gel. Figure S2. Schematic work flow in a round of SELEX and a representative image of agarose gel electrophoresis result showing the optimization of PCR cycles. Figure S3. Flow cytometry results showing that HER2 was overexpressed on SKOV3 cells, but not on MDA-MB-231 cells. Figure S4. Sequencing the final screening pool by Ion-Torrent 2 nd generation sequencing. Figure S5. Sequence analysis of the most frequent 7 sequence families. Figure S6. Cell viability of SKOV3 cells treated with Heraptamers in vitro for 2 days. Figure S7. Binding of Heraptamer to HER2 ECD and SKOV3 cell in vitro. 3. Supplemental Tables Table S1. PCR conditions used for DNA preparation during SELEX. Table S2. Summary of HER2 protein-selex. Table S3. Summary of HER2 Cell-SELEX using SKOV3 cells. Table S4. DNA sequences used for 2 nd -gen high throughput sequencing. Table S5. Sequences of a panel of most frequent Heraptamer candidates. 2
3 Supplemental Methods DNA synthesis DNA was synthesized as previously described (25), except library DNA and DNA modified with alkyne DNA which were purchased from IDT (Coralville, IA). Cell lines and cell culture SKOV3, MDA-MB-231, MDA-MB-435, and MCF7 cells were purchased from ATCC. SKOV3 cells were cultured in MyCoy s 5A cell culture medium, MDA-MB-231 and MDA-MB-435 in Leibovitz's L-15 medium, and MCF7 in EMEM medium. Cells were grown in a humidified atmosphere (5% CO 2, 37 C). Cell-SELEX SKOV3, which overexpress HER2, was used for cell-selex. Cells were digested to be single cells and seeded into petri dish one day before use for screening. 90% confluent cells were used for screening. One 75-mm petri dish of cells, equivalent to about 1 million cells, was used for each round of screening. For positive screening, cells were washed for 3 times using cell binding buffer (PBS supplemented with 5 mm Mg 2+ and 5g/L glucose). Snap-cooled DNA was diluted into 2 ml cell binding buffer and added into one petri dish. Cells were incubated with DNA on ice, with gentle shaking, for 1 h. Then, cells were washed with cell binding buffer for 3 times to remove unbound DNA. Cell-DNA complexes were scraped off on ice, heated at 95 C immediately for 5 min, and then centrifuged at rpm for 5 min to remove debris and collect supernatant. The supernatant was desalted, cryo-concentrated to reduce volume to be under 300 µl. The resultant product was then PCR amplified, as performed for protein-selex. Negative screening was performed by adding HSA (1 mg/ml) into the mixture of DNA and cells to allow remove DNA bound to HSA by washing. Deep sequencing and bioinformatics analysis The final screening pool was subject to deep sequencing using Ion Torrent 2 nd generation high throughput sequencing. A pair of primers (see sequences in Figure 1C) integrated with the primers used for screening and the adaptors for sequencing were designed. The PCR conditions using this pair of primers were again optimized in PCR temperature and time. Using optimized PCR conditions, preparative PCR of the DNA pool was conducted. PCR products were analyzed by agarose gel electrophoresis in a 20-cm gel to allow separation of the target PCR products from byproducts. The gel was stained using Ethedium Bromide and visualized under UV exposure. The target band (with size about 123 bp) was cut out, collected and dissolved in buffer. The DNA was extracted using a DNA extraction kit (Valencia, CA). Extracted DNA was sequenced in the 3
