Supporting Information

Transcription

1 Supporting Information Rational Design of a Polymer with Robust Efficacy for Intracellular Protein and Peptide Delivery Hong Chang 1,, Jia Lv 1,, Xin Gao 2, Xing Wang 1, Hui Wang 1, Hui Chen 1, Xu He 1, Lei Li 1, Yiyun Cheng 1, * 1 Shanghai Key Laboratory of Regulatory Biology, School of Life Sciences, East China Normal University, Shanghai , P. R. China. 2 Department of Orthopedic Oncology, Changzheng Hospital, the Second Military Medical University, Shanghai, , P.R. China. These authors contributed equally on this manuscript. *Correspondence should be addressed to Yiyun Cheng. yycheng@mail.ustc.edu.cn 1

2 Experimental section Materials. Ethylenediamine-cored generation 5 polyamidoamine dendrimer was purchased from Dendritech (Midland, MI). GBA, BA, 1H-pyrazole-1-carboxamidine hydrochloride, N-Boc-4-aminobenzoic acid, dicyclohexylcarbodiimide (DCC), N-hydroxysuccinimide (NHS), trifluoroacetic acid (TFA), BSA and saporin were purchased from Sigma-Aldrich (St. Louis, MO). GFP was purchased from Abcam (Shanghai, China). Triethylamine (TEA), anhydrous N, N-dimethyl formamide (DMF) and dimethyl sulfoxide (DMSO) were purchased from Sinopharm Chemical Reagent Co., Ltd (Shanghai, China). N,N-diisopropylethylamine (DIEA) was purchased from Aladdin (Shanghai, China). PULSin TM was purchased from Polyplus (France). R-PE and β-gal were purchased from J&K Chemical (Shanghai, China). In situ β-galactosidase staining kit and β-galactosidase assay kit were purchased from Beyotime (Shanghai, China). P1 (CWMSPRHLGTC) and P2 (AVPIAQK) labeled with FITC were obtained from Top-peptide Biotechnology Co. Ltd. (Shanghai, China). FITC Annexin V Apoptosis Detection Kit I was purchased from BD Biosciences (Shanghai, China). All the compounds were used as received without further purification. Synthesis and Characterization of Surface-engineered Dendrimers. GBA (0.132 mmol), DCC (0.171 mmol) and NHS (0.158 mmol) were dissolved in 2 ml DMF. The solution was stirred at room temperature for 6 h. After that, TEA (0.198 mmol) and polyamidoamine dendrimer (1.735 µmol) dissolved in 2 ml DMSO were added. The mixture was further stirred at room temperature for 7 d and followed by extensive dialysis against DMSO and distilled water and freeze-dried as white powders. BA-modified dendrimer was synthesized by the same procedure. The molar ratio of BA and dendrimer is 64. The purified products were characterized by 1 H NMR in D 2 O and DMSO-d6, respectively (Varian MHz). For guanidyl-modified dendrimer, polyamidoamine dendrimer (1.04 µmol) dissolved in 2 ml distilled water was added dropwise into 1H-pyrazole-1-carboxamidine hydrochloride (0.126 mmol) and DIEA (0.126 mmol) aqueous solution (1 ml). The mixture was stirred at room temperature for 24 h and extensively dialyzed against distilled water. After 2

