A Multiplex RT-PCR Assay to Detect and Discriminate Porcine Reproductive and Respiratory Syndrome Viruses in Clinical Specimens

Transcription

1 viruses Article A Multiplex RT-PCR Assay to Detect and Discriminate Porcine Reproductive and Respiratory Syndrome Viruses in Clinical Specimens Keli Yang *, Yongxiang Tian *, Danna Zhou, Zhengying Duan, Rui Guo, Zewen Liu, Fangyan Yuan and Wei Liu Key Laboratory of Prevention and Control Agents for Animal Bacteriosis (Ministry of Agriculture), Institute of Animal Husbandry and Veterinary, Hubei Academy of Agricultural Sciences, Wuhan , China; zdn_66@126.com (D.Z.); zy001d@sina.com (Z.D.); hlguorui@163.com (R.G.); liuzwen2004@sina.com (Z.L.); hbxms@126.com (F.Y.); liuwei85@126.com (W.L.) * Correspondence: keliy6@126.com (K.Y.); tyxanbit@163.com (Y.T.); Tel.: (K.Y.) Academic Editor: Curt Hagedorn Received: 15 May 2017; Accepted: 28 July 2017; Published: 1 August 2017 Abstract: Outbreaks of highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) have led to large economic losses in China. The attenuated vaccine (HP-PRRSV JXA1-R) was used to control HP-PRRSV. However, in recent years, co-infection with classical PRRSV (C-PRRSV), HP-PRRSV, and/or HP-PRRSV JXA1-R has been increasing in China, resulting in a significant impact on PRRSV diagnostics and management. To facilitate rapid discrimination of HP-PRRSV JXA1-R from HP-PRRSV and C-PRRSV, a multiplex RT-PCR assay for visual detection of HP-PRRSV JXA1-R, HP-PRRSV, and C-PRRSV was established and evaluated with reference PRRSV strains and clinical samples. Primer specificities were evaluated with RNA/DNA extracted from 10 viral strains, and our results revealed that primers had a high specificity for PRRSV. The assay sensitivity was 24 copies/µl for PRRSVs. A total of 516 serum samples were identified, of which 12.21% (63/516) were HP-PRRSV-positive, 2.33% (12/516) were HP-PRRSV JXA1-R-positive, and 1.16% (6/516) were C-PRRSV-positive, respectively, which was completely consistent with sequencing method. The high specificity, sensitivity, and reliability of multiplex RT-PCR assay described in this study indicate that it is useful for rapid and differential diagnosis of HP-PRRSV JXA1-R, HP-PRRSV, and C-PRRSV. Keywords: porcine reproductive and respiratory syndrome virus; highly pathogenic; vaccine strain; multiplex RT-PCR; viral discrimination 1. Introduction Porcine reproductive and respiratory syndrome (PRRS) is one of most economically important swine diseases worldwide. The etiological agent of PRRS is porcine reproductive and respiratory syndrome virus (PRRSV) which belongs to order Nidovirales, family Arteriviridae [1]. PRRSV can be divided into European genotype (type 1) and North American genotype (type 2) with Lelystad and VR-2332 as prototypical strains, respectively [2]. The viruses under two genotypes could be furr divided into different sub-genotypes according to virus genome characteristics based on phylogenetic analysis [3]. PRRSV was first confirmed in China in 1996 [4], and since n virus has been found throughout China [5,6]. In May 2006, HP-PRRSV (a highly pathogenic form of PRRSV) severely impacted pig industry in South China, which led to death of more than 2 million pigs [7]. Classical PRRSV (C-PRRSV) is prototypical strain of North American (type 2) genotype VR The C-PRRSV, HP-PRRSV, and HP-PRRSV JXA1-R strains all belongs to North Viruses 2017, 9, 205; doi: /v

2 Viruses 2017, 9, of 10 American (type 2) genotype, and PRRSV strains circulating in China are almost all of North American (type 2) genotype [8,9]. Despite development and application of modified live vaccines for HP-PRRSV, virulent HP-PRRSV variants were constantly reported under massive national immunization campaign [2]. In recent years, co-infection with classical PRRSV (C-PRRSV), HP-PRRSV, and/or HP-PRRSV JXA1-R has been increasing in China, resulting in a significant impact on PRRSV diagnostics and management. Isolation of pathogenic agents and/or differential serological tests were used for identification and differentiation of PRRSV. However, y are labor-intensive and time-consuming procedures. Molecular typing methods have been developed, and are currently used for rapid detection and identification of PRRSV [10]. Recently, a multiplex real-time RT-PCR based on specific probes was developed for type 1, type 2, and HP-PRRSVs [10]; a SYBR-green-based real-time RT-PCR assay has been developed for detection and differentiation of HP-PRRSV and C-PRRSV [11]; and a one-step RT-PCR assay has been developed for detection and differentiation of HP-PRRSV and C-PRRSV [12]. However, se assays are not suitable for differentiation of C-PRRSV, HP-PRRSV, and HP-PRRSV JXA1-R strains. Prompt detection and discrimination of PRRSV in field samples are important for effective PRRS control, reby reducing potentially serious economic losses from an outbreak. Therefore, a rapid, convenient, sensitive, and specific diagnostic method to discriminate between C-PRRSV, HP-PRRSV, and HP-PRRSV JXA1-R strains would be extremely useful for diagnosis and control of PRRSV in China. In this study, a multiplex RT-PCR assay was developed for detection and discrimination of C-PRRSV, HP-PRRSV, and HP-PRRSV JXA1-R strains. The