Real-time quantitative PCR detection of Escherichia coli O157:H7
|
|
- Lucy Mason
- 6 years ago
- Views:
Transcription
1 Real-time quantitative PCR detection of Escherichia coli O157:H7 Chen Si y, Huang Kun-Lun y, Xu Wen-Tao, Li Yuan and Luo Yun-Bo* College of Food Science and Nutritional Engineering, China Agricultural University, Beijing , China Received 29 April 2005; Accepted 23 May 2005 First published in Journal of Agricultural Biotechnology 2006, 14(5): Abstract A rapid and accurate real-time quantitative polymerase chain reaction (real-time PCR) method with SYBR Green I was established for detecting Escherichia coli O157:H7. A pair of primers were designed to amplify the eae gene. The dissociation curves showed that the amplification product was very specific. The optimal conditions and standard curve were established. The result indicated that real-time PCR was 1000 times more sensitive than ordinary PCR. Keywords: Escherichia coli O157:H7; SYBR Green I; quantitative fluorescence; real-time PCR Introduction Escherichia coli O157:H7 is the most common type of enterohaemorrhagic E. coli (EHEC). During the 20 years since the first isolation of E. coli O157:H7 (Riley et al., 1983), many reports of O157:H7 outbreaks and spread have been published in Canada, the UK, Japan, etc. The largest outbreak in the world took place in Japan, where more than 9000 persons were infected and more than 10 died (Infectious Agents Surveillance Center, 1996). The first case of E. coli O157:H7 in China was detected in Jiangsu province in 1987 (Wang and Shi, 2001). Later, this infection was reported in many other places, for example Henan province (Zhang et al., 2003a), Shanghai (Gu et al., 2003) and Hebei province (Zhang et al., 2003b). The infective dose of O157:H7 is extremely low. Some reports show that fewer than 10 bacteria would cause disease (Paton and Panton, 1998). There is no specifically effective vaccine at present, so research on its prevention and incidence is vital. Methods of O157 detection are mainly traditional isolation and incubation, immunology and polymerase chain reaction (PCR) at the molecular level. An advanced comparative method is real-time fluorescence quantitative PCR, which involves the use of a fluorescence probe or dye to reveal the quantities of template DNA in real time, and to display this graphically. Results recorded with this technique are often accurate and Bhagwat (2003) used it to increase the lowest limit of detection of EHEC O157:H7 to 1 10 cells/ml. By combining real-time PCR and molecular labelling technology, Fortin (2001) detected 1 cfu (colony forming unit)/ml. However, no similar reports have been published in Chinese laboratories. In this paper, the eaea gene from Escherichia coli O157:H7 cultured on intestinal epidermal cells was amplified to establish a method for detecting O157:H7 by fluorescence quantitative PCR. Materials and methods Materials Bacteria E. coli O157:H7 EDL933 (American) was donated by Jing Huai-qi (Epidemic Disease Microbiology Research Institute of China Preventive Medical Science Academy). Negative control E. coli BL21 and DH5a were from the Food Biotechnology Laboratory of Food Science College (China Agricultural University, China).
2 Instruments The following equipment was utilized: ABI Prism (r) 7000 fluorescence quantitative PCR (Applied Biosystems Co., Foster City, California, USA); U-Vikon XL UV/VIS spectrophotometer (Secomam Co., France); PCR analyser (Hybaid Ltd, Britain) Main reagents SYBR Green I PCR kit was purchased from Beijing Tian Wei Shi Dai Science Technology Co. (Beijing, China); Taq DNA polymerase from Beijing Ding Guo Biotechnology Co. (Beijing, China). The primers were synthesized by Shanghai Sheng Gong Biotechnology Co. (Shanghai, China). Primer order: Forward, K14924: 5 0 -TTACCAGCGATACCAAGAGC-3 0 Reverse, K14925: 5 0 -CAACATGACCGATGACAAGG-3 0 The length of PCR product was 126. Methods Preparation of template DNA Single colonies from bacterial cultures were incubated at 37 C on a shaker for 10 h. After bacterial density counting by electronic microscopy, the DNA was extracted with phenol chloroform according to Li (1994). DNA quality was identified using UV/VIS spectrophotometry, diluted 10 times, and cfu/ml concentration gradients were used as templates. Qualitative PCR amplification The reaction system contained 25 ml: 1rbuffer (10 mmol/ l Tris HCl, ph 8.3, 50 mmol/l KCl, 2 mmol/l MgCl 2 ), 0.2 mmol/l deoxynucleoside triphosphates (dntps), 1 U Taq DNA polymerase, 2 mmol/l forward and reverse primers and 2r10 6 cfu/ml as DNA template. The PCR program initially started with denaturation at 95 C for 10 min, followed by 40 cycles of 94 C for 30 s, 59 C for 45 s, 72 C for 30 s, and 72 C final extension for 10 min. Negative bacterium and water control samples were set up to examine the specificity, and the reaction sensitivity was measured by the 10 concentration gradient templates. The amplified products