3 lyophilization, the number of residual primary amine groups on the product was characterized by a well-established ninhydrin assay. 1 For 4-aminobenzoic acid (ABA)-modified dendrimer, N-Boc-4-aminobenzoic acid (0.104 mmol), DCC (0.135 mmol) and NHS (0.125 mmol) were dissolved in 2 ml DMF. The solution was stirred at room temperature for 6 h. After that, polyamidoamine dendrimer (1.041 µmol) and TEA (0.156 mmol) dissolved in 2 ml DMSO were added. The mixture was further stirred at room temperature for 7 d and followed by extensive dialysis against DMSO for twice and freeze-dried, the obtained solid was dissolved in 2 ml TFA and stirred at room temperature for 6 h to remove the Boc groups. Then, TFA was removed by rotary evaporation and the crude materials were intensively dialyzed against DMSO, PBS buffer and distilled water. The purified product was freeze-dried and characterized by 1 H NMR in DMSO-d6. Preparation and Characterization of the Polymer/protein Complexes. The polymers were mixed with BSA at optimal weight ratios in protein transfection, followed by the addition of 100 µl serum-free medium. After incubation at room temperature for 20 min, the solutions were diluted by addition of 900 µl serum-free medium. TEM images of the polymer/protein complexes were collected using a transmission electron microscope (HT7700, HITACHI, Japan). Size of the complexes was measured using dynamic light scattering (Malvern Zetasizer 3000). The complexes were also analyzed by native polyacrylamide gel electrophoresis (Native-PAGE, 7% PAGE gel), circular dichroism (CD) spectroscopy (J-815, Jasco International), and fluorescence resonance energy transfer (FRET). 1 H NMR spectra of DGBA60/AVPIAQK (P2 in the manuscript, the weight ratio of DGBA60 to AVPIAQK is 0.5:1) complexes at different temperatures were measured to prove the role of hydrogen bond in the complex formation. Cell Culture and Intracellular Protein Delivery. HeLa cells (a human cervical carcinoma cell line, ATCC), NIH3T3 cells (a mouse embryo fibroblast cell line, ATCC) and Raw264.7 cells (a mouse leukemic monocyte macrophage cell line, ATCC) were cultured in DMEM containing 10% FBS, 100 µg/ml streptomycin, and 100 µg/ml penicillin at 37 C under a humidified atmosphere containing 5% CO 2. PC-9 3

4 cells (a non-small cell lung cancer cell line, ATCC) were cultured in 1640 medium with 10% FBS, 100 µg/ml streptomycin, and 100 µg/ml penicillin at 37 C under a humidified atmosphere containing 5% CO 2. The cells were cultured in 24-well plates overnight before protein delivery, and then incubated with the polymer/protein complexes at different weight ratios. After 4 h, the transfected cells were observed by a fluorescent microscopy (Olympus, Japan) and quantitatively measured by flow cytometry (BD FACSCalibur, San Jose). The commercial transfection reagent PULSin was served as a positive control and used according to the manufacturers protocols. Intracellular Trafficking of the Polymer/Protein Complexes. The localizations of polymer/protein complexes in HeLa cells were observed by a laser scanning confocal microscopy (Leica SP5, Germany). The cells were incubated with the polymer/bsa-fitc complexes for 1, 2, and 4 h, respectively. The acidic compartments and the nuclei of the cells were stained by LysoTracker Red (DND-99, Invitrogen) and Hoechst (Beyotime), respectively. Synthesis and Characterization of BSA-Pt. In a typical synthesis of BSA-Pt, BSA (1 mg) was dispersed in 10 ml phosphate-buffered saline (PBS, ph = 7.5), and 0.63 ml H 2 PtCl 6 (38.6 mm) was added to the solution. The mix was magnetically stirred at dark for 30 min. After that, 0.16 ml NaBH 4 (0.1 M) was added in the reaction solution to reduce H 2 PtCl 6. 2 h later, the reaction solution was transferred into a dialysis bag (Biosharp, molecular weight cut off = 3500 Da), and then was dialyzed against deionized (DI) water for 10 times. The BSA concentration in the product was determined by a ninhydrin assay. Cell Viability Assay. The viabilities of cells treated with polymers, polymer/protein or polymer/peptide complexes were measured by a well-established 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. Generally, HeLa cells were seeded in 96-well plates with a density of cells per well one day before the experiment. The cells were incubated with 200 µl polymers or complexes solutions at concentrations equal to those used in transfection experiments for 4 h and then replaced with 100 µl serum-containing medium (10% FBS). The 4