proposed method was shown to be a convenient, sensitive, reliable, and suitable tool to aid prevention and control of PRRS. 2. Materials and Methods 2.1. Viruses, Cells, and Reagents C-PRRSV strain CH-1a (GenBank ID: AY032626) is first wild-type strain isolated from China, and was kindly provided by Hanzhong Wang (Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China). PRRSV strain 07HBEZ is a highly pathogenic North American-type PRRSV, and was isolated in 2007 (GenBank ID: FJ ). HP-PRRSV JXA1-R strain was isolated from highly pathogenic porcine reproductive and respiratory syndrome vaccine, live (JXA1-R) (Pulike Biological Engineering Inc., Luoyang, China). Marc-145 cells were cultured and maintained in DMEM supplemented with 10% newborn calf serum (Gibco) at 37 C in a humidified 5% CO 2 incubator. Or viruses, including classical swine fever virus (CSFV), pseudorabies virus (PRV), porcine circovirus type 2 (PCV2), porcine parvovirus (PPV), Japanese encephalitis virus (JEV), rotavirus (RV), porcine epidemic diarrhea virus (PEDV), stored in our laboratory, were used to confirm specificity of proposed multiplex RT-PCR assay Clinical Specimen Collection A total of 516 serum samples were obtained from 10 pig farms in Hubei Province, central China, from June to August All samples used in this study were collected in accordance with international standards for animal welfare. The pigs were immunized with live vaccine of HP-PRRSV JXA1-R strain (Pulike Biological Engineering Inc.) according to manufacturer s instructions at about 30 days old. The serum samples were collected from pigs when y were about 50 days old. Before samples were collected, re were no clinical signs of PRRSV in farms Primers Design The primers were designed using Primer Premier 5.0 (Primer Biosoft International, Palo Alto, Santa Clara, CA, USA) based on PRRSV sequences in GenBank database to amplify discontinuous 30-aa deletion in NSP2 gene between HP-PRRSV and C-PRRSV genome sequences, and

3 Viruses 2017, 9, of 10 nucleotide fragments (13,380 13,900nt) of HP-PRRSV and HP-PRRSV JXA1-R strain, respectively (Table 1). The specificity of primers was confirmed against random nucleotide sequences obtained by a BLAST search in GenBank database. The PCR-amplified HP-PRRSV and C-PRRSV products were 229 and 319 bp, respectively, and PCR-amplified products of HP-PRRSV JXA1-R strain were two bands of 229 bp and 620 bp.the primers were synsized by Sangon Biotech Co., Ltd. (Shanghai, China). Table 1. The primer sequences for multiplex RT-PCR. Primer Primer Sequences (5 3 ) Origin/Target Gene Location Products Source Nsp2-F Nsp2-R JXA1-F JXA1-R TGAYGGGCGACAATGTCC CGCAGACAAATCCAGAVG ATTTGAATGTTCGCACGGTCTC CCGCTGAAACTCTGGTTAAAGG PRRSV CH-1a (GenBank:AY032626)/Nsp2 PRRSV 07HBEZ (GenBank:FJ )/Nsp2 PRRSV 07HBEZ (GenBank:FJ )/GP4 PRRSV JXA1-P170 (GenBank:JQ )/GP (AY032626) (FJ ) (AY032626) (FJ ) 13,380 13,401 13,879 13, bp (AY032626) 229 bp (FJ ) None (FJ ) 620 bp (JQ ) Previous study [12] This study 2.4. Nucleic Acid Extractions Viral RNA samples for multiplex RT-PCR were extracted from serum samples using TaKaRa MiniBEST Viral RNA Extraction Kit Ver.4.0 (TaKaRa, Dalian, China) according to manufacturer s protocol. Total RNA was eluted with 40 µl of diethylpyrocarbonate-treated water and stored at 80 C until use. Viral genomic RNA or DNA to test specificity of multiplex RT-PCR assay were extracted from cell cultures infected by each virus using TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver. 4.0 (TaKaRa, Dalian, China) according to manufacturer s instructions First Strand cdna Synsis First strand cdna was synsized from 5 µg total RNA using PrimeScript 1st Strand cdna Synsis Kit (TaKaRa) following manufacturer s protocol with OligodT primer Single PCR and Plasmid Template Construction The PCR reaction was conducted in a 25 µl mixture including 2.5 µl 10 PCR buffer, 2 µl 10 mm of each dntps, 0.5 µl of each 10 µm primer (Table 1), 1.25 U of Taq DNA polymerase (5 U/µL) (TaKaRa), 2.5 µl of cdna, and distilled water was added to 25 µl. The amplifications were performed in a rmal cycler (Bio-Rad, Hercules, CA, USA) under following conditions: after initial denaturation at 95 C for 5 min, 35 cycles were conducted at 95 C for 30 s, 58 C for 45 s, and 72 C for 45 s, followed by a final extension at 72 C for 10 min. The PCR products were detected by electrophoresing through 1.0% agarose gel in 1 TAE (40 mm Tris-aceate, 1 mm EDTA, ph8.0). Each specific viral target fragment was cloned into plasmid pmd18-t (TaKaRa). The constructed recombinant plasmids were sequenced and confirmed to use as standard templates for optimization of following PCR assays Optimization of MultiplexRT-PCR Assay Based on established single PCR, multiplex RT-PCR was optimized by varying single parameters while or parameters were maintained. The evaluated parameters and ranges in concentrations included: primers, 2 30 pm; dntps, µm, and TaKaRaTaq DNA polymerase, U. The effects of annealing temperature (range: C) and number of cycles (range: cycles) were also determined experimentally. The PCR products were detected by electrophoresing as described above. Negative control using distilled water instead of template cdna was run with test.

