In mice: V H ~250 D ~15 J ~5. L 1 -V H1 -L 2 -V H2 -L 3 -V H3 ---L n -V Hn ----D 1 -D 2 -D 3 ---D n ----J 1 -J J n V L ~250 J ~4
|
|
- Loren Hunter
- 6 years ago
- Views:
Transcription
1 Lecture 14 ymes Cont. ymes preferentially stabilize transitions states versus ground states ite directed mutagenesis (Tyr ta synthetase) Transition state analogue inhibitors Design of protein active sites that stabilize the transition state CDs have large sequence variation (protypic diversity system) 1. multiple germline V genes light chain V, J; heavychain V, D, J In mice: V ~250 D ~15 J ~5 Antibodies V L 1 V 1 L 2 V 2 L 3 V 3 L n V n D 1 D 2 D 3 D n J 1 J 2 J n Antibody IgG light chain C L heavy chain 250 AAs C 1 C 2 C 3 constant region variable region (125 AAs) Binding site for antigen, consists of 6 hypervariable loops, 3 from light chain, 3 from heavy chain LV 1 D 2 J 1 V L ~250 J ~4 V L LV L1 LV n J 1 J 2 J n splice together in different combinations in mice ~20,000 different combinations (combinatorial diversity) 2. recombination inaccuracy When you combine D genes insertions and deletions can occur ften use smaller fragments: Fab fragment V scfv fragment CCC CCC TGG Pro Pro Trp joining region C 1 C L CD2 (5865) V L sheet GGG linker C between V L /V gives: CCC CGG Pro Arg near joining region 3. somatic mutation, 320 point mutations into the germline variable regnion to increase affinity. Germiline diversity of ~10 8 variable regions V region point mutations, affinity maturation M 1 CD1 (3036) 4. multiple constant regions Loop CD3 (95109) IgM IgD IgG IgE IgA Antibodies are expressed at the surface of preb cells. When an antigen binds it crosslinks two antibodies on the surface, sending signals to the B cell to proliferate & undergo somatic mutation.
2 Antibodies as catalysts yme have evolved maximal affinity towards T For more complex reactions: Ex. Cope rearrangement ow would you make an enzymelike catalyst for the reaction: sec + Make antibodies to: k cat /k uncat ~10 4 Want an immunogen like: ammond's postulate: for high energy intermediates, the structure of the transition state is similar to that of the intermediate P transition state analogue: tetrahedral, negativelycharged, stable Take albumin, covalently attach the ligand P k cat /k uncat =~
3 Ex. Aldol eaction: ' ' yme catalysis: 1. T stabilization 2. proximity effects 3. covalent catalysis 4. general acid base catalysis 5. cofactors pk a ~20 ymes make a chiffbase: 2 Make an immunogen: ' If any antibodies have a Lysine in the binding pocket: 4. General base catalysis Logk = Bronsted coefficient (pk a ) + C PLP catalyzed reactions: Lys Lys Asp ote pk a is ~67, Lys ~10 Lys C 2 2 C 2 k cat 3 C 2 C 2 C 2 LysE C 2 ' tautomerize ' table adduct 2 C k cat /k m ~10 9 k uncat
4 trategy mutate K258A inactive (with respect to + transfer) <10 6 of wt activity no large changes observed in crystal structure "rescue" activity with exogenous amines Use Lcysteine sulfinate as substrate (Asp analog with greater reactivity) 2 C C 3 + Asp yme Inhibitors: antibiotics Ex. ulfadrugs 2 2 reduced in vivo e / Prodrug chanism of action: paraaminosulfonamide esults linear dependence of rate versus [amine] plot of logk vs pk a was poor plot of log k vs "A 3 " Linear (/Et/Pr/Bu) with same pk a (~10.6) therefore use double linear plot: logk B = = (pk a ) + V + C V =( ) 3 c= % of full + charge on Lys 258 in T total variation: 10x greater due to volume than k cat due to basicity points to the effect of cavities/steric effects 2 2 F 3 C C dihydropteroate synthesis P P 2 dihydrofolate Bacteria utilize paraaminosulfonamide and substitute it into dihydrofolate synthesis, resulting in an inactive cofacter. 2 2