were examined by 2% agar gel electrophoresis. Fluorescence quantitative PCR amplification The reaction system (40 ml) comprised 20 ml SYBR Green I mixture (2 ml 10rbuffer, 0.1 mol/l dntps, 2.5 U Taq DNA polymerase), 2 mmol/l forward and reverse primers and DNA template. The PCR program initially started with a 95 C denaturation for 10 min, followed by 40 cycles of 94 C for 15 s, 60 C for 30 s, 72 C for 30 s. The fluorescence was measured during the annealing period of each cycle. After reaction completion, the product was heated at 95 C, cooled down to 60 C, then slowly reheated to 95 C (0.2 C/s). The changes in fluorescence signal and the dissociation curve of the amplified product were recorded. Specificity examination and reaction sensitivity measurement were conducted as above. Optimization of the fluorescence quantitative PCR reaction To determine the optimal primer concentration, 0.5, 1.0, 2.0, 3.0 and 5.0 ml primer were added and amplified, respectively. Different DNA concentrations were used to determine the optimal range of quantitative PCR template. Preparation of a fluorescence quantitative standard curve Optimal DNA template concentration was determined based on the influence of different template concentrations on amplification and fluorescence. Reaction systems of five template gradients in the optimal concentration range were as described above under Fluorescence quantitative PCR amplification. After the threshold and baseline were determined, a standard curve was obtained. Results 126 Qualitative PCR reaction Fig. 1. Qualitative polymerase chain reaction (PCR) for the eae gene. Lanes: 1, E. coli strain EDL933; 2, E. coli strain BL21; 3, control (water); 4, DL2000 marker. The ratio of OD 260 /OD 280 by UV spectrophotometry was 1.8, indicating the purity of the DNA template. Qualitative PCR for the eae gene (Fig. 1) showed that only the positive bacteria EDL933 exhibited a band of 126. No
3 amplification was observed in the negative bacteria BL21 or the water control sample, which showed that the designed primers reached the PCR detection requirements and no operational mistake occurred during the procedure. As indicated in Fig. 2, the intensity of the bands decreased with the decrease of template concentration. The first band (10 3 cfu/ml) was the lowest template concentration detected by normal PCR. Fluorescence quantitative PCR amplification The fluorescence signal curve of positive bacteria EDL933 was smooth and stable (Fig. 3), and reached the requirements of quantitative detection, with a comparatively high peak and long index increase period. No amplification was noticed from samples of corresponding negative bacteria (BL21 and DH5a) and water control, indicating good specificity of the designed primer in realtime PCR reaction. This was confirmed by the profile obtained using agar gel electrophoresis (result not shown), which was similar to that of Fig. 1. Quantitative dissociation curves of 10 DNA template concentrations ( cfu/ml) were performed using realtime fluorescence. It can be seen from the curves (Fig. 4) that all the concentration peaks were significantly pure and without primer dimers, proving once more the product specificity. The 1 cfu/ml concentration curve indicated that the detection limit, by real-time PCR, could theoretically reach 1 cfu/ml, which is 1000 times higher than in the normal quantitative PCR. Optimization of fluorescence quantitative PCR reaction Fig. 2. Sensitivity analysis of ordinary polymerase chain reaction (PCR). Lanes 1 7, cfu/ml E. coli strain EDL933, respectively; 8, DL2000 marker. A concentration of primers that is too high may cause primer dimers, and one that is too low will influence the amplification efficiency. The final determined primer Relative fluorescence absorption concentration here was 2 mmol/l for both forward and reverse primers. An excessively high or low concentration of template can influence the peak of the dissociation curves and the S-shaped curve of fluorescence absorption. In this trial, the optimal concentration for detecting E. coli O157:H7 ranged between 10 2 and 10 7 cfu/ml, with a sample volume of 2 ml. Standard curve Cycle Number Fig. 3. Specificity analysis for real-time PCR. EDL933, positive bacteria; BL21 and DH5a, negative bacteria; ck, water control. (See online for a colour version of this Fluorescence signal intensity Temperature ( C) Fig. 4. Quantitative dissociation curves of 10 DNA template concentrations ( cfu/ml). CK, water control. (See online for a colour version of this According to the above result, five DNA template concentrations (10 2,10 3,10 4,10 5 and 10 6 cfu/ml) were selected for amplification (Fig. 5) and the standard curve (Fig. 6) was produced, based on the threshold, baseline and cycle threshold (Ct) values. The horizontal axis in Fig. 6 is the log value of the concentration of positive bacteria EDL933, and the vertical axis is the Ct value detected by real-time PCR.