4 Viruses 2017, 9, of Specificity of Proposed Multiplex RT-PCR Assay Specificity of multiplex RT-PCR assay was determined by analyzing 10 different viral strains and ddh 2 O as negative control. C-PRRSV, HP-PRRSV, and HP-PRRSV JXA1-R strains were identified by sequencing, and or virus strains (CSFV, PRV, PCV2, PPV, JEV, RV, and PEDV) were verified by serological or PCR methods. Viral RNA extracted from C-PRRSV-, HP-PRRSV-, and HP-PRRSV JXA1-R infected cell supernatants with approximate viral titers of 10 3 TCID 50 /ml were analyzed with multiplex RT-PCR assay as described above Sensitivity of Proposed Multiplex RT-PCR Assay To assess sensitivity of proposed assay, C-PRRSV, HP-PRRSV, and HP-PRRSV JXA1-R strains were determined in Marc-145 cells grown in 96-well plates, and TCID 50 was calculated using method of Reed and Muench [13]. Total RNA from virus samples was extracted and analyzed with sensitivity of proposed multiplex RT-PCR assay. The RNA concentration was determined by spectrophotometry, and exact number of RNA molecules was calculated. Then 10-fold serial dilution was performed from copies/µl to copies/µl and used as templates for multiplex RT-PCR. The lowest amount of RNA detectable under conditions described above was defined as sensitivity of multiplex RT-PCR assay Detection of PRRSV in Clinical Specimens by Multiplex PCR To evaluate feasibility of multiplex RT-PCR detection of PRRSV, 516 clinical specimens described above were analyzed using multiplex RT-PCR assay. To verify accuracy of developed protocol, all of RT-PCR products from positive samples were cloned into plasmid pmd18-t and sequenced by Sangon Biotech Co., Ltd (Shanghai, China). All of negative samples were furr detected using one-step RT-PCR in our previous study [12]. 3. Results 3.1. MultiplexRT-PCR Assay Conditions The optimal parameters of multiplex RT-PCR assay were investigated. A final 25-µL volume of multiplex RT-PCR master mix contained of 2.5 µl of 10 buffer, 0.25 µl of Taq polymerase (5 U/µL), 2.5 µl of cdna template, 2µL of dntps (10 mm), 0.5µL of forward and reverse primers (10 µm), and µl nuclease-free water in each reaction tube. Master mixes were maintained on ice at all times prior to PCR analysis. An optimized experimental protocol on a Peltier Thermal Cycler machine (Bio-Rad, Hercules, CA, USA) consisted of a denaturation program (95 C for 5 min) and an amplification program repeated 35 times (denaturation at 95 C for 30 s, 58 C for 40 s, and elongation at 72 C for 45 s), followed by a 10-min extension at 72 C. HP-PRRSV JXA1-R cdna, HP-PRRSV cdna, C-PRRSV cdna, and a negative control reaction mixture without template were analyzed using above protocol, and PCR amplification results are illustrated in Figure 1.

5 Viruses 2017, 9, of 10 Viruses 2017, 9, of 10 Viruses 2017, 9, of 10 Figure 1. The results of multiplex RT-PCR in optimization conditions.lane M, DL2000 DNA marker; Figure lane 1, 1. highly The results pathogenic of multiplex porcine RT-PCR reproductive in optimization and respiratory conditions.lane syndrome M, virus DL2000 (HP-PRRSV) DNA marker; strain lane JXA1-R; 1, 1, highly lane pathogenic 2, classical porcine porcine PRRSV reproductive (C-PRRSV) and strain and respiratory respiratory CH-1a; syndrome lane syndrome 3, virus HP-PRRSV (HP-PRRSV) virus (HP-PRRSV) strain strain07hbez; JXA1-R; JXA1-R; lane 2, 4, classical ddh2o. lane 2, PRRSV classical (C-PRRSV) strain (C-PRRSV) CH-1a; lane strain 3, HP-PRRSV CH-1a; lane strain 3, 07HBEZ; HP-PRRSV lanestrain 4, ddh07hbez; 2 O. lane 4, ddh2o Specificity Specificity of of Proposed Proposed Multiplex Multiplex RT-PCR RT-PCR Assay Assay 3.2. Specificity of Proposed Multiplex RT-PCR Assay The The specificity specificity of of primer primer pairs pairs for for each each virus virus was was analyzed analyzed using using proposed proposed multiplex multiplex RT-PCR RT-PCR The assay. assay. specificity As As illustrated illustrated of primer in in Figure Figure pairs 2, for 2, each multiplex multiplex virus RT-PCR was RT-PCR analyzed assay assay was using was specific specific proposed for for target multiplex target virus because RT-PCR virus because no assay. amplification no As amplification illustrated occurred in occurred Figure with CSFV, 2, with PRV, CSFV, multiplex PCV2, PRV, PPV, RT-PCR PCV2, JEV, assay RV, PPV, PEDV, JEV, was or RV, specific ddh PEDV, 2 O for (lanes or ddh2o target 4 11), whereas virus (lanes