5 Ex. lactam penicillins Cell wall biosynthesis: DAla DAla AGAMAG LAla DyGlu L Lys (Gly) 5 2 Fast er (transpeptidase) L Lys (Gly) 5 2 er 2 (Gly) 5 Lys L cytoplasm C 2 cell wall biosynthesis enzymes porins L Lys (Gly) 5 2 (Gly) Lys 5 L inner membrane outer membrane mimic : C 2 peptidoglycan with: C 2 For resistance make a transpeptidase C 2 lactamase er C 2 er C 2 inactivated enzyme er C 2 slow deacylation C 2 2 yme catalyzed fast! C 2
GENETIC BASIS OF ANTIBODY STRUCTURE AND DIVERSITY. Steven J. Norris, Ph.D
GENETIC BASIS OF ANTIBODY STRUCTURE AND DIVERSITY Steven J. Norris, Ph.D Topics I. General principles II. The heavy chain Ig locus and VDJ rearrangement III. Light chain rearrangement. IV. Mechanisms of
More informationIMMUNOGLOBULIN GENES UNDERGO TWO DNA REARRANGEMENTS
A Prototype Ig Gene: Murine Kappa About 10 0 V κ gene segments 4 J Gene Segment s 1 C κ Gene Segmen t Multiple V gene segments, distant from J and C A few J gene segments One C gene segment GERMLINE Ig
More informationImmunoglobulins. Harper s biochemistry Chapter 49
Immunoglobulins Harper s biochemistry Chapter 49 Immune system Detects and inactivates foreign molecules, viruses, bacteria and microorganisms Two components with 2 strategies B Lymphocytes (humoral immune
More informationChapter 5. Genetic Models. Organization and Expression of Immunoglobulin Genes 3. The two-gene model: Models to Explain Antibody Diversity
Chapter 5 Organization and Expression of Immunoglobulin Genes 3 4 5 6 Genetic Models How to account for: ) Vast diversity of antibody specificities ) Presence of Variable regions at the amino end of Heavy
More informationEnzymes Part III: regulation I. Dr. Mamoun Ahram Summer, 2017
Enzymes Part III: regulation I Dr. Mamoun Ahram Summer, 2017 Mechanisms of regulation Expression of isoenzymes Regulation of enzymatic activity Inhibitors Conformational changes Allostery Modulators Reversible
More informationAntibody Structure. Antibodies
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
More informationAntibody Structure supports Function
Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against
More informationChapter 4. Antigen Recognition by B-cell and T-cell Receptors
Chapter 4 Antigen Recognition by B-cell and T-cell Receptors Antigen recognition by BCR and TCR B cells 2 separate functions of immunoglobulin (Ig) bind pathogen & induce immune responses recruit cells
More informationSpeaker: Yu-Chen Ku Professor: Ching-Tsan Huang, Ph. D. Source: Biochemical Journal (2007) 402, Date: December 4th, 2007
Directed evolution and structural analysis of N-carbamoyl-D-amino acid amidohydrolase provide insights into recombinant protein solubility in Escherichia coli Speaker: Yu-Chen Ku Professor: Ching-Tsan
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationMutagenesis. Classification of mutation. Spontaneous Base Substitution. Molecular Mutagenesis. Limits to DNA Pol Fidelity.
