Supplementary Materials for. Combinatory screening of DNA aptamers for molecular imaging of HER2 in cancer

Transcription

1 Supplementary Materials for Combinatory screening of DNA aptamers for molecular imaging of HER2 in cancer Guizhi Zhu, Huimin Zhang,, Orit Jacobson, Zhantong Wang, Haojun Chen,, Xiangyu Yang, ǁ, Gang Niu, and Xiaoyuan Chen,* Laboratory of Molecular Imaging and Nanomedicine, National Institute of Biomedical Imaging and Bioengineering (NIBIB), National Institutes of Health (NIH), Bethesda, Maryland (MD), United States (USA) Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen , P. R. China Department of Nuclear Medicine, Xiamen Cancer Center, The First Affliated Hospital of Xiamen University, Xiamen, China, ǁ Jiangsu Key Laboratory of Molecular Imaging and Functional Imaging, Department of Radiology, Zhongda Hospital, Medical School of Southeast University, Nanjing , China * Corresponding Author: Dr. Xiaoyuan Chen Building 35A Rm GD937, 35A Convent Dr., Bethesda, MD Telephone: shawn.chen@nih.gov 1

2 1. Supplemental Methods DNA synthesis Cell lines and cell culture Cell-SELEX Table of Contents Deep sequencing and bioinformatics analysis Aptamer binding test by flow cytometry Cell staining using aptamers Tumor Model Statistical Analysis 2. Supplemental Figures Figure S1. An image of western blotting verifying HER2 ECD using a native PAGE gel. Figure S2. Schematic work flow in a round of SELEX and a representative image of agarose gel electrophoresis result showing the optimization of PCR cycles. Figure S3. Flow cytometry results showing that HER2 was overexpressed on SKOV3 cells, but not on MDA-MB-231 cells. Figure S4. Sequencing the final screening pool by Ion-Torrent 2 nd generation sequencing. Figure S5. Sequence analysis of the most frequent 7 sequence families. Figure S6. Cell viability of SKOV3 cells treated with Heraptamers in vitro for 2 days. Figure S7. Binding of Heraptamer to HER2 ECD and SKOV3 cell in vitro. 3. Supplemental Tables Table S1. PCR conditions used for DNA preparation during SELEX. Table S2. Summary of HER2 protein-selex. Table S3. Summary of HER2 Cell-SELEX using SKOV3 cells. Table S4. DNA sequences used for 2 nd -gen high throughput sequencing. Table S5. Sequences of a panel of most frequent Heraptamer candidates. 2

3 Supplemental Methods DNA synthesis DNA was synthesized as previously described (25), except library DNA and DNA modified with alkyne DNA which were purchased from IDT (Coralville, IA). Cell lines and cell culture SKOV3, MDA-MB-231, MDA-MB-435, and MCF7 cells were purchased from ATCC. SKOV3 cells were cultured in MyCoy s 5A cell culture medium, MDA-MB-231 and MDA-MB-435 in Leibovitz's L-15 medium, and MCF7 in EMEM medium. Cells were grown in a humidified atmosphere (5% CO 2, 37 C). Cell-SELEX SKOV3, which overexpress HER2, was used for cell-selex. Cells were digested to be single cells and seeded into petri dish one day before use for screening. 90% confluent cells were used for screening. One 75-mm petri dish of cells, equivalent to about 1 million cells, was used for each round of screening. For positive screening, cells were washed for 3 times using cell binding buffer (PBS supplemented with 5 mm Mg 2+ and 5g/L glucose). Snap-cooled DNA was diluted into 2 ml cell binding buffer and added into one petri dish. Cells were incubated with DNA on ice, with gentle shaking, for 1 h. Then, cells were washed with cell binding buffer for 3 times to remove unbound DNA. Cell-DNA complexes were scraped off on ice, heated at 95 C immediately for 5 min, and then centrifuged at rpm for 5 min to remove debris and collect supernatant. The supernatant was desalted, cryo-concentrated to reduce volume to be under 300 µl. The resultant product was then PCR amplified, as performed for protein-selex. Negative screening was performed by adding HSA (1 mg/ml) into the mixture of DNA and cells to allow remove DNA bound to HSA by washing. Deep sequencing and bioinformatics analysis The final screening pool was subject to deep sequencing using Ion Torrent 2 nd generation high throughput sequencing. A pair of primers (see sequences in Figure 1C) integrated with the primers used for screening and the adaptors for sequencing were designed. The PCR conditions using this pair of primers were again optimized in PCR temperature and time. Using optimized PCR conditions, preparative PCR of the DNA pool was conducted. PCR products were analyzed by agarose gel electrophoresis in a 20-cm gel to allow separation of the target PCR products from byproducts. The gel was stained using Ethedium Bromide and visualized under UV exposure. The target band (with size about 123 bp) was cut out, collected and dissolved in buffer. The DNA was extracted using a DNA extraction kit (Valencia, CA). Extracted DNA was sequenced in the 3