4 Nextgen DNA Sequencing Laboratory of Interdisciplinary Center for Biotechnology Research at the University of Florida. Bioinformatics analysis of the sequencing results were conducted to get the most frequent reads. First, using Galaxy ( sequences were filtered by length to remove any remnant PCR byproducts. Sequences were then collapsed to merge, converge and count the same sequences. Sequences were then arranged by order of frequence, and the most frequent sequences were picked for downstream validation. Sequence homology was analyzed using online software MEME The structures of aptamer candidates were simulated using online software NUPACK. Aptamer binding test by flow cytometry The binding of aptamers or aptamer candidates were tested using HER2-ECD-coupled beads and a panel of cells. To test binding with HER2-coupled beads, biotinylated DNA (200 nm) was incubated with HER2-ECD-coupled beads in protein screening buffer for 30 min at room temperature. Beads were then washed for 2 times to remove unbound DNA. Streptavidin-PE-Cy5.5 was then added into the solution, followed by 20 min of further incubation and washing again for 3 times. The resultant beads were then analyzed by flow cytometry to determine the fluorescence intensity. To test binding with cells, cells were digested to single cells and seeded one day before use. Before use for cell binding test, cells were washed using PBS for 3 times, and cells were dissociated using non-enzymatic dissociation buffer to prepare single dissociated cells while keeping cell membrane proteins intact. Cells were washed and quantified. Cells (0.2 x 10 6 /sample) were suspended into cell binding buffer, and DNA labeled with FITC or Cy5 or Biotin (200 nm) was added into cell suspension, followed by incubation on ice (unless denoted otherwise) for 30 min and then washing for 3 times. If biotinylated DNA was used, Streptavidin- PE-Cy5.5 was then added into the solution, followed by 20 min of further incubation and washing again for 3 times. The resultant cells were then analyzed by flow cytometry to determine fluorescence intensity. Cell staining using aptamers Cells were digested and seeded into cell culture chambers one day before use. Before staining with aptamers, cells were washed for 3 times. Cells were then immersed in cell binding buffer, Alexa488-labeled aptamers (200 nm) and Hoechst33342 (1000x dilution; Invitrogen, Carlsbad, CA) were added into cell binding buffer and incubated with cells for 30 min on ice. Afterwards, cells were washed for 3 times and immersed in cell binding buffer again, followed by immediate confocal microscopy observation. Tumor Model HER2-positive SKOV3 tumor model was used for molecular imaging of HER2. Nude mice were subcutaneously inoculated with 5 x 10 6 SKOV3 cells/mouse on the right shoulder. The tumor 4
5 growth was monitored by caliper measurement for 4 weeks, until when the tumor sizes reached about 500 mm 3 and mice were used for PET imaging. Statistical Analysis Data represent mean ± standard deviation (SD). Statistical analysis was conducted using Student s t test for unpaired data. P values < 0.05 were considered significant. 5
6 Supplemental Figures Figure S1. An image of western blotting verifying HER2 ECD using a native PAGE gel. The upper band is likely a dimer of HER2 ECD. Alexa488-labeled 2 nd Ab was used. Figure S2. (A) Schematic work flow in a round of SELEX. (B) A representative image of agarose gel electrophoresis result showing the optimization of PCR cycles in each round of SELEX. PCR products with the optimal cycles produce the fewest byproducts within the most cycles. 6
7 Figure S3. Flow cytometry results showing that HER2 was overexpressed on SKOV3 cells, but not on MDA-MB-231 cells. Live cells were stained with anti-her2 antibody (trastuzumab) conjugated with Cy5 using NHS-Cy5. 7
8 Figure S4. Sequencing the final screening pool by Ion-Torrent 2 nd generation sequencing. (A) An agarose gel electrophoresis image showing the DNA products from PCR amplification of the final screening pool, using a pair of primers integrated with sequencing-dedicated adaptors. The 8
9 gel band of amplified products was cut, dissolved, and filtrated to extract and purify PCR DNA products. (B, C) Electrophoregraphs showing the size analysis of DNA markers (C) and purified DNA pools from the above gel (B). The band corresponding to the size of 35 bp is likely primer dimers. (D) A graph showing the size profile of the sequenced DNA in the final screening pool. The majority of DNAs have 66 bp (excluding the adaptor primer used for sequencing), which is consistent with the library design. Figure S5. Sequence analysis of the most frequent 7 sequence families: Heraptamer1 to Heraptamer7. (A) Alignment of the variable regions (excluding the two primer regions used for PCR during SELEX) of Heraptamer1 to Heraptamer7. Motifs with high homology were marked in the same colors (upper panel). (B) The sequences of these motifs. The heights of base letters is proportional to their frequencies among the DNA pool. 9