because 4 11), HP-PRRSV no whereas amplification JXA1-R, HP-PRRSV occurred C-PRRSV, JXA1-R, with andcsfv, HP-PRRSV C-PRRSV, PRV, target PCV2, and genes PPV, HP-PRRSV were JEV, RV, specifically target PEDV, genes or amplified ddh2o were using (lanes specifically 4 11), defined amplified whereas primer using pairs HP-PRRSV (lanes defined 1 3). primer JXA1-R, pairs C-PRRSV, (lanes 1 3). and HP-PRRSV target genes were specifically amplified using defined primer pairs (lanes 1 3). Figure 2. Specificity of multiplex RT-PCR. Lane M, DL2000 DNA marker; lane 1, HP-PRRSV JXA1-R; lane 2, Figure C-PRRSV 2. strain Specificity CH-1a; of multiplex lane RT-PCR. 3, HP-PRRSV Lane M, strain DL HBEZ; DNA marker; lane 4, 4, lane CSFV; 1, HP-PRRSV lane 5, 5, PRV; JXA1-R; lane 6, PCV2; lane lane 2, 7, C-PRRSV PPV; lane strain 8, CH-1a; 8, JEV; lane 9, lane 9, RV; 3, RV; lane HP-PRRSV lane 10, 10, PEDV; strain lane 07HBEZ; lane 11, 11, ddh ddh2o. 2 lane 4, CSFV; lane 5, PRV; lane 6, PCV2; lane 7, PPV; lane 8, JEV; lane 9, RV; lane 10, PEDV; lane 11, ddh2o Sensitivity of Multiplex RT-PCR 3.3. Sensitivity The sensitivity of Multiplex of RT-PCR multiplex RT-PCR assay was defined as minimum detectable RNA molecules The sensitivity concentration of at which multiplex a positive RT-PCR amplification assay was product defined could as be minimum detected. detectable RNA molecules Upon concentration 10-fold serial dilution, at which RNA a positive standards amplification with known product copy could numbers be detected. (2.4 ( copies/µl copies/μl to 2.4 Upon copies/μl) copies/µl) 10-fold serial were were dilution, synsized RNA first standards first strand with cdna known and used copy for numbers multiplex (2.4 RT-PCR copies/μl As shown to in 2.4 Figure 10 1 copies/μl) 3, multiplex were RT-PCR synsized successfully first strand detected cdna as and little used as 24 for copies/µl copies/μl multiplex of RT-PCR. RNA molecules, As shown determined in Figure 3, by multiplex by agarose agarose RT-PCR gelelectrophoresis successfully detected for for HP-PRRSV as little HP-PRRSV as JXA1-R, 24 copies/μl C-PRRSV, JXA1-R, of RNA and C-PRRSV, HP-PRRSV. molecules, and The HP-PRRSV. determined results demonstrated The by results agarose demonstrated that gelelectrophoresis sensitivity that of sensitivity multiplex for of RT-PCR HP-PRRSV multiplex was 24RT-PCR JXA1-R, copies/µl was C-PRRSV, for 24 HP-PRRSV copies/μl and JXA1-R, HP-PRRSV. for HP-PRRSV C-PRRSV, The JXA1-R, results and HP-PRRSV. C-PRRSV, demonstrated and that HP-PRRSV. sensitivity of multiplex RT-PCR was 24 copies/μl for HP-PRRSV JXA1-R, C-PRRSV, and HP-PRRSV.

6 Viruses 2017, 9, of 10 Viruses 2017, 9, of 10 Figure3. Sensitivityof of multiplex RT-PCRfor for PRRSVLane Lane M, M, DL2000 DNA DNA marker; marker; lanes lanes are: are: 1, 2.4 1, ; 10 2, ; 2, ; 3, ; 3, ; 4, ; 4, ; 5, ; 5, ; 6, ; 10 6, ; 7, ; 7, copies/μl copies/µl Detection of Viruses in Clinical Specimens A total of 516 clinical specimens were tested by multiplex RT-PCR assay with optimal parameters. The results were as follows: HP-PRRSV RNA was detected in 63 (12.21%) of 516 serum samples, HP-PRRSV JXA1-R RNA was detected in 12 (2.33%) of 516 serum samples, and C-PRRSV RNA was detected in 66 (1.16%) of of serum samples, respectively, which which were were 100% 100% correlated correlated with with sequencing sequencing method method (Table (Table 2). The2). results The results of one-step of one-step RT-PCR RT-PCR for negative for negative samples samples were same were as same thoseas ofthose multiplex of multiplex RT-PCR RT-PCR assay weassay developed. we developed. The results The obtained results obtained by multiplex by multiplex RT-PCR RT-PCR method and method subsequent and subsequent sequencing sequencing furr indicated furr indicated accuracy of accuracy developed of method. developed method. Additionally, two HP-PRRSV JXA1-R and HP-PRRSV positive, one HP-PRRSV and C-PRRSV positive, Additionally, and two HP-PRRSV two HP-PRRSV JXA1-R JXA1-R and C-PRRSV and HP-PRRSV positive clinical positive, samples one HP-PRRSV were detected and in C-PRRSV samples positive, from fourand pigtwo farms HP-PRRSV (Table 2). JXA1-R The rate and of C-PRRSV co-infection positive was 0.97% clinical (5/516) samples in all were of detected detected in samples clinical specimens. from four pig farms (Table 2). The rate of co-infection was 0.97% (5/516) in all of detected clinical specimens. Table 2. Detection