5 cells were further cultured for 20 h before tested. For DGBA and DGBA/BSA, the DGBA dose was 1.6 µg, and the BSA dose was 0.4 µg in each well; For DGBA60/P1 and DGBA60/P2 complexes, the DGBA dose was 1.6 µg, and the peptide dose was 2 µg in each well. Cells without treatment were used as a control. A standard MTT assay was used to determine the cell viability. Five repeats were conducted for each sample and the data were analyzed by Student s t-test. β-gal Staining and Activity Assay. The intracellular β-gal delivery efficacy was tested by an in situ β-galactosidase staining kit according to the manufacturers protocol. Generally, HeLa cells in 24-well plate were washed three times with PBS and fixed with 4% paraformaldehyde for 15 min at room temperature. Then the cells were incubated overnight at 37 C in darkness with the working solution containing 0.05 mg/ml 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal). The activities of β-gal in the transfected cells were determined using a β-galactosidase assay kit. Generally, HeLa cells in 24-well plate were lysed with 200 µl Reporter Lysis Buffer for 1 h at room temperature. Then 25 µl clear supernatant extract and 25 µl working solution containing O-nitrophenyl-β-D-galactopyranoside were added in 96-well plate and incubated at 37 C for 1 h. After that, 150 µl Na 2 CO 3 solution (1 M) was added to stop the reaction. The optical density of the reaction solution was immediately measured at 420 nm. The relative β-gal activity was obtained by normalizing to a free β-gal solution. Purification of p53. Gene fragment encoding p53 was amplified and cloned into ppal7 vector (Bio-Rad) at the HindIII and XhoI restriction sites (Primers as following: Forward primer: CCCAAGCTTTGATGGAGGAGCCGCAGTC; Reverse primer: CCGCTCGAGTCAGTCTGAGTCAGGCCCTT). Plasmids were transformed into Escherichia coli BL21 (DE3) after sequencing to confirm the veracity of the cloned DNA. The bacteria were cultured in LB medium at 37 C and gene expression was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG) at a final concentration of 0.5 mm. After that, the p53 protein was purified by a Bio-Rad protein purification system. Western Blot Analysis. HeLa cells were seeded in 24-well plates and incubated 5

6 overnight before transfection. Then the cells were treated with DGBA60, p53, DGBA60/p53 complexes for 4 h and the incubation media were then replaced by fresh medium containing 10% FBS and further cultured for 20 h. The doses of DGBA60 and p53 were 8 µg and 2 µg, respectively. Transfected HeLa cells were washed twice with cold PBS and lysed in the buffer (50 mm Tris-HCl, ph 7.4, 1.0 mm EDTA, 150 mm NaCl, 0.1% SDS, 1% Triton X-100, and 1% sodium deoxycholate). The cell lysates were separated on 10% SDS-PAGE gels and transferred onto a nitrocellulose membrane. Then the proteins were immunoblotted with primary antibodies (p21, p53 and actin) overnight at 4 C. After incubation with a fluorescent-labeled secondary antibody (1:5000 dilutions), specific signals for the proteins were visualized by a LI-COR Odyssey Infrared Imaging System. Cell Apoptosis Assay. The cell apoptosis was tested by a FITC Annexin V Apoptosis Detection Kit I according to the manufacturers protocol. To determine the cell apoptosis caused by p53 transfection, the transfected cells (the same condition as described in the western blot assay) were re-suspended in FITC binding buffer and stained by FITC Annexin V and propidium iodide (PI) (BD Biosciences, Shanghai) for 15 min in the dark at room temperature. The treated cells in each well were quantitatively analyzed by a flow cytometry (BD FACSCalibur, San Jose). In Vivo Saporin Delivery and Anti-tumor Efficacy. 4-week-old male BALB/c nude mice with average body weight of 20 g were purchased from SLAC Laboratory Animal Co. Ltd. (Shanghai, China). The animal experiments were performed according to the NIH guidelines for the care and use of experimental animals and were approved by the ethics committee of East China Normal University. BALB/c bearing PC-9 tumors were developed according to a previous report. 2 Briefly, PC-9 cells (~10 6 cells, 20 ul) in PBS were injected into the right back of BALB/c mice. Mice bearing PC-9 tumors reached a size of 100 mm 3 were sorted into four groups randomly (five mice in each group). The mice were treated with 30 µl PBS, saporin, DGBA60, or DGBA60/saporin complex solution, respectively via intratumoral injection twice at the first and fourth day. The doses of saporin and polymer are 310 µg/kg and 4.5 mg/kg, respectively. The tumor size and body weight of the mice were 6

7 recorded every day, and the mice were sacrificed at the ninth day. The data were analyzed by student s t-test. Figure S1. Synthesis of DGBA60, DBA60 and DG60. 7

8 Figure S2. 1 H NMR spectrum of DGBA60 (A) and DBA60 (B) in D 2 O and DMSO-d6, respectively. 8

9 Figure S3. Native-PAGE analysis of polymer/bsa complexes (A). CD spectra of polymer/bsa complexes (B). Fluorescence spectra of BSA-FITC and DGBA60-RBITC/BSA-FITC complexes (C). 9