10 Figure S6. Cell viability of SKOV3 cells treated with Heraptamers in vitro for 2 days. Cell viability was assayed using an AlamarBlue assay according to manufacturer s instruction. 10
11 Figure S7. (A) The left photographs shows that Heraptamer2-Cy5 was able to detect HER2 ECD on a membrane transferred from a PAGE gel, in a way similar to a Western Blotting in which Heraptamer2 was used instead of an antibody; the right photograph shows that the HER2 ECD on the membrane was verified using anti-her2 antibody, by first stripping the membrane blotted by Heraptamer2 and then blotting with anti-her2 antibody. The signal from Heraptamer was weaker than that from antibody, likely due to fewer copies of dyes were conjugated on one aptamer molecule than that on one antibody molecule. HSA was used as a control, and demonstrated that Heraptamer2 did not bind to HSA. (B) Confocal microscopy images displaying that live SKOV3 cells were specifically stained by two Alexa488-modified Heraptamers. (DNA concentration: 200 nm; Hoechst33342: 1000 dilution) 11
12 Supplemental Tables Table S1. PCR conditions used for DNA preparation during SELEX. Temperature ( o C) Time (s) Cycle Hot start Denaturation n Annealing n Extension n Final Extension Table S2. Summary of HER2 protein-selex. Rounds HER2 input DNA input DNA yield from Negative selection (pmole) (pmole) PCR (pmole) No No Blank beads Blank beads and albumin Blank beads and albumin Blank beads and albumin Blank beads Blank beads 12
13 Table S3. Summary of HER2 Cell-SELEX using SKOV3 cells. About 1 x 10 6 cells, with 90% confluence, were used in each round of screening. Rounds DNA input (pmole) DNA yield from PCR (pmole) Negative selection Albumin Albumin Albumin Albumin Albumin Albumin Albumin Table S4. DNA sequences used for 2 nd gen high throughput sequencing. Colored sequences are primer regions. A-Primer 1 trp1-primer 2 Sequences (5'-3') CCATCTCATCCCTGCGTGTCTCCGACTCAG AGCGTCGAATACCACTAC CCTCTCTATGGGCAGTCGGTGAT CTAATGGAGCTCGTGGTC Table S5. Sequences of a panel of most frequent Heraptamer candidates. Heraptamers1 to Heraptamer7 were denoted in the order from the most to the least frequency. Colored sequences are primer regions. Names Heraptamer1 Heraptamer2 Heraptamer3 Heraptamer4 Heraptamer5 Heraptamer6 Heraptamer7 Sequences (5'-3') AGCGTCGAATACCACTACACACCACATCCGTCTTACTCCCCAATTACA AGCGTCGAATACCACTACTCCACCTTTCCGTCTAACTCCCCACTTTAT AGCGTCGAATACCACTACCCAACCTTTACCGTCAAACTCCCCACTTTT AGCGTCGAATACCACTACTAAGACGCAATTCGACCTTCTTCCCCATTC AGCGTCGAATACCACTACACTTACACCAACTCTATCATCTCCCTTATA AGCGTCGAATACCACTACTTACATCCCTACGAACAAGCGGACTGCAGA AGCGTCGAATACCACTACCCGCCATCCGTCAACGTCTTCCCACTATT 13
SANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationNote: for laboratory research use only. RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Signalway Biotechnology
Note: for laboratory research use only RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Cat. #: RP1202 (50preps) Signalway Biotechnology I. Kit Content, Storage Condition and Stability Content
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information Amplified Binding-Induced Homogeneous Assay through Catalytic
More informationEPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of
More informationSupporting Information
Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany RNA ligands that distinguish metabolite-induced conformations in the TPP riboswitch Günter Mayer, Marie-Sophie L. Raddatz, Julia D. Grunwald,
More informationDNA Visualizer Extraction Kit
DNA Visualizer Extraction Kit Catalog Number D0006 50 reactions Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...