4 Relative fluorescence absorption Cycle Number products as well as the existence, or not, of dimers. However, this technique can not be used for multiple detection and the fluorescence signal does not show a template specificity. The utilization of this technique in this research has lowered the experimental cost and has allowed the application of dissociation curves to the analysis, and the unique primer design minimized any disadvantages. Determination of the quantitative unit Fig. 5. Fluorescence curves of cfu/ml of E. coli strain EDL933. (See online for a colour version of this Ct Since the present study concerns the toxin-producing E. coli O157:H7, the total colony amount is much more important than its total DNA. Here, the absolute quantity of DNA was not adopted as the quantitative unit; the choice of cfu as the quantitative unit best reflects bacterial vigour and is more meaningful in microbe detection. Selection of standard substances The equation of the final standard curve was y =-2.367x The quantity of the positive bacteria in samples could be calculated by inserting detected Ct values (y) into the equation. The relative coefficient R 2 was over 0.98, indicating that this equation can be used as the standard equation for O157 detection in the future. Discussion Y = X Log CO Fig. 6. Standard curve Ct, cycle threshold; CO, concentration of bacteria. (See online for a colour version of this Advantages and disadvantages of SYBR Green I fluorescence dye During a dye detection procedure, a certain number of dye molecules can be combined with a DNA doublechain as it forms. A fluorescence signal will be enhanced as the signal intensity and DNA quantity are directly proportional. The dye method is advantageous as it presents a low-cost method, with no need of a probe and being suitable for primary detection. Furthermore, dissociation curves can quantitatively determine the PCR The basic principles in choosing standard substances are: PCR efficiency of substance similar to that of the sample the less the difference the less the error; use under the same conditions as the sample (same instruments, reagents, recycling index, and experiment time); use the same quality templates and the same T m (melting temperature) primer. In this paper, the standard curve was determined by fluorescence quantitative amplification of diluted positive bacteria, which guarantees the identity of standard substances and samples. Threshold and baseline function A good choice of the threshold and baseline can help in drawing the standard curves. By adjusting the values of these two indexes, the relative coefficient of the standard curve reaches more than Acknowledgements This research was supported by Key Technology of Food Safety of The Tenth Five-Year Plan, Ministry of Science and Technology, China (No. 2001BA804A23-1). References Bhagwat AA (2003) Simultaneous detection of Escherichia coli O157:H7, Listeria monocytogenes and Salmonella strains by real-time PCR. International Journal of Food Microbiology 84(2):
5 Fortin NY (2001) Use of real-time polymerase chain reaction and molecular beacon for the detection of Escherichia coli O157:H7. Analytical Biochemistry 289(2): Gu BK, Xu XB, Jin HM, Hu PY and Xi MF (2003) Surveillance of E. coli O157:H7 in meat food of Shanghai district. Disease Surveillance 8(1): 5 7 (in Chinese with English abstract). Infectious Agents Surveillance Center, National Institute of Health and Infectious Diseases Control Division, Ministry of Health and Welfare, Japan (1996) Outbreaks of enterohemorrhagic Escherichia coli O157:H7 infection. Japan ISAR 17(8): Li DB (1994) Principle and Methods of Recombinant DNA. Zhejiang: Science and Technology Press, pp (in Chinese). Paton AW and Panton JC (1998) Detection and characterization of shiga toxin genic Escherichia coli by using multiplex PCR assays for stx1 stx2 enterohemorrhagic E. coli hly A, rfbo 111 and rfbo157. Journal of Clinical Microbiology 36(2): Riley LW, Remis R, Helgerson SD, et al. (1983) Outbreaks of hemorrhagic colitis associated with a rare Escherichia coli serotype. New England Journal of Medicine 308: Wang H and Shi ZY (2001) Study on epidemiology of E. coli O157:H7. Jiangsu Health Care 3(1): 4 5 (in Chinese with English abstract). Zhang J, Xia SL and Ma H (2003a) The epidemiological investigation on infectious cases of shiga s toxin-producing E. coli O157:H7 in eastern Henan, China. Strait Journal of Preventive Medicine 9(5): (in Chinese with English abstract). Zhang YL, Guo YX, Li GY, et al. (2003b) Surveillance of E. coli O157:H7 infection in Hebei province. Disease Surveillance 8(3): (in Chinese with English abstract).