rates of clinical specimens by multiplex RT-PCR and sequencing method. Table 2. Detection rates of clinical specimens by multiplex RT-PCR and sequencing method. Multiplex RT-PCR Sequencing Method Pig No. of HP-PRRSVMultiplex JXA1-R HP-PRRSV RT-PCR C-PRRSV HP-PRRSV JXA1-R Sequencing HP-PRRSV Method C-PRRSV Concordance Pig Farm No. Specimens of HP-PRRSV Positive JXA1-R (%) HP-PRRSV Positive (%) C-PRRSV Positive (%) HP-PRRSV Positive (%) HP-PRRSV Positive (%) Positive C-PRRSV (%) Concordance Rate (%) Farm 1Specimens 56 Positive 1 (1.79) (%) Positive 6 (10.71) (%) Positive 0 (0) (%) JXA1-RPositive 1 (1.79) (%) Positive 6 (10.71) (%) Positive 0 (0) (%) Rate 100 (%) (1.79) 2 a (3.33) 6 11 (10.71) (18.33) 0 2 (0) (3.33) 1 2 (1.79) (3.33) 11 6 (10.71) (18.33) 2 (3.33) 0 (0) (2.22) 5 (11.11) 0 (0) 1 (2.22) 5 (11.11) 0 (0) a (3.33) 2 a (3.45) 11 a 9(18.33) a (15.52) 2 (3.33) 1 (1.72) 2 a 2(3.33) a (3.45) 119 (15.52) (18.33) 12 (1.72) (3.33) (2.22) 0 (0) 5 (11.11) 3 (9.38) 0 (0) 0 (0) 1 (2.22) 0 (0) 53 (11.11) (9.38) 0 (0) a (3.45) 0 (0) 9 a (15.52) 5 (14.29) 1 (1.72) 0 (0) 2 a (3.45) 0 (0) 95 a (14.29) (15.52) 10 (1.72) (0) (2.04) (0) 3 (9.38) (4.08) 1 0 (0) (2.04) 1 (2.04) 2 0 (0) 3 (4.08) 1 (9.38) (2.04) (3.51) 6 (10.53) 0 (0) 2 (3.51) 6 (10.53) 0 (0) (0) (0) (3.03) 5 (14.29) 10 (15.15) 02 (0) (3.03) 02 (0) (3.03) 510 (14.29) (15.15) 2 c 0 (3.03) (0) (2.04) 1 (1.72) 2 b 6 (4.08) (10.34) 1 b (2.04) 0 (0) 1 (2.04) 1 (1.72) 26 b (10.34) (4.08) 1 b 0 (2.04) (0) Total (2.33) 63 (12.21) 6 (1.16) 12 (2.33) 63 (12.21) 6 (1.16) (3.51) 6 (10.53) 0 (0) 2 (3.51) 6 (10.53) 0 (0) One 66 sample in 2 c (3.03) farm was HP-PRRSV 10 (15.15) JXA1-R 2 c (3.03) and HP-PRRSV2 c positive, (3.03) positive 10 (15.15) ratio was2 1.67% c (3.03) (1/60) and % 58 (1/58), respectively; 1 (1.72) One sample 6 (10.34) in farm 0 (0) was 1 (1.72) and C-PRRSV 6 positive, (10.34) positive 0 (0) ratio was % (1/49); Total 516 Two samples in farm were HP-PRRSV JXA1-R and C-PRRSV positive, positive ratio was 12 (2.33) 63 (12.21) 6 (1.16) 12 (2.33) 63 (12.21) 6 (1.16) % (2/66). a One sample in farm was HP-PRRSV JXA1-R and HP-PRRSV positive, positive ratio was 1.67% (1/60) and 1.72% (1/58), respectively; b One sample in farm was HP-PRRSV and C-PRRSV 4. Discussion positive, positive ratio was 2.04% (1/49); c Two samples in farm were HP-PRRSV JXA1-R and C-PRRSV has positive, obsessed positive pig ratio industry was 3.03% for(2/66). decades and leads to massive economic losses all over world. In 2006, a highly-pathogenic PRRSV occurred in China, affected over 2,000,000 pigs 4. with Discussion about 400,000 fatal cases [7]. The outbreaks observed were furr characterized by a rapid spread within affected provinces, and it was observed that pigs of all ages were affected [14]. PRRSV has obsessed pig industry for decades and leads to massive economic losses all over world. In 2006, a highly-pathogenic PRRSV occurred in China, affected over 2,000,000 pigs

7 Viruses 2017, 9, of 10 Due to its high rates of mutation and recombination events, protection ability of PRRSV vaccines was compromised if infection froma heterologous virus occurred [15]. In order to prevent PRRS, six live attenuated PRRSV vaccines including PRRSMLV, CH-1R, and R98 for C-PRRSV, and JXA1-R, HuN4-F112, and TJM-F92 specific for HP-PRRSV are currently marketed in China [16], and JXA1-R strain has been widely used in recent years. However, co-infection with classical PRRSV (C-PRRSV), HP-PRRSV, and/or HP-PRRSV JXA1-R has been increasing in China, resulting in a significant impact on PRRSV diagnostics and management. PRRS diagnosis is typically accomplished by viral isolation followed by immunochromatochemical analysis, serological methods, and/or conventional RT-PCR. However, viral isolation is complex, labor intensive, and time-consuming. Immunochromatochemical and serological methods have low specificity and/or sensitivity [17]. To overcome se shortcomings and obtain more accurate diagnoses, real-time RT-PCR assays specific for highly-pathogenic PRRSV have been developed [18 20], and some qrt-pcr assays and one-step RT-PCR assays have been developed for detection and differentiation of HP-PRRSV and C-PRRSV [10 12]. These tests are highly specific and sensitive, but cannot distinguish C-PRRSV, HP-PRRSV, and HP-PRRSV JXA1-R strains coexisting in Chinese swine herds. In present study, we developed an efficient and sensitive multiplex RT-PCR assay for detection