More informationADVANCED ELECTROPHORESIS
Ref. ELECAVANZADA (4 practices) 1. EXPERIMENT OBJETIVE ADVANCED ELECTROPHORESIS The aim of this experiment is to introduce students to the knowledge of electrophoretic theory and to familiarize themselves
More informationphab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation
phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis 1 Outline 1. phab Dyes 2. Protocols for conjugating phab Dyes to antibodies 3. Applications:
More informationMyers Lab ChIP-seq Protocol v Modified January 10, 2014
Myers Lab ChIP-seq Protocol V011014 1 Contact information: Dr. Florencia Pauli Behn HudsonAlpha Institute for Biotechnology 601 Genome Way Huntsville, AL 35806 Telephone: 256-327-5229 Email: fpauli@hudsonalpha.org
More informationSupplementary information for. An Ultrasensitive Biosensor for DNA Detection Based on. Hybridization Chain Reaction Coupled with the Efficient
Supplementary information for An Ultrasensitive Biosensor for DNA Detection Based on Hybridization Chain Reaction Coupled with the Efficient Quenching of Ruthenium Complex to CdTe Quantum Dot Yufei Liu,
More informationAward Number: W81XWH TITLE: Direct inhibition of Skp2 for the Treatment of Advanced Prostate Cancer. PRINCIPAL INVESTIGATOR: Hyun-Suk Lim
AD Award Number: W81XWH-11-1-0286 TITLE: Direct inhibition of Skp2 for the Treatment of Advanced Prostate Cancer PRINCIPAL INVESTIGATOR: Hyun-Suk Lim CONTRACTING ORGANIZATION: Indiana University Indianapolis,
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationThe preparation of native chromatin from cultured human cells.
Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the
More informationPROTOCOL. Example Protocol for the Culture of the Breast Carcinoma MDA-MB-231 Cell Line on Alvetex Scaffold in Well Insert and Well Plate Formats
Page 1 Introduction MDA-MB-231 is a metastatic human breast cancer cell line originally isolated in the early 1970s[1]. MDA-MB-231 cells possess epithelial-like morphology and exhibit invasive properties
More informationSegments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationab Ran Activation Assay Kit
ab173247 Ran Activation Assay Kit Instructions for Use For the simple and fast measurement of Ran activation. This product is for research use only and is not intended for diagnostic use. Version 1 Last
More informationab G alpha i Activation Assay Kit
ab173234 G alpha i Activation Assay Kit Instructions for Use For the simple and fast measurement of G alpha i activation. This product is for research use only and is not intended for diagnostic use. Version
More informationAttention all MYbaits users: The following MYbaits protocol has been replaced with a newer version, which can be accessed from:
MYcroarray Attention all MYbaits users: The following MYbaits protocol has been replaced with a newer version, which can be accessed from: http://www.mycroarray.com/mybaits/manual s.html The following
More informationSUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells
SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationGeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual
GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationProcedure & Checklist - Preparing Asymmetric SMRTbell Templates
Procedure & Checklist - Preparing Asymmetric SMRTbell Templates Before You Begin In this procedure, PCR products are generated using two rounds of amplification. The first round uses target specific primers
More informationMirror-image polymerase chain reaction
Supplementary Information Mirror-image polymerase chain reaction Wenjun Jiang 1,4, Baochang Zhang 2,4, Chuyao Fan 1,4, Min Wang 1,4, Jiaxing Wang 2, Qiang Deng 1, Xianyu Liu 1, Ji Chen 1, Jishen Zheng
More informationHiPer Gel Extraction Teaching Kit (Column Based)
HiPer Gel Extraction Teaching Kit (Column Based) Product Code: HTBM010 Number of experiments that can be performed: 10 Duration of Experiment Agarose Gel Electrophoresis: 1 hour Protocol: 1 hour Agarose
More informationProduct Information. Before you begin. Component A 1 vial of 30 ul vial of 300 ul each Glycerol. Tris
Glowing Products for Science Mix-n-Stain Antibody Labeling Kits Size: 1 labeling per kit Storage: -20 o C Stability: Stable for at least 1 year from date of receipt when stored as recommended. Components:
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationAmpliScribe T 7 Aminoallyl-RNA Transcription Kit
Cat. No. AA50125 The AmpliScribe T7 Aminoallyl-RNA Transcription Kit enables high-yield production of aminoallyl-labeled RNA. The kit utilizes Epicentre s high yielding AmpliScribe T7-Flash in vitro transcription
More informationDescription...1 Components...1 Storage... 1 Technical Information...1 Protocol...2 Examples using the kit...4 Troubleshooting...