Pr oject Summar y. Rapid quantification of culturable and viable-but-nonculturable Escherichia coli O157:H7 in beef products using EMA-Real Time PCR
Pr oject Summar y Rapid quantification of culturable and viable-but-nonculturable Escherichia coli O17:H7 in beef products using EMA-Real Time PCR Principal Investigator: Azlin Mustapha University of Missouri
More informationE-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA
E-Supporting Information-1 (ESI-1) Ionic liquids promote PCR amplification of DNA Yugang Shi, ab Yen-Liang Liu, a Peng-Yeh Lai, c Ming-Chung Tseng, a Min-Jen Tseng, c Yudong Li, b and Yen-Ho Chu* a a Department
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationElectronic Supplementary Information. Target-induced Intermolecular Hybridization
Electronic Supplementary Information The Real-time PCR for Sensitive Protein Detection by Target-induced Intermolecular Hybridization Cuiping Ma a, Lijie Cao a, Chao Shi a *and Naihao Ye b * a State Key
More informationExecutive Summary. clinical supply services
clinical supply services case study Development and NDA-level validation of quantitative polymerase chain reaction (qpcr) procedure for detection and quantification of residual E.coli genomic DNA Executive
More informationElectronic Supplementary Information
Electronic Supplementary Information Ultrasensitive quantification of mature micrornas by real-time PCR based on ligation of ribonucleotide-modified DNA probe Jiangyan Zhang, Zhengping Li,* Hui Wang, Yucong
More information2 march 06 Seminar on RT-PCR. About Real-time PCR. Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire
2 march 06 Seminar on RT-PCR About Real-time PCR Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire Target DNA PCR Applications: Gene Plasmide, phage Diagnostic
More informationQuantitative Real time PCR. Only for teaching purposes - not for reproduction or sale
Quantitative Real time PCR PCR reaction conventional versus real time PCR real time PCR principles threshold cycle C T efficiency relative quantification reference genes primers detection chemistry GLP
More informationBauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04
Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Author(s): Claire Reardon Reviewers: Christian Daly Contact: claire@cgr.harvard.edu
More informationSupplementary Information
Supplementary Information DNA based identification of medicinal materials in Chinese patent medicines Rong Chen, Juan Dong, Xin Cui, Wei Wang, Afshan Yasmeen, Yun Deng, Xiaomao Zeng, Zhuo Tang Materials
More informationPrincipals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt
Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection
More informationQuantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR)
Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR) Quantitative Real-Time RT-PCR Versus RT-PCR In Real-Time RT- PCR, DNA amplification monitored at each cycle but RT-PCR measures the
More informationOnly for teaching purposes - not for reproduction or sale
PCR reaction conventional versus real time PCR real time PCR principles threshold cycle C T efficiency relative quantification reference genes primers detection chemistry GLP in real time PCR Relative
More informationTHUNDERBIRD SYBR qpcr Mix
Instruction manual THUNDERBIRD SYBR qpcr Mix 1304 A4251K THUNDERBIRD SYBR qpcr Mix QPS-201T 1 ml x 1 QPS-201 1.67 ml x 3 Contents [1] Introduction [2] Components [3] Primer design [4] Template DNA [5]
More informationSYBR Green Realtime PCR Master Mix -Plus-
Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0803 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction [2] Components
More informationDNA amplification and analysis: minipcr TM Food Safety Lab
Science for everyone, everywhere DNA amplification and analysis: minipcr TM Food Safety Lab Release date: 09 September 2014 Welcome Our goals for today: Review DNA amplification theory Solve a public health
More informationModule1TheBasicsofRealTimePCR Monday, March 19, 2007
Objectives Slide notes: Page 1 of 41 Module 1: The Basics Of Real Time PCR Slide notes: Module 1: The Basics of real time PCR Page 2 of 41 Polymerase Chain Reaction Slide notes: Here is a review of PCR,
More informationQuantitative Real time PCR. Only for teaching purposes - not for reproduction or sale
Quantitative Real time PCR PCR reaction conventional versus real time PCR real time PCR principles threshold cycle C T efficiency relative quantification reference genes primers detection chemistry GLP
More informationRoche Molecular Biochemicals Technical Note No. LC 12/2000
Roche Molecular Biochemicals Technical Note No. LC 12/2000 LightCycler Absolute Quantification with External Standards and an Internal Control 1. General Introduction Purpose of this Note Overview of Method
More informationPCR OPTIMIZATION AND TROUBLESHOOTING
PCR OPTIMIZATION AND TROUBLESHOOTING Amplification of each DNA fragment can occur only under the defined conditions which are provided by a reaction mixture. If no positive PCR result can be obtained,
More information3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) Fax: (905)
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com E.coli O157:H7 End-Point PCR Kit Product# EP41300 Product Insert
More informationMolecular methods for detection of Antibiotic Resistance in environmental matrices: limits, prospects and challenges.