and discrimination of C-PRRSV, HP-PRRSV, and HP-PRRSV JXA1-R strains using two specific primer pairs one of which was designed in our previous study [12]. The PCR products produced from specific primers are distinct for each PRRSV strain, and no amplification occurred with non-target viruses or ddh 2 O, which can be visualized and easily differentiated by agarose gel electrophoresis checking. In addition, all specific PCR products obtained by analyzing clinical specimens were also cloned into pmd18-t and sequenced to furr confirm specificity of multiplex assay. Generally, presence of more than one pair of primers in same reaction mix may limit sensitivity or cause preferential amplification of specific targets [21], and sensitivity of multiplex PCR is usually approximately 10-fold lower than that of a single PCR [22]. Fortunately, established multiplex RT-PCR assay in study was as sensitive as single PCR in our previous study [12] with a detection limit of 24 copies/µl for PRRSV, which suggested a desired primer design and proper optimization of multiplex RT-PCR assay developed. Moreover, sensitivity was similar to that of a real-time RT-PCR-based assay for same virus ( sensitivity of which was 20 copies/µl) [10], and was higher than a multiplex PCR ( sensitivity of which was 800 copies/µl) [23] and a RT-qPCR assay ( sensitivity of which was 100 copies/µl) [24]. As we know, re are many factors that can affect sensitivity of PCR assays, such as nucleic acid extraction method, cycles of PCR, and PCR products detection method, etc. The sensitivity difference between multiplex PCR we developed and RT-qPCR assay [24] maybe caused by factors above, and sensitivity difference between multiplex PCR we developed and anor multiplex PCR assay [23] maybe mainly caused by nucleic acid extraction method. In present study, when assessing diagnostic performances, sensitivity of proposed multiplex RT-PCR assay was 24 copies/µl; that is to say, samples with virus below 24 copies/µl could not be detected as positive. Additionally, sensitivity of multiplex RT-PCR in this study, is similar with that of one-step RT-PCR in our previous study [12], which was 25 copies/µl for both HP-PRRSV and C-PRRSV. The difference between two assays is that one step RT-PCR assay can detect and discriminate HP-PRRSV and C-PRRSV, while multiplex RT-PCR assay can detect and discriminate not only HP-PRRSV and C-PRRSV, but also HP-PRRSV JXA1-R. However, PRRSV has genetic variability; when a new variant strain of PRRSV appears, it is possible that multiplex RT-PCR would be unable to detect and discriminate it. This facet will also need furr research. In present study, 516 specimens were detected using multiplex RT-PCR, and results were 100% consistent with that of sequencing method. In our clinical specimens, 12.21% (63/516) were HP-PRRSV-positive, 2.33% (12/516) were HP-PRRSV JXA1-R-positive, and 1.16% (6/516) were

8 Viruses 2017, 9, of 10 C-PRRSV-positive, respectively, which was completely consistent with that of sequencing method. The results also indicated that PRRSV infection was still severe in Hubei Province, Central China. At present, several commercial PRRSV vaccines are used in pig farms in China, including modified live vaccines (MLV) and inactivated vaccines (IV). The use of vaccines in piglets has been more controversial, and is limited by dynamics of viral circulation in farm. When flow of viremic piglets from maternities to nurseries is high, most piglets will be infected before establishment of an active immunity due to vaccination [25]. Some studies have dealt with evaluation of virus transmission to vaccinated and unvaccinated pigs [25 28]. Thus, in controlling PRRS, it is important to develop an assay to discriminate different PRRSV strains in clinical specimens. Currently, epidemic of atypical PRRS has not been completely controlled in China [14]. The highly pathogenic PRRSV may continue to impact Chinese swine industry for an extended period [12]. PRRS is one of most important pig diseases worldwide. The causative PRRSV is rapidly evolving and re is an urgent need for development of quicker and more efficacious assay to discriminate PRRSV different strains to improve PRRS control. Control of PRRSV infection in pig farms mainly relies on four pillars:biosecurity, diagnosis, herd management and immunization. Of se, diagnosisis essential to detect pathogen and to limit impact of infection