QuickClean II Gel Extraction Kit Cat. No. L00418 Technical Manual No. TM0594 Version: 03042011 I II III IV V VI VII VIII Description......1 Components.....1 Storage.... 1 Technical Information....1 Protocol.....2
More informationA nucleic acid-based fluorescent sensor for expeditious detection of pyrophosphate anions at nanomolar concentrations
Supporting Information for A nucleic acid-based fluorescent sensor for expeditious detection of pyrophosphate anions at nanomolar concentrations Xin Su, Chen Zhang, Xianjin Xiao, Anqin Xu, Zhendong Xu
More informationImmunoprecipitation Protocol
Immunoprecipitation Protocol Immunoprecipitation is a general method to obtain the enrichment of a specific protein from tissue lysate and cell lysate. It can be used to purify a specific protein, to identify
More informationAutomated genomic DNA purification of marine organisms on the epmotion 5075 VAC from Eppendorf
APPLICATION NOTE No. 281 I April 2013 Automated genomic DNA purification of marine organisms on the epmotion 5075 VAC from Eppendorf Cécile Ribout 1, Christophe Carpentieri 2 1 UMR IMBE, SCBM, Marseille,
More informationNanobody Library Selection by MACS
Nanobody Library Selection by MACS Introduction We have written the protocol below with the goal of making steps of in vitro nanobody selection as clear and broadly applicable as possible, but it is important
More informationEPIGENTEK. EpiQuik In Situ Histone H3-K27 Tri-Methylation Assay Kit. Base Catalog # P-3014T PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik In Situ Histone H3-K27 Tri-Methylation Assay Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik In Situ Histone H3-K27 Tri-Methylation Assay Kit is suitable for specifically
More informationWesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits
WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationMagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study
MagSi Beads Magnetic Silica Beads for Life Science and Biotechnology study MagnaMedics Diagnostics B.V. / Rev. 9.2 / 2012 Wide range of products for numerous applications MagnaMedics separation solutions
More informationInstructions. Fuse-It-siRNA. Shipping and Storage. Overview. Kit Contents. Specifications. Note: Important Guidelines
Membrane fusion is a highly efficient method for transfecting various molecules and particles into mammalian cells, even into sensitive and primary cells. The Fuse-It reagents are cargo-specific liposomal
More informationEZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK
EZ-0 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK (Bacteria, Plant, Animal, Blood) Version 8 Rev 05/0/03 EZ-0 Genomic DNA Kit Handbook Table of Contents Introduction Limitations of Use Features Applications
More informationRayBio Custom ELISA Kit
RayBio Custom ELISA Kit Catalog #: EL-PRELIM User Manual Last revised April 15, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100 Norcross, GA 30092
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationOptiblot ECL Ultra Detect Kit (1.2pg 2ng)
ab133409 Optiblot ECL Ultra Detect Kit (1.2pg 2ng) Instructions for Use For enhanced chemiluminescent Western blotting. This product is for research use only and is not intended for diagnostic use. 1 Table
More informationProcedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing
Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing Before You Begin This document describes methods for generating barcoded PCR products
More informationPresto Soil DNA Extraction Kit
Instruction Manual Ver. 02.23.17 For Research Use Only Presto Soil DNA Extraction Kit Advantages SLD004 (4 Preparation Sample Kit) SLD050 (50 Preparation Kit) SLD100 (100 Preparation Kit) Sample: 250-500
More informationOverview of Solulink Products. June 2011
Overview of Solulink Products June 2011 1 Who we are Established in 2003, Solulink develops, patents, manufactures, and sells consumables to over 1,000 customers in life science, diagnostic, and pharmaceutical
More informationFFPE DNA Extraction kit