10 Figure S4. 1 H NMR spectra of DGBA60, peptide and DGBA60/peptide complex in D 2 O at 25 o C (A). 1 H NMR spectra of the DGBA60/peptide complex in D 2 O at 25, 45 and 65 o C, respectively (B). The weight ratio of DGBA60 to peptide in the complex is 0.5:1. Note: The role of hydrogen bond in the binding of proteins to DGBA60 is proved by 1 H NMR (Figure S4). Since the protein structure is complicated and its NMR spectrum has poor resolution, a peptide (AVPIAQK) was used as the model protein. The addition of AVPIAQK into DGBA60 caused the downfield shift of aromatic proton peaks on guanidinobenzoic acid in DGBA60 and the broadening of proton peaks in the peptide, which suggests the binding of peptide to DGBA60. At higher temperatures, the peaks of peptide in the complex are gradually recovered. This phenomenon can be explained by the breakage of hydrogen bonds at high temperatures, which causes the dis-assembly of DGBA60/peptide complex. These results proved the role of hydrogen bond interactions in the binding of AVPIAQK to the polymeric vector DGBA60. 10

11 Figure S5. Zeta-potential analysis of the polymer/bsa complexes. The concentration of the polymer was mg/ml and the concentration of BSA was mg/ml. 11

12 Figure S6. Confocal images of HeLa cells treated with DGBA60/BSA-FITC or DG60/BSA-FITC complexes (green) for 1 h, 2 h and 4 h, respectively. The nuclei were stained with Hoechst (blue) and the acidic compartments were stained with LysoTracker (red), respectively. 12

13 Figure S7. Fluorescence spectra of BSA-FITC and DG60/BSA-FITC complex (A). Intracellular delivery of BSA-Pt into HeLa cells for 4 h by DGBA60 and DG60. The internalized Pt nanoparticles by the cells were measured by ICP-MS (B). The doses of polymer and BSA-Pt was 8 µg and 2 µg, respectively. Note: The weak fluorescence observed for cells treated with DG60/BSA-FITC is probably due to the fluorescence quenching of FITC in the complex. To prove this speculation, we tested the fluorescence spectra of BSA-FITC and BSA-FITC/DG60 complex. As shown in Figure S7A, the fluorescence intensity of BSA-FITC was significantly reduced after complexation with DG60. This means the fluorescence of FITC on BSA is mostly quenched when binding with DG60. As demonstrated in Figure 2C, DG60 has poor ability in endosomal escape and most of complexes were entrapped in the acidic compartments. Therefore, extremely weak fluorescence was observed for the cells treated with DG60/BSA-FITC in Figure 2. To investigate whether DG60/BSA-FITC could be internalized by the incubated cells, BSA was labeled with a platinum (Pt) nanoparticle before complexation with the polymers. The cells were then treated with DG60/BSA-Pt and DGBA60/BSA-Pt complexes for 4 h. After the removal of culture media, the cells were washed with PBS buffer for three times, and the internalized platinum nanoparticles by the cells were analyzed by ICP-MS (Agilent 7500 CE, Agilent Technologies, USA). As shown in Figure S7B, the internalized BSA-Pt by DG60 is similar to that by DGBA60, and both polymers show much higher efficacy in the delivery of BSA-Pt than free BSA-Pt without polymer, suggesting that the major barrier for DG60 is not endocytosis, but the endosomal escape. 13

14 Figure S8. Screening the optimal condition for the delivery of BSA-FITC into HeLa cells mediated by DGBA60, DBA60, DG60 and unmodified dendrimer, respectively. The cells were incubated with the polymer/protein complexes for 4 h. 2 µg BSA-FITC was used in each well. DBA60 and DG60 show extremely low protein delivery efficacy at all the tested conditions. For easier comparison, 8 µg was used as the optimal condition for DGBA60, DBA60 and DG60 and unmodified dendrimer in the study. 14

15 Figure S9. Fluorescence intensity of the HeLa cells treated with polymer/bsa-fitc complexes for 1 h, 2 h and 4 h respectively measured by flow cytometry. 15