within an infected herd. Thus, we developed proposed multiplex RT-PCR to aid in PRRS prevention and control. In this study, since we could discriminate PRRSV different strains in clinical specimens, we believed that multiplex RT-PCR could be used for detection of PRRSV, and useful in implementing methods to prevent transmission of disease. In summary, proposed multiplex RT-PCR is a convenient, rapid, efficient, sensitive, and highly specific assay for identification of different PRRSV strains. The size of amplified product is sufficient to distinguish different PRRSV strains. Our method showed great promise not only in laboratory testing, but also in field and clinical applications. The simplicity and accuracy of test make it a powerful tool for PRRSV detection and control in China. Acknowledgments: The present study was supported by National Key Research and Development Program of China (2016YFD ), Hubei Province Innovation Center of Agricultural Sciences and Technology ( ). It was also financed by Key Natural Science Foundation of Hubei Province, China (2012FFA067) and Opening Subject of Key laboratory of prevention and control agents for animal bacteriosis (Ministry of Agriculture) (2016ZD006). Author Contributions: K.Y. and Y.T. conceived and designed experiments; D.Z., Z.D. and Z.L. performed experiments; F.Y. and W.L. analyzed data; K.Y. wrote paper; R.G. performed sampling, and provided biological material. All authors read and approved final manuscript. Conflicts of Interest: The authors declare that re was no conflict of interest in preparation of this manuscript. Abbreviations PRRSV porcine reproductive and respiratory syndrome virus CSFV classical swine fever virus PRV pseudorabies virus PCV2 porcine circovirus type 2 PPV porcine parvovirus JEV Japanese encephalitis virus RV rotavirus PEDV porcine epidemic diarrhea virus References 1. Renukaradhya, G.J.; Meng, X.J.; Calvert, J.G.; Roof, M.; Lager, K.M. Live porcine reproductive and respiratory syndrome virus vaccines: Current status and future direction. Vaccine 2015, 33, [CrossRef] [PubMed] 2. Loving, C.L.; Osorio, F.A.; Murtaugh, M.P.; Zuckermann, F.A. Innate and adaptive immunity against porcine reproductive and respiratory syndrome virus. Vet. Immunol. Immunopathol. 2015, 167, [CrossRef] [PubMed]

9 Viruses 2017, 9, of Brar, M.S.; Shi, M.; Murtaugh, M.P.; Leung, F.C. Evolutionary diversification of type 2 porcine reproductive and respiratory syndrome virus. J. Gen. Virol. 2015, 96, [CrossRef] [PubMed] 4. Guo, B.Q.; Chen, Z.S.; Liu, W.X.; Cui, Y.Z. Isolation and identification of porcine reproductive and respiratory syndrome (PRRS) virus from aborted fetuses suspected of PRRS. Chin. J. Anim. Pollut. Infect. Dis. 1996, 26, 1 5. (In Chinese) 5. Gao, Z.Q.; Guo, X.; Yang, H.C. Genomic characterization of two Chinese isolates of porcine respiratory and reproductive syndrome virus. Arch. Virol. 2004, 149, [CrossRef] [PubMed] 6. Chen, J.; Liu, T.; Zhu, C.G.; Jin, Y.F.; Zhang, Y.Z. Genetic variation of Chinese PRRSV strains based on ORF5 sequence. Biochem. Genet. 2006, 44, [CrossRef] [PubMed] 7. Tian, K.G.; Yu, X.L.; Zhao, T.Z.; Feng, Y.J.; Cao, Z.; Wang, C.B.; Hu, Y.; Chen, X.Z.; Hu, D.M.; Tian, X.S.; et al. Emergence of fatal PRRSV variants: Unparalleled outbreaks of atypical PRRS in China and molecular dissection of unique hallmark. PLoS ONE 2007, 2, e526. [CrossRef] [PubMed] 8. Zhao, K.; Ye, C.; Chang, X.B.; Jiang, C.G.; Wang, S.J.; Cai, X.H.; Tong, G.Z.; Tian, Z.J.; Shi, M.; An, T.Q. Importation and recombination are responsible for latest emergence of highly pathogenic porcine reproductive and respiratory syndrome virus in China. J. Virol. 2015, 89, [CrossRef] [PubMed] 9. Zhou, Z.; Ni, J.; Cao, Z.; Han, X.; Xia, Y.; Zi, Z.; Ning, K.; Liu, Q.; Cai, L.; Qiu, P.; et al. The epidemic status and genetic diversity of 14 highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) isolates from China in Vet. Microbiol. 2011, 150, [CrossRef] [PubMed] 10. Wernike, K.; Hoffmann, B.; Dauber, M.; Lange, E.; Schirrmeier, H.; Beer, M. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time RT-PCR. PLoS ONE 2012, 7, e [CrossRef] [PubMed] 11. Chai, Z.; Ma, W.J.; Fu, F.; Lang, Y.K.; Wang, W.; Tong, G.Z.; Liu, Q.F.; Cai, X.H.; Li, X. A SYBR Green-based real-time RT-PCR assay for simple and rapid detection and differentiation of highly pathogenic and classical type 2 porcine reproductive and respiratory syndrome virus circulating in China. Arch. Virol. 