A Comparison of Agarose, Metaphor Agarose, and Polyacrylamide Gel Electrophoresis Systems in Resolving Pawpaw Simple Sequence Repeat Markers

Transcription

1 A Comparison of Agarose, Metaphor Agarose, and Polyacrylamide Gel Electrophoresis Systems in Resolving Pawpaw Simple Sequence Repeat Markers Lauren Collins, Jeremiah D. Lowe, and Kirk W. Pomper Land Grant Program, Kentucky State University, Atwood Research Facility, Frankfort, KY 40601

2 What is Pawpaw? Asimina triloba (L.) Dunal Fruit has tropical-like like flavor Blend of pineapple-mango mango- banana, melon High nutritional value high in many vitamins, minerals, and amino acids Potential new crop for farmers in Kentucky

3 The Native Range of Pawpaw Grows wild in 26 states It is well adapted to the Southeastern United States

4 Pawpaws in the Wild Usually found in the understory in hardwood forests May not produce many fruit shade lack of pollinators cross-pollination Asexual reproduction by root suckering

5 Improving Pawpaw Cultivars There are about 45 named pawpaw cultivars (e.g., Overleese )) that have been selected in the wild or are the result of breeding efforts. Improvements in fruit quality, size, appearance, etc., in future cultivars would be desirable. Linking traits to molecular markers

6 Research at Kentucky State U. KSU research efforts involve developing pawpaw as a commercial crop for limited- resource farmers The USDA National Clonal Germplasm Repository for Asimina species is also located at KSU. Assessment of genetic diversity Evaluation and improvement of germplasm repository

7 PCR Polymerase Chain Reaction Amplifies DNA Applications Include Molecular Markers for: Species identification Parentage determination Determination of genetic diversity and genetic identification

8 Polymerase Chain Reaction

9 Microsatellite Marker System Simple sequence repeats (SSR) (Litt and Luty, 1989; Tautz, 1989) 1-44 nucleotide repetitions [e.g. (GT) n or (GATA) n ] Primers made for flanking sequence Number of repetitions changes product size Visualized as different sized bands on gel Type of gel electrophoresis system can alter band separation, but by how much?

10 Gel Electrophoresis Prepare the agarose gel with wells and fill them with DNA and dye solution.

11 Gel Electrophoresis

12 Gel Electrophoresis

13 Types of Gel Electrophoresis Agarose ( bp DNA) Metaphor Agarose (20 to 800 bp DNA) Cambrex Co. states it challenges polyacrylamide in separation power Approximate resolution of polycrylamide gels (4% to 8%). Polyacrylamide Gel Electrophoresis (20 to 800 bp DNA)

14 Objective: To determine if SSR-PCR products separated on agarose, metaphor agarose, and polyacrylamide gel electrophoresis systems display unique scoring patterns in nine pawpaw cultivars.

15 Methods and Materials Leaves were collected from the pawpaw cultivars: Cales Creek Rebecca s Davis Gold Taytwo Middletown Wilson NC-1 Zimmerman Overleese

16 DNA Extraction DNA was extracted from young leaf tissue using a DNAMITE Plant Kit (the Gel Co., San Francisco, CA) Concentration determined with a spectrophotometer Diluted to 1ng/μl Stored 4 C4

17 PCR Conditions 1X PCR buffer 0.02 mmol dntp s 5.0 µmol/ mol/µl l primer 0.01 U/µl l Taq polymerase 1.5 mmol MgCl ng/µl l DNA template 10.8 µl l H 2 0

18 Primers C104 Forward: TTTAGCTGACCCCACATAGG Reverse: CAGGAGCCTTACAGGATCAG B129 Forward: ACACCAGCCATGATTATGATTC Reverse: TCCTTCTCACTCCATCAACAAC Primers were developed by Genetic Information Services (Chatsworth, CA)

19 PCR Program 35 cycles 94 C 94 C 3 min 40 sec 55 C 40 sec 72 C 72 C 30 sec 4 min 4 C

20 Methods PCR products were run on: 3% agarose (4 60V) 3% metaphor agarose (6 60V) 5% polyacrylamide TBE precast gel (50 125V) Stained with ethidium bromide Visualized on a UV transilluminator and photographed Molecular weights were calculated using Kodak 1D software

21 Results Primer B129 Gel Rep 1 Primer B129 Gel Rep 2 3% Agarose 3% Metaphor-Agarose Primer B129 Gel Rep 1 Primer B129 Gel Rep 2 Cales Creek Cales Creek Davis Middletown NC-1 Overleese Rebeccas Gold Taytwo Wilson Zimmerman Davis Middletown NC-1 Overleese Rebeccas Gold Taytwo Wilson Zimmerman

22 Results 5% polyacrylamide TBE precast gel 5% polyacrylamide TBE precast gel Cales Creek Davis Middletown NC-1 Overleese Rebeccas Gold Taytwo Wilson Zimmerman 215 to 240 bp (non denaturing) 160 to 200 bp

23 Results 3% Agarose 3% Metaphor- Agarose 5% polyacrylamide TBE precast gel Cales Creek Davis Middletown NC-1 Overleese Rebeccas Gold Taytwo Wilson Zimmerman Cales Creek Davis Middletown NC-1 Overleese Rebeccas Gold Taytwo Wilson Zimmerman Cales Creek Davis Middletown NC-1 Overleese Rebeccas Gold Taytwo Wilson Zimmerman

24 Discussion The SSR-PCR markers were separated on the 3% agarose, 3% metaphor agarose, 5% polyacrylamide gels for the pawpaw varieties examined. Markers were not as clear on the agarose gels compared to the metaphor-agarose agarose gels. Many additional DNA markers were revealed on the 5% % polyacrylamide gel compared to either agarose gel systems. The 5% polyacrylamide gel system should yield more markers for identification of pawpaw cultivars and provide better estimates of genetic diversity.

25 Conclusions SSR-PCR markers from pawpaw cultivars can be best separated on polyacrylamide gel electrophoresis systems. Despite claims by the manufacturer, the metaphor-agarose agarose gel did not separate markers as well as a polyacrylamide gel.

26 Acknowledgements Dr. Harold Benson Dr. Kirk Pomper Mr. Jeremy Lowe Ms. Sheri Crabtree

27

28 Results 4% polyacrylamide TBE precast gel (denaturing)