Dr. Angela Cicatelli acicatelli@unisa.it Molecular methods for detection of Antibiotic Resistance in environmental matrices: limits, prospects and challenges. 1st Workshop on "Risk prognosis of environmental
More informationDetection of Biological Threat Agents by Real-Time PCR - Comparison of Assay
Detection of Biological Threat Agents by Real-Time PCR - Comparison of Assay Performance on the Idaho Technology, Inc. R.A.P.I.D., the Roche LightCycler, and the Cepheid Smart Cycler Supplemental Data
More informationSYBR Green Realtime PCR Master Mix
Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More information3color RT HS-PCR Mix SYBR Ready-to-use mix for real-time Hot Start PCR with SYBR Green. Dedicated for white reaction tubes and plates.
3color RT HS-PCR Mix SYBR Ready-to-use mix for real-time Hot Start PCR with SYBR Green. Dedicated for white reaction tubes and plates. version 0217 250 reactions in 20 μl Cat. # 2000-250S 2500 reactions
More informationPCR. CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D.
PCR CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D. General Outline of the Lecture I. Background II. Basic Principles III. Detection and Analysis of PCR Products IV. Common Applications
More informationQUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.
More informationEnterohaemorrhagic E. coli assay
Enterohaemorrhagic E. coli assay For the detection of EHEC stx1, EHEC stx2, EHEC eaea and EHEC hlya genes using the BD MAX TM system. Instructions for use (Version 3.0 February 2018) 1 Contents Introduction
More informationInstructions for Use Life Science Kits & Assays
Instructions for Use Life Science Kits & Assays Product specifications 1 Product specifications Starting material Time of detection qpcr detection channels Sensitivity Isolated total DNA ~ 60 minutes FAM
More informationSupporting Information Innate Reverse Transcriptase Activity of DNA Polymerase for Isothermal RNA Direct Detection
Supporting Information Innate Reverse Transcriptase Activity of DNA Polymerase for Isothermal RNA Direct Detection Chao Shi, Xiaotong Shen, Shuyan Niu and Cuiping Ma *, Key Laboratory of Sensor Analysis
More informationSupporting Information
Supporting Information Transition Metal Dichalcogenide Nanosheets for Visual Monitoring PCR Rivaling a Real-Time PCR Instrument Liu Wang 1,2, Zhicheng Huang 2, Rui Wang 1, Yibo Liu 2, Cheng Qian 1, Jian
More informationTECHNICAL BULLETIN. SYBR Green JumpStart Taq ReadyMix without MgCl 2. Catalog Number S5193 Storage Temperature 20 C
SYBR Green JumpStart Taq ReadyMix without MgCl 2 Catalog Number S5193 Storage Temperature 20 C TECHNICAL BULLETIN Product Description SYBR Green JumpStart Taq ReadyMix without MgCl 2 combines JumpStart
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationcatalytic hairpin DNA assembly for dual-signal amplification toward homogenous analysis of protein and
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supporting Information Programmable Mg 2+ -dependent DNAzyme switch by the catalytic hairpin DNA
More informationReal-Time PCR Principles and Applications
Real-Time PCR Principles and Applications Dr Esam Ibraheem Azhar (BSc, MSc, Ph.D Molecular Medical Virology) Asst. Prof. Medical Laboratory Technology Department Objectives Real-Time PCR Principles and
More informationGuidelines for Developing Robust and Reliable PCR Assays
Guidelines for Developing Robust and Reliable PCR Assays Leta Steffen, PhD Applications Scientist Promega Corporation Outline 1) PCR reaction components What is in the reaction? How does it affect assay
More informationGeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual
GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000
More informationBeginner s guide to Real-time PCR
Beginner s guide to Real-time PCR Beginner s guide to Real-time PCR PCR or the Polymerase Chain Reaction has become the cornerstone of modern molecular biology the world over. Real-time PCR is a bespoke
More informationNEW PARADIGM of BIOTECHNOLOGY - GENET BIO. GeNet Bio Global Gene Network
NEW PARADIGM of BIOTECHNOLOGY - GENET BIO GeNet Bio Global Gene Network GENET BIO DNA AMPLIFICATION PRODUCTS GUIDE Keynote of Products Prime TaqTM DNA Polymerase Prime TaqTM Premix ExPrime TaqTM DNA Polymerase
More informationPolymerase Chain Reaction PCR
1 Description of Module Subject Name Paper Name Module Name/Title Dr. Vijaya Khader Dr. MC Varadaraj 2 1. Objectives 1. To understand principle of 2. Types 3. Applications 2. Lay Out 3 Types of Qualitative
More informationBacterial Identification and Characterization