2013, 158, [CrossRef] [PubMed] 12. Yang, K.L.; Li, Y.H.; Duan, Z.Y.; Guo, R.; Liu, Z.W.; Zhou, D.N.; Yuan, F.Y.; Tian, Y.X. A one step RT-PCR assay to detect and discriminate porcine reproductive and respiratory syndrome viruses in clinical specimens. Gene 2013, 531, [CrossRef] [PubMed] 13. Reed, L.J.; Muench, H. A simple method of estimating fifty percent end points. Am. J. Hyg. 1938, 27, Zhou, L.; Yang, H.C.; Lunney, J.K.; Rowland, R.R.R. Porcine reproductive and respiratory syndrome in China. Virus Res. 2010, 154, [CrossRef] [PubMed] 15. Lunney, J.K.; Fang, Y.; Ladinig, A.; Chen, N.; Li, Y.; Rowland, B.; Renukaradhya, G.J. Porcine reproductive and respiratory syndrome virus (PRRSV): Pathogenesis and interaction with immune system. Annu. Rev. Anim. Biosci. 2016, 4, [CrossRef] [PubMed] 16. Yu, X.; Chen, N.; Wan, L.; Wu, J.; Zhou, Z.; Ni, J.; Li, X.; Zhai, X.; Shi, J.; Tian, K. New genomic characteristics of highly pathogenic porcine reproductive and respiratory syndrome viruses do not lead to significant changes in pathogenicity. Vet. Microbiol. 2012, 158, [CrossRef] [PubMed] 17. Mengeling, W.L.; Lager, K.M. A brief review of procedures and potential problems associated with diagnosis of porcine reproductive and respiratory syndrome. Vet. Res. 2000, 31, [CrossRef] [PubMed] 18. Kleiboeker, S.B.; Schommer, S.K.; Lee, S.M.; Watkins, S.; Chittick, W.; Polson, D. Simultaneous detection of North American and European porcine reproductive and respiratory syndrome virus using real-time quantitative reverse transcriptase-pcr. J. Vet. Diagn. Investig. 2005, 17, [CrossRef] [PubMed] 19. Lurchachaiwong, W.; Payungporn, S.; Srisatidnarakul, U.; Mungkundar, C.; Theamboonlers, A.; Poovorawan, Y. Rapid detection and strain identification of porcine reproductive and respiratory syndrome virus (PRRSV) by real-time RT-PCR. Lett. Appl. Microbiol. 2008, 46, [CrossRef] [PubMed] 20. Xiao, X.L.; Wu, H.; Yu, Y.G.; Cheng, B.Z.; Yang, X.G.; Chen, G.; Liu, D.M.; Li, X.F. Rapid detection of a highly virulent Chinese-type isolate of Porcine Reproductive and Respiratory Syndrome virus by real-time reverse transcriptase PCR. J. Virol. Methods 2008, 149, [CrossRef] [PubMed] 21. Markoulatos, P.; Siafakas, N.; Moncany, M. Multiplex polymerase chain reaction: A practical approach. J. Clin. Lab. Anal. 2002, 16, [CrossRef] [PubMed] 22. Xu, X.G.; Chen, G.D.; Huang, Y.; Ding, L.; Li, Z.C.; Chang, C.D.; Wang, C.Y.; Tong, D.W.; Liu, H.J. Development of multiplex PCR for simultaneous detection of six swine DNA and RNA viruses. J. Virol. Methods 2012, 183, [CrossRef] [PubMed]

10 Viruses 2017, 9, of Liu, J.K.; Wei, C.H.; Yang, X.Y.; Dai, A.L.; Li, X.H. Multiplex PCR for simultaneous detection of porcine reproductive and respiratory syndrome virus, classical swine fever virus, and porcine circovirus in pigs. Mol. Cell. Probes 2013, 27, [CrossRef] [PubMed] 24. Spear, A.; Faaberg, K.S. Development of a genome copy specific RT-qPCR assay for divergent strains of type 2 porcine reproductive and respiratory syndrome virus. J. Virol. Methods 2015, 218, 1 6. [CrossRef] [PubMed] 25. Pileri, E.; Gibert, E.; Martín-Valls, G.E.; Nofrarias, M.; López-Soria, S.; Martín, M.; Díaz, I.; Darwich, L.; Mateu, E. Transmission of Porcine reproductive and respiratory syndrome virus 1 to and from vaccinated pigs in a one-to-one model. Vet. Microbiol. 2017, 201, [CrossRef] [PubMed] 26. Charpin, C.; Mahé, S.; Keranflec h, A.; Belloc, C.; Cariolet, R.; Le Potier, M.F.; Rose, N. Infectiousness of pigs infected by Porcine Reproductive and Respiratory Syndrome virus (PRRSV) is time-dependent. Vet. Res. 2012, 43, 69. [CrossRef] [PubMed] 27. Pileri, E.; Gibert, E.; Soldevila, F.; García-Saenz, A.; Pujols, J.; Diaz, I.; Darwich, L.; Casal, J.; Martín, M.; Mateu, E. Vaccination with a genotype 1 modified live vaccine against porcine reproductive and respiratory syndrome virus significantly reduces viremia, viral shedding and transmission of virus in aquasi-natural experimental model. Vet. Microbiol. 2015, 175, [CrossRef] [PubMed] 28. Rose, N.; Renson, P.; Andraud, M.; Paboeuf, F.; Le Potier, M.F.; Bourry, O. Porcine reproductive and respiratory syndrome virus (PRRSv) modified-live vaccine reduces virus transmission in experimental conditions. Vaccine 2015, 33, [CrossRef] [PubMed] 2017 by authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under terms and conditions of Creative Commons Attribution (CC BY) license (