4 Nextgen DNA Sequencing Laboratory of Interdisciplinary Center for Biotechnology Research at the University of Florida. Bioinformatics analysis of the sequencing results were conducted to get the most frequent reads. First, using Galaxy ( sequences were filtered by length to remove any remnant PCR byproducts. Sequences were then collapsed to merge, converge and count the same sequences. Sequences were then arranged by order of frequence, and the most frequent sequences were picked for downstream validation. Sequence homology was analyzed using online software MEME The structures of aptamer candidates were simulated using online software NUPACK. Aptamer binding test by flow cytometry The binding of aptamers or aptamer candidates were tested using HER2-ECD-coupled beads and a panel of cells. To test binding with HER2-coupled beads, biotinylated DNA (200 nm) was incubated with HER2-ECD-coupled beads in protein screening buffer for 30 min at room temperature. Beads were then washed for 2 times to remove unbound DNA. Streptavidin-PE-Cy5.5 was then added into the solution, followed by 20 min of further incubation and washing again for 3 times. The resultant beads were then analyzed by flow cytometry to determine the fluorescence intensity. To test binding with cells, cells were digested to single cells and seeded one day before use. Before use for cell binding test, cells were washed using PBS for 3 times, and cells were dissociated using non-enzymatic dissociation buffer to prepare single dissociated cells while keeping cell membrane proteins intact. Cells were washed and quantified. Cells (0.2 x 10 6 /sample) were suspended into cell binding buffer, and DNA labeled with FITC or Cy5 or Biotin (200 nm) was added into cell suspension, followed by incubation on ice (unless denoted otherwise) for 30 min and then washing for 3 times. If biotinylated DNA was used, Streptavidin- PE-Cy5.5 was then added into the solution, followed by 20 min of further incubation and washing again for 3 times. The resultant cells were then analyzed by flow cytometry to determine fluorescence intensity. Cell staining using aptamers Cells were digested and seeded into cell culture chambers one day before use. Before staining with aptamers, cells were washed for 3 times. Cells were then immersed in cell binding buffer, Alexa488-labeled aptamers (200 nm) and Hoechst33342 (1000x dilution; Invitrogen, Carlsbad, CA) were added into cell binding buffer and incubated with cells for 30 min on ice. Afterwards, cells were washed for 3 times and immersed in cell binding buffer again, followed by immediate confocal microscopy observation. Tumor Model HER2-positive SKOV3 tumor model was used for molecular imaging of HER2. Nude mice were subcutaneously inoculated with 5 x 10 6 SKOV3 cells/mouse on the right shoulder. The tumor 4

5 growth was monitored by caliper measurement for 4 weeks, until when the tumor sizes reached about 500 mm 3 and mice were used for PET imaging. Statistical Analysis Data represent mean ± standard deviation (SD). Statistical analysis was conducted using Student s t test for unpaired data. P values < 0.05 were considered significant. 5

6 Supplemental Figures Figure S1. An image of western blotting verifying HER2 ECD using a native PAGE gel. The upper band is likely a dimer of HER2 ECD. Alexa488-labeled 2 nd Ab was used. Figure S2. (A) Schematic work flow in a round of SELEX. (B) A representative image of agarose gel electrophoresis result showing the optimization of PCR cycles in each round of SELEX. PCR products with the optimal cycles produce the fewest byproducts within the most cycles. 6

7 Figure S3. Flow cytometry results showing that HER2 was overexpressed on SKOV3 cells, but not on MDA-MB-231 cells. Live cells were stained with anti-her2 antibody (trastuzumab) conjugated with Cy5 using NHS-Cy5. 7