Bacterial Identification and Characterization Timothy R. Dambaugh, PhD DuPont Nutrition & Health Wilmington, Delaware USA INOFOOD2013 Santiago, Chile October 8, 2013 1 Campylobacter disease (C. jejuni
More informationApplied Biosystems Real-Time PCR Rapid Assay Development Guidelines
Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping
More informationOn-point Detection of GM Rice in 20 Minutes with Pullulan as CPA
Electronic Supplementary Material (ESI) for Analytical Methods. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information for On-point Detection of GM Rice in 20 Minutes
More information7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
More informationFastGene Optima. Products for PCR. proof-reading. ReadyMix. cdna SNP. routine PCR. polymerase. optimized blend complex templates. N gene knock out B O
Products for PCR www.nippongenetics.eu efficiency polymerase convenience endpoint PCR incl. loading dye direct PCR incl. dntps engineered enzyme archeal type B polymerase high GC content FastGene tissuebest
More informationBrilliant II SYBR Green QPCR Master Mix
Brilliant II SYBR Green QPCR Master Mix INSTRUCTION MANUAL Catalog #600828 (single kit) #600831 (10-pack kit) Revision B.01 For In Vitro Use Only 600828-12 LIMITED PRODUCT WARRANTY This warranty limits
More informationReverTra Ace qpcr RT Master Mix
Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template
More informationHigh Pure Technology and Silica Adsorption High Pure PCR Product Purification Kit
for purification of DNA from PCR reactions Cat. No. 1 73 668 (50 purifications) Cat. No. 1 73 676 (50 purifications) Principle In the presence of chaotropic salt, product DNA binds selectively to glass
More informationDiscussion Items. Microbial Indicators of Water Quality
Discussion Items! Announcements! Group Project topics! Discuss previous lab (Microbes in food) Results Lab report Isolates streak isolate by Thursday.! Microbial analysis of water (Tuesday) MPN and MF!
More informationIndex 327. Escherichia coli. food-borne pathogen, 66 Shiga toxin, see Shiga toxinproducing
Index 325 Index A Actinobacilus pleuropneumoniae, cultivation and typing, 87 PCR, detection in lung and nasal secretions, nested PCR, 93 overview, 91, 92 template preparation, 92, 94 identification and
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationHiPer Real-Time PCR Teaching Kit
HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from
More informationHighly efficient one-step PCR-based mutagenesis technique for large plasmids using high-fidelity DNA polymerase
Highly efficient one-step PCR-based mutagenesis technique for large plasmids using high-fidelity DNA polymerase H. Liu, R. Ye and Y.Y. Wang Department of Medical Microbiology and Parasitology, School of
More information10x Hot-Taq Buffer 1 ml 1 ml x 2ea 1 ml x 10ea. dntp Mix (each 10 mm) None / 0.2 ml None / 0.4 ml None / 0.4 ml x 5ea
HelixAmp TM Hot-Taq Polymerase (Ver. 2.0) CERTIFICATE OF ANALYSIS (1603-V01R03) Contents HelixAmp TM Hot-Taq Polymerase (Ver. 2.0) Cat. No. HT250/HT250N HT500/HT500N HT2500/HT2500N Hot-Taq (2.5 units/μl)
More informationGenomic DNA was extracted from 3 to 5 ml of blood collected in EDTA blood collection tubes
Supplementary information Methods DNA and RNA extraction Genomic DNA was extracted from to ml of blood collected in EDTA blood collection tubes using the Gentra Puregene Blood kit (Qiagen, California,
More informationPolymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr
Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr review Enzyme based DNA amplification Thermal Polymerarase derived from a thermophylic bacterium DNA dependant DNA polymerase
More informationEnteropathogenic Escherichia coli
Techne qpcr test Enteropathogenic Escherichia coli Intimin (eae) gene 150 tests For general laboratory and research use only 1 Introduction to Enteropathogenic Escherichia coli Escherichia coli (E. coli)
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More informationIntroduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationMastermix 16S Complete, DNA-free
Mastermix 16S Complete, DNA-free For the PCR detection and identification of bacteria using universal 16S rdna primers For research use only Cat. No. S-020-0100 Cat. No. S-020-0250 Cat. No. S-020-1000
More informationAmplification Products for PCR and RT-PCR
Selection guide Polymerase Hot start Comment UptiTherm DNA pol. no Most economic. Lower error rate than Taq polymerase Available in several formats, master mix including or not dntp, Mg 2+..., in gel format
More informationFor in vitro Veterinary Diagnostics only. Kylt E. coli F18, F41, Stx2e. Real-Time PCR Detection.