16 Figure S10. Confocal images of HeLa cells transfected with DGBA60/BSA-FITC for 4 h, 6 h, 8 h, 12 h and 24 h, respectively (A). Fluoresence intensity of HeLa cells transfected with DGBA60/BSA-FITC, DBA60/BSA-FITC, DG60/BSA-FITC, unmodified dendrimer/bsa-fitc and PULSin/BSA-FITC for 4 h, 6 h, 8 h, 12 h and 24 h, respectively (B). For the cells transfected for 12 h and 24 h, the culture media were replaced with fresh medium containing 10% FBS after 8 h incubation. The protein and polymer doses are 2 µg and 8 µg, respectively. 16

17 Figure S11. Synthesis of ABA modified dendrimer (A). The synthesized material DABA60 was characterized by 1 H NMR (B). Confocal images of HeLa cells treated with polymer/bsa-fitc complexes (green) for 4 h (C). The nuclei were stained with Hoechst (blue) and the acidic compartments were stained with LysoTracker (red). Efficacies of unmodified dendrimer, DABA60 and DGBA60 in the delivery of BSA-FITC into HeLa cells. The cells were incubated with polymer/bsa-fitc complexes for 4 h, 6 h, 8 h, 12 h and 24 h, respectively. The protein dose in each well is 2 µg (D). 17

18 Figure S12. Magnified images HeLa cells (A) and NIH3T3 cells (B) in Figure 3A and Figure 3C, respectively. 18

19 Figure S13. Intracellular delivery of R-PE into Raw264.7 cells. The doses of polymers and R-PE in each well were 8 µg and 1 µg, respectively. PULSin TM was used as a positive control. The cells were treated with the polymer/r-pe complexes for 4 h. 19

20 Figure S14. Confocal images of HeLa cells transfected with DGBA60/R-PE for 4 h, 6 h, 8 h, 12 h and 24 h, respectively (A). Fluoresence intensity of HeLa cells transfected with DGBA60/R-PE, DBA60/R-PE, DG60/R-PE, unmodified dendrimer/r-pe and PULSin/R-PE for 4 h, 6 h, 8 h, 12 h and 24 h, respectively (B). For the cells transfected for 12 h and 24 h, the culture media were replaced with fresh medium containing 10% FBS after 8 h incubation. The protein and polymer doses are 1 µg and 8 µg, respectively. 20

21 Figure S15. Magnified images of HeLa cells in Figure 4A. 21

22 Figure S16. Intracellular peptide delivery mediated by DGBA60. Fluorescence images of HeLa cells treated with DGBA60/P1-FITC (A) or DGBA60/P2-FITC (D) for 24 h. The polymer dose is 8 µg, and the peptide dose is 1 µg. The culture media were replaced with fresh medium containing 10% FBS after 8 h incubation. Fluorescence intensity of the transfected cells with DGBA60/P1-FITC (B) or DGBA60/P2-FITC (E) for 24 h. Viability of cells treated with DGBA60/P1-FITC (C) or DGBA60/P2-FITC (F) complexes for 24 h. P1-FITC and P2-FITC were tested as negative controls. The culture media were replaced with fresh medium containing 10% FBS after 8 h incubation. 22

23 Figure S17. Viability of cells treated with DGBA60/P1 or DGBA60/P1-Scr complexes for 24 h. P1 and P1-Scr were tested as negative controls. The culture media were replaced with fresh medium containing 10% FBS after 8 h incubation. 23

24 Figure S18. p53 delivery efficacy was determined by western blot analysis. (A) Flow cytometry analysis of HeLa cells treated with complexes for 24 h. (B) The cells were stained with annexin V and propidium iodide (PI) to determine the percent of apoptotic cells. The doses of DGBA60 and p53 were 8 µg and 2 µg, respectively. 24

25 Figure S19. The hematological parameters of mice analyzed 7 days after administration with PBS, DGBA60, saporin and DGBA60/saporin complexes by intraperitoneal injection. The doses of saporin and polymer are 310 µg/kg and 4.5 mg/kg, respectively. *p < 0.05 and **p < 0.01 analyzed by student s t-test. Reference (1) Wang, M.; Liu, H.; Li, L.; Cheng, Y. Nat. Commun. 2014, 5, (2) Wang, X.; Wang, H.; Wang, Y.; Yu, X.; Zhang, S.; Zhang, Q.; Cheng, Y. Sci. Rep. 2016, 6,