FFPE DNA Extraction kit Instruction Manual FFPE DNA Extraction kit Cat. No. C20000030, Format 50 rxns Version 1 / 14.08.13 Content Introduction 4 Overview of FFPE DNA extraction workflow 4 Kit contents
More informationTIANgel Mini DNA Purification Kit
TIANgel Mini DNA Purification Kit For DNA purification from agarose and polyacrylamide gels www.tiangen.com/en DP130419 TIANgel Mini DNA Purification Kit Kit Contents (Spin column) Cat. no. DP208 Contents
More informationEdU Flow Cytometry Kit. User Manual
User Manual Ordering information: (for detailed kit content see Table 2) EdU Flow Cytometry Kits for 50 assays: Product number EdU Used fluorescent dye BCK-FC488-50 10 mg 6-FAM Azide BCK-FC555-50 10 mg
More informationDNA isolation from tissue DNA isolation from eukaryotic cells (max. 5 x 106 cells) DNA isolation from paraffin embedded tissue
INDEX KIT COMPONENTS 3 STORAGE AND STABILITY 3 BINDING CAPACITY 3 INTRODUCTION 3 IMPORTANT NOTES 4 EUROGOLD TISSUE DNA MINI KIT PROTOCOLS 5 A. DNA isolation from tissue 5 B. DNA isolation from eukaryotic
More informationProduct Name : Simple mirna Detection Kit
Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components
More informationRayBio Apoptotic DNA Ladder Extraction Kit
RayBio Apoptotic DNA Ladder Extraction Kit User Manual Version 1.1 March 1, 2016 RayBio Apoptotic DNA Ladder Extraction (Cat#: 68SO-DNAL-S50) RayBiotech, Inc. We Provide You With Excellent Support And
More informationStabilization of a virus-like particle and its application as a nanoreactor at physiological conditions
Supporting Information Stabilization of a virus-like particle and its application as a nanoreactor at physiological conditions Lise Schoonen, b Sjors Maassen, b Roeland J. M. Nolte b and Jan C. M. van
More informationHiPer Real-Time PCR Teaching Kit
HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from
More informationAcetyl-p53 (K381) Cell-Based Colorimetric ELISA Kit
Acetyl-p53 (K381) Cell-Based Colorimetric ELISA Kit Catalog No. KA8015C Detection and Quantification of Acetyl-p53 (K381) Protein Concentration in Cell. Research Purposes Only. Not Intended for Diagnostic
More informationFigure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9
Supplementary Information Ultrasensitive antibody detection by agglutination-pcr (ADAP) Cheng-ting Tsai 1 *, Peter V. Robinson 1 *, Carole A. Spencer 2 and Carolyn R. Bertozzi 3,4ǂ Department of 1 Chemistry,
More informationApoTrack Cytochrome c Apoptosis ICC Antibody
ab110417 ApoTrack Cytochrome c Apoptosis ICC Antibody Instructions for Use For the Immunocytochemistry analysis of cytochrome c and a mitochondrial marker (Complex Vα) in apoptotic cells and nonapoptotic
More informationE.Z.N.A. Tissue RNA Kit. R preps R preps
E.Z.N.A. Tissue RNA Kit R6688-00 5 preps R6688-01 50 preps May 2015 E.Z.N.A. Tissue RNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Important Notes...4 Homogenization
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationSupporting Information
Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany Rolling-circle Amplification of a DNA Nanojunction Chenxiang Lin, Mingyi Xie, Julian J.L. Chen, Yan Liu and Hao Yan A. RCA replication of the
More informationTIANamp Yeast DNA Kit
TIANamp Yeast DNA Kit For isolation of genomic DNA from yeast cells www.tiangen.com/en DP121221 TIANamp Yeast DNA Kit Kit Contents (Spin Column) Cat. no. DP307 Contents Buffer GA Buffer GB Buffer GD Buffer
More informationTECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70
GenElute mrna Miniprep Kit Catalog Numbers MRN 10, MRN 70 TECHNICAL BULLETIN Product Description The GenElute mrna Miniprep Kit provides a simple and convenient way to purify polyadenylated mrna from previously
More informationRayBio Human Caspase-3 ELISA Kit
RayBio Human Caspase-3 ELISA Kit Catalog #: ELH-CASP3 User Manual Last revised July 21, 2017 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100 Norcross,
More informationUse of Drosophila Melanogaster as a Model System in the Study of Human Sodium- Dependent Multivitamin Transporter. Michael Brinton BIOL 230W.