For in vitro Veterinary Diagnostics only. Kylt E. coli F18, F41, Stx2e Real-Time PCR Detection www.kylt.eu DIRECTION FOR USE Kylt E. coli F18, F41, Stx2e Real-Time PCR Detection A. General Kylt E. coli
More informationElectronic Supporting Information
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 Electronic Supporting Information Highly Sensitive and Multiplexed Quantification of mrna
More informationSYBR Premix Ex Taq II (Tli RNaseH Plus), ROX plus
Cat. # RR82LR For Research Use SYBR Premix Ex Taq II (Tli RNaseH Plus), ROX plus Product Manual The long-term storage temperature of this product has been changed to -20 since Lot. A1901A. See section
More informationGreenMasterMix (2X) b i o s c i e n c e. G E N A X X O N b i o s c i e n c e. High ROX (500nM)
G:\products\productflyer\pcr\polymerasen\hotstart\manu_m3052_green_en.docx GreenMasterMix (2) High RO (500nM) qpcr master mix with fluorescence dye and passive reference dye Contact & Technical support
More informationSupplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application
Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application SCD1 NM_173959.4 CACGCAAAAGCAGGCTCAGGA GCATCTGGGCTCTCAGACACT RT-qPCR ACC1
More informationIntroduction to Real-Time PCR: Basic Principles and Chemistries
Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the
More informationSYBR Real-Time PCR Kit
SYBR Real-Time PCR Kit For Amplification and detection of DNA in Quantitative real-time PCR (qpcr). Catalog No. QPG-040/QPG-041/QPG-042/QPG-043 User Manual Table of Contents Kit Contents and Storage...
More informationOne Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
More informationReal-time TaqMan PCR for Yersinia enterocolitica detection based on. the ail and foxa genes
JCM Accepts, published online ahead of print on 22 October 2014 J. Clin. Microbiol. doi:10.1128/jcm.02528-14 Copyright 2014, American Society for Microbiology. All Rights Reserved. 1 2 3 4 Real-time TaqMan
More informationOptimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design
Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design The Polymerase Chain Reaction (PCR) is a powerful technique used for the amplification of a specific segment of a nucleic acid
More informationKayhan Azadmanesh MD, Ph.D. Virology Department
Principles of molecular tests Kayhan Azadmanesh MD, Ph.D. Virology Department Pasteur Institute t of Iran 1 DNA molecule (1954) 2 Southern Blot (1975) 3 We needed to know the sequence of the genes and
More informationPrimeScript RT Master Mix (Perfect Real Time)
Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.
More informationDEC PCR KIT. SSI Diagnostica
DEC PCR KIT SSI Diagnostica 2 DEC PCR Kit for PCR Detection of Diarrhoeagenic E. coli (DEC) for in vitro diagnostic use Application The DEC PCR Kit is for in vitro diagnostic PCR detection of diarrhoeagenic
More informationDevelopment of PMA-LAMP for Rapid Detection of Staphylococcus aureus in Viable but Nonculturable State
2016 Joint International Conference on Social Science and Environmental Science (SSES 2016) and International Conference on Food Science and Engineering (ICFSE 2016) ISBN: 978-1-60595-390-8 Development
More informationPulseNet MLVA protocols General overview
PulseNet MLVA protocols General overview Eija Trees, Ph.D., D.V.M. PulseNet Methods Development and Reference Unit Enteric Diseases Laboratory Branch CDC, Atlanta, GA 1 Multiple-Locus VNTR Analysis (MLVA)
More informationEfficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application
Efficient Method for Isolation of High Quality Concentrated Cellular RNA with Extremely Low Levels of Genomic DNA Contamination Application Gene Expression Authors Ilgar Abbaszade, Claudia Robbins, John
More informationRNA-direct Realtime PCR Master Mix
Instruction manual RNA-direct Realtime PCR Master Mix 0803 F0929K RNA-direct Realtime PCR Master Mix Contents [1] Introduction [2] Components [3] Primer/Probe design [4] Detection [5] Specimens [6] Protocol
More informationPRODUCT INFORMATION Thermo Scientific Luminaris Probe Low ROX qpcr Master Mix #K0944 For 5000 rxns Lot Expiry Date Store at -20 C in the dark CERTIFICATE OF ANALYSIS The absence of endo-, exodeoxyribonucleases
More informationmirna QPCR Master Mix
mirna QPCR Master Mix Instruction Manual Catalog #600583 Revision B Research Use Only. Not for Use in Diagnostic Procedures. 600583-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement
More informationPolymerase Chain Reaction-361 BCH