8 Figure S4. Sequencing the final screening pool by Ion-Torrent 2 nd generation sequencing. (A) An agarose gel electrophoresis image showing the DNA products from PCR amplification of the final screening pool, using a pair of primers integrated with sequencing-dedicated adaptors. The 8

9 gel band of amplified products was cut, dissolved, and filtrated to extract and purify PCR DNA products. (B, C) Electrophoregraphs showing the size analysis of DNA markers (C) and purified DNA pools from the above gel (B). The band corresponding to the size of 35 bp is likely primer dimers. (D) A graph showing the size profile of the sequenced DNA in the final screening pool. The majority of DNAs have 66 bp (excluding the adaptor primer used for sequencing), which is consistent with the library design. Figure S5. Sequence analysis of the most frequent 7 sequence families: Heraptamer1 to Heraptamer7. (A) Alignment of the variable regions (excluding the two primer regions used for PCR during SELEX) of Heraptamer1 to Heraptamer7. Motifs with high homology were marked in the same colors (upper panel). (B) The sequences of these motifs. The heights of base letters is proportional to their frequencies among the DNA pool. 9

10 Figure S6. Cell viability of SKOV3 cells treated with Heraptamers in vitro for 2 days. Cell viability was assayed using an AlamarBlue assay according to manufacturer s instruction. 10

11 Figure S7. (A) The left photographs shows that Heraptamer2-Cy5 was able to detect HER2 ECD on a membrane transferred from a PAGE gel, in a way similar to a Western Blotting in which Heraptamer2 was used instead of an antibody; the right photograph shows that the HER2 ECD on the membrane was verified using anti-her2 antibody, by first stripping the membrane blotted by Heraptamer2 and then blotting with anti-her2 antibody. The signal from Heraptamer was weaker than that from antibody, likely due to fewer copies of dyes were conjugated on one aptamer molecule than that on one antibody molecule. HSA was used as a control, and demonstrated that Heraptamer2 did not bind to HSA. (B) Confocal microscopy images displaying that live SKOV3 cells were specifically stained by two Alexa488-modified Heraptamers. (DNA concentration: 200 nm; Hoechst33342: 1000 dilution) 11

12 Supplemental Tables Table S1. PCR conditions used for DNA preparation during SELEX. Temperature ( o C) Time (s) Cycle Hot start Denaturation n Annealing n Extension n Final Extension Table S2. Summary of HER2 protein-selex. Rounds HER2 input DNA input DNA yield from Negative selection (pmole) (pmole) PCR (pmole) No No Blank beads Blank beads and albumin Blank beads and albumin Blank beads and albumin Blank beads Blank beads 12

13 Table S3. Summary of HER2 Cell-SELEX using SKOV3 cells. About 1 x 10 6 cells, with 90% confluence, were used in each round of screening. Rounds DNA input (pmole) DNA yield from PCR (pmole) Negative selection Albumin Albumin Albumin Albumin Albumin Albumin Albumin Table S4. DNA sequences used for 2 nd gen high throughput sequencing. Colored sequences are primer regions. A-Primer 1 trp1-primer 2 Sequences (5'-3') CCATCTCATCCCTGCGTGTCTCCGACTCAG AGCGTCGAATACCACTAC CCTCTCTATGGGCAGTCGGTGAT CTAATGGAGCTCGTGGTC Table S5. Sequences of a panel of most frequent Heraptamer candidates. Heraptamers1 to Heraptamer7 were denoted in the order from the most to the least frequency. Colored sequences are primer regions. Names Heraptamer1 Heraptamer2 Heraptamer3 Heraptamer4 Heraptamer5 Heraptamer6 Heraptamer7 Sequences (5'-3') AGCGTCGAATACCACTACACACCACATCCGTCTTACTCCCCAATTACA AGCGTCGAATACCACTACTCCACCTTTCCGTCTAACTCCCCACTTTAT AGCGTCGAATACCACTACCCAACCTTTACCGTCAAACTCCCCACTTTT AGCGTCGAATACCACTACTAAGACGCAATTCGACCTTCTTCCCCATTC AGCGTCGAATACCACTACACTTACACCAACTCTATCATCTCCCTTATA AGCGTCGAATACCACTACTTACATCCCTACGAACAAGCGGACTGCAGA AGCGTCGAATACCACTACCCGCCATCCGTCAACGTCTTCCCACTATT 13