Use of Drosophila Melanogaster as a Model System in the Study of Human Sodium- Dependent Multivitamin Transporter Michael Brinton BIOL 230W.001 28 October 2013 TA: Sashi Gollapudi Introduction Many human
More informationPrepare CTAB solutions to extracting DNA from Plant
Prepare CTAB solutions to extracting DNA from Plant By Dr. Mona S. Alwahibi Botany and Microbiology Dep. Introduction The search for a more efficient means of extracting DNA of both higher quality and
More informationTechnical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
More informationNotes to accompany the slidecast on theory of SDS PAGE and Western blotting
S317 Biological science: from genes to species Notes to accompany the slidecast on theory of SDS PAGE and Western blotting SDS PAGE SDS PAGE is a standard technique for determining the molecular size of
More informationExecutive Summary. clinical supply services
clinical supply services case study Development and NDA-level validation of quantitative polymerase chain reaction (qpcr) procedure for detection and quantification of residual E.coli genomic DNA Executive
More informationThis Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
More informationE.Z.N.A. Water DNA Kit. D preps D preps D preps
E.Z.N.A. Water DNA Kit D5525-00 5 preps D5525-01 50 preps D5525-02 200 preps April 2017 E.Z.N.A. Water DNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing
More informationPolyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous
Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-(509-619) (GST-coiled
More informationTotal Histone H3 Acetylation Detection Fast Kit (Fluorometric)
Total Histone H3 Acetylation Detection Fast Kit (Fluorometric) Catalog Number KA1539 48 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use...
More informationSupporting Information
Electronic Supplementary Material (ESI) for Materials Chemistry Frontiers. This journal is the Partner Organisations 2017 Supporting Information Supramolecular Conjugated Polymer Materials for Organelle
More informationab Histone H3 Acetylation Assay Kit
ab115102 Histone H3 Acetylation Assay Kit Instructions for Use For the measurement of global histone H3 acetylation using a variety of mammalian cells This product is for research use only and is not intended
More informationGenepHlow Gel Extraction Kit
Instruction Manual Ver. 02.10.17 For Research Use Only GenepHlow Gel Extraction Kit DFG004 (4 Preparation Sample Kit) DFG100 (100 Preparation Kit) DFG300 (300 Preparation Kit) Advantages Convenient: includes
More informationTruSeq ChIP Sample Preparation
FOR RESEARCH USE ONLY Date: Illumina Kit Description: NOTE Unless familiar with the protocol in the latest version of the TruSeq ChIP Sample Preparation Guide (part # 15023092), new or less experienced
More informationPresto Stool DNA Extraction Kit
Instruction Manual Ver. 10.21.17 For Research Use Only Presto Stool DNA Extraction Kit Advantages STLD004 (4 Preparation Sample Kit) STLD050 (50 Preparation Kit) STLD100 (100 Preparation Kit) Sample: 180-200
More informationHuman DNA Alu Amplification by Polymerase Chain Reaction (PCR)* Laboratory Procedure
Human DNA Alu Amplification by Polymerase Chain Reaction (PCR)* Laboratory Procedure *Polymerase Chain Reaction is covered by patents owned by Hoffmann-La Roche, Inc. This experiment was adapted from Laboratory
More informationValidation of qpcr Rapid Bacterial Quantification through Viable E. coli cell count in the Saginaw Bay Watershed
Validation of qpcr Rapid Bacterial Quantification through Viable E. coli cell count in the Saginaw Bay Watershed TYLER LEFEVRE ADVISOR: DR. TAMI SIVY 1 Overview Introduction to fecal coliforms Current
More informationMagniSort Mouse CD3 Positive Selection Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.