Polymerase Chain Reaction-361 BCH 1-Polymerase Chain Reaction Nucleic acid amplification is an important process in biotechnology and molecular biology and has been widely used in research, medicine, agriculture
More informationCalifornia Institute of Technology. Directed evolution. Dr. F.H. Arnold s lab
Directed evolution. Dr. F.H. Arnold s lab May 4, 1999 Mutagenic PCR -[Mn] The amount of Mn used in the reaction should be titrated to produce the desired mutagenic rate. Libraries that have close to 30%
More informationBrilliant II Fast SYBR Green QPCR Master Mix
Brilliant II Fast SYBR Green QPCR Master Mix INSTRUCTION MANUAL Catalog #600843 (single kit) #600844 (10-pack kit) Revision B.01 For In Vitro Use Only 600843-12 LIMITED PRODUCT WARRANTY This warranty limits
More informationMultiplex sample-to-answer detection of bacteria using a pipette-actuated
Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2018 Supplementary information Multiplex sample-to-answer detection of bacteria using a pipette-actuated
More informationHLA-DR TYPING OF GENOMIC DNA
HLA-DR TYPING OF GENOMIC DNA Zofia SZCZERKOWSKA, Joanna WYSOCKA Institute of Forensic Medicine, Medical University, Gdañsk, Poland ABSTRACT: Advances in molecular biology techniques allowed for introduction
More informationFOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual RNA-direct SYBR Green Realtime PCR Master Mix 0810 F0930K RNA-direct SYBR Green Realtime PCR Master Mix Contents QRT-201T QRT-201 0.5mLx2 0.5mLx5 Store at -20 C, protected from light
More informationAll-in-One qpcr Mix. User Manual. For universal quantitative real-time PCR
All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000 qpcr reactions) Cat. No. AOPR-1200
More informationEvaluation of the genesig q16 quantitative PCR unit
Primer design Evaluation of the genesig q16 quantitative PCR unit 1 Evaluation of the genesig q16 quantitative PCR unit for the detection of three anaerobic beer spoilage bacteria. Executive summary The
More informationPolymerase Chain Reaction PCR
Polymerase Chain Reaction PCR What is PCR? An in vitro process that detects, identifies, and copies (amplifies) a specific piece of DNA in a biological sample. Discovered by Dr. Kary Mullis in 1983. A
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More informationA Recommended Procedure for Real-Time Quantitative TaqMan PCR for Roundup Ready Canola RT73 Monsanto Biotechnology Regulatory Sciences
Page 1 of 7 Overview Purpose & Scope This procedure describes an event-specific real-time TaqMan PCR method for determination of the relative content of Roundup Ready canola RT73 (hereafter referred to
More informationProcomcure Biotech. PCR Reagents
Procomcure Biotech PCR Reagents valid for 2018 VitaTaq DNA Polymerase is a standard Taq DNA polymerase suitable for all common PCR applications like colonypcr, cloning applications, high-throughput PCR
More informationRandomly arrayed G-rich DNA sequence for label-free and realtime. assay of enzyme activity
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Randomly arrayed G-rich DNA sequence for label-free and realtime assay of enzyme activity Zhuoliang
More informationSupplemental Materials. DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC
Supplemental Materials DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC BAA-1523 = JCM 15061) was grown in defined basal medium amended with 0.5 mm 1,1,2- trichloroethane (1,1,2-TCA)
More informationOverview: The DNA Toolbox
Overview: The DNA Toolbox Sequencing of the genomes of more than 7,000 species was under way in 2010 DNA sequencing has depended on advances in technology, starting with making recombinant DNA In recombinant
More informationAttostar T4 Bacteriophage As a DNA extraction and PCR control
Attostar T4 Bacteriophage As a DNA extraction and PCR control Overview:... 2 Products Catalog No. Quantity... 2 AttoMaster 2X Mix for qpcr AM10 1.25 ml... 2 T4 bacteriophage DNase resistant BAC130 0.5
More informationOur world as food scientists has changed already. The most recent
2 By Jim Byron In a time of drastic change, it is the learners who inherit the future. The learned usually find themselves equipped to live in a world that no longer exists. Eric Hoffer Our world as food
More informationQ-PCR QUANTITATIVE-PCR 세포생물학및실험 2 박태식교수님
Q-PCR QUANTITATIVE-PCR 세포생물학및실험 2 박태식교수님 Title : Study that the Drug A inhibits the accumulation of fat. Schedules 1. Mouse necropsy : take up the blood and major tissues(organs) ex) heart, liver, fat,
More information