Page 1 of 2 MagniSort Mouse CD3 Positive Selection Kit RUO: For Research Use Only. Not for use in diagnostic procedures. Mouse splenocytes were unsorted (left) or sorted with the MagniSort Mouse CD3 Positive
More informationRayBio Rat IL-6 ELISA Kit (For Lysates)
RayBio Rat IL-6 ELISA Kit (For Lysates) Catalog #: ELR-IL6-CL User Manual Last revised April 15, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100
More informationAssay of Cytokines in Tissue Culture Supernatants AfCS Procedure Protocol PP Version 1, 03/17/04
AfCS Procedure Protocol PP00000223 Version 1, 03/17/04 The Bio-Plex cytokine assay employs a liquid suspension array for quantification of cytokines in tissue culture supernatants or serum. Using this
More informationProtocol for DNA extraction from FFPE Samples
25, ave Georges Lemaître - B-6041 Gosselies (Belgique) Tel : +32 (0)71 37 85 27 - Fax : +32 (0)71 34 78 79 Protocol for DNA extraction from FFPE Samples Step 1. Paraffin Removal 1 Equilibrate a heat block
More informationE.Z.N.A. Bacterial RNA Kit. R preps R preps
E.Z.N.A. Bacterial RNA Kit R6950-00 5 preps R6950-01 50 preps July 2017 E.Z.N.A. Bacterial RNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Before Beginning...4
More informationGeNei TM Gel Extraction Teaching Kit Manual
Teaching Kit Manual Cat No. New Cat No. KT43 106279 KT43A 106300 KT43B 106301 Revision No.: 00280507 CONTENTS Page No. Objective 3 Principle 3 Kit Description 5 Materials Provided 7 Procedure 8 Observation
More informationTIANamp Marine Animals DNA Kit
TIANamp Marine Animals DNA Kit For isolation of genomic DNA from marine animal tissues www.tiangen.com/en DP121221 TIANamp Marine Animals DNA Kit (Spin Column) Cat. no. DP324 Kit Contents Contents DP324-02
More informationUnzipping Genes MB563 HiPurA TM PCR Product and Gel Purification Combo Kit
Unzipping Genes P r o d u c t MB563 HiPurA TM PCR Product and Gel Purification Combo Kit Kit Contents Product Code Reagents provided MB563 I n f o r m a t i o n 20 Preps 50 Preps 250 Preps DS0115 Combo
More informationab Optiblot Fluorescent Western Blot Kit
ab133410 Optiblot Fluorescent Western Blot Kit Instructions for Use For quantitative, multi-color fluorescent Western blotting. This product is for research use only and is not intended for diagnostic
More informationImmunoaffinity Chromatography
PR120 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Immunoaffinity Chromatography Teacher s Guidebook (Cat. # BE 507) think proteins! think
More informationCytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358
CytoGLOW IKK-α/β Colorimetric Cell-Based ELISA Kit Catalog #: CB5358 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only.
More informationEnzymatic assembly of DNA molecules up to several hundred kilobases
nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures
More informationCloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau Page 1 of 5 (Modified from Solexa sequencing protocol from Bartel lab)
Cloning small RNAs for Solexa Sequencing version 2.0 by Nelson Lau 09162008 Page 1 of 5 General Cloning Protocol: Gel-purification 1. Pour 1mm thick, urea denaturing 10% or 15% polyacrylamide gels, with
More informationab Histone H4 Acetylation Assay Kit
ab115103 Histone H4 Acetylation Assay Kit Instructions for Use For the measurement of global histone H4 acetylation using a variety of mammalian cells, including Tissue, adherent and suspension cells This
More informationINOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807
INOS Colorimetric Cell-Based ELISA Kit Catalog #: OKAG00807 Please read the provided manual entirely prior to use as suggested experimental protocols may have changed. Research Purposes Only. Not Intended
More informationAbsolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions
Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect
More informationFisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further. (Promega) and DpnI (New England Biolabs, Beverly, MA).
175 Appendix III Chapter 4 Methods General. Unless otherwise noted, reagents were purchased from the commercial suppliers Fisher (Fairlawn, NJ) and Sigma-Aldrich (St. Louis, MO) and were used without further
More informationQuantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract
Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used
More information