Mutagenesis 1. Classification of mutation 2. Base Substitution 3. Insertion Deletion 4. s 5. Chromosomal Aberration 6. Repair Mechanisms Classification of mutation 1. Definition heritable change in DNA
More informationEnzymes III. Dr. Kevin Ahern
Enzymes III Dr. Kevin Ahern Enzyme Inhibition Enzyme Inhibition Competitive Inhibitor Resembles Natural Substrate and Competes with it for Binding to the Active Site Enzyme Inhibition Normal Substrate
More informationAB. ANTIBODY CATALYSIS
AB. ANTIBODY CATALYSIS By 1947 it had become clear that proteins are responsible for carrying out the majority of biological functions of interest. Two common modes of action by proteins were known. Receptors
More information1 Name. 1. (3 pts) What is apoptosis and how does it differ from necrosis? Which is more likely to trigger inflammation?
1 Name MCB 150 Midterm Eam #1 (100 points total) Please write your full name on each page of the eam!! The eam consists of 17 questions (6 pages). Each has a different point count as indicated. Please
More informationDNA Begins the Process
Biology I D N A DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells DNA Begins the Process
More informationLECTURE: 22 IMMUNOGLOBULIN DIVERSITIES LEARNING OBJECTIVES: The student should be able to:
LECTURE: 22 Title IMMUNOGLOBULIN DIVERSITIES LEARNING OBJECTIVES: The student should be able to: Identify the chromosome that contains the gene segments that encode the surface immunoglobulin heavy chain
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Exam Chapter 17 Genes to Proteins Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. The following questions refer to Figure 17.1, a simple metabolic
More informationGerm-line vs somatic-variation theories
BME 128 Tuesday April 26 (1) Filling in the gaps Antibody diversity, how is it achieved? - by specialised (!) mechanisms Chp6 (Protein Diversity & Sequence Analysis) - more about the main concepts in this
More informationDisease and selection in the human genome 3
Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression
More informationENZYMES. Unit 3 - Energy
ENZYMES Unit 3 - Energy What is an enzyme? What do they do? What is an enzyme? What do they do? Key Things to remember: They are proteins They are catalysts They are reusable - not consumed in reaction
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationAtlas of Genetics and Cytogenetics in Oncology and Haematology. IMMUNOGLOBULIN GENES: CONCEPT OF DNA REARRANGEMENT * Introduction
Atlas of Genetics and Cytogenetics in Oncology and Haematology IMMUNOGLOBULIN GENES: CONCEPT OF DNA REARRANGEMENT * Introduction I Historical questions II Answers II.1 Light chains (kappa or lambda) II.1.1
More informationDegenerate Code. Translation. trna. The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism
Translation The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism Degenerate Code There are 64 possible codon triplets There are 20 naturally-encoding amino acids Several codons specify
More informationLecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
More informationMOLECULAR RECOGNITION
MOLECULAR RECOGNITION Bioanalytical Methods Classification 1. Biassay: molecular recognition, signal generation and detection in solution or on inert solid phase 2. Biosensor: molecular recognition system
More informationIn vitro cultures of bone marrow stromal cells and progenitor B cells can accurately recapitulate the normal steps of B cell development.
Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina, Tim, and I encourage all confused
More informationB cell development The stages of B cell development
Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina, Tim, and I encourage all confused
More informationBig Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
More informationCHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES
CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES I. Introduction A. No operon structures in eukaryotes B. Regulation of gene expression is frequently tissue specific.
More informationIntroduction to Proteins
Introduction to Proteins Lecture 4 Module I: Molecular Structure & Metabolism Molecular Cell Biology Core Course (GSND5200) Matthew Neiditch - Room E450U ICPH matthew.neiditch@umdnj.edu What is a protein?
More informationSPHERO TM Coated Particles
SPHERO TM Coated Particles Manufactured by either passive adsorption or covalent coupling depending upon the intended application Stable for several years under proper storage condition Available in a
More informationبسم هللا الرحمن الرحيم. Today we're going to talk about the generation of diversity of the receptors of the lymphocytes
بسم هللا الرحمن الرحيم Today we're going to talk about the generation of diversity of the receptors of the lymphocytes The receptors of lymphocytes are : 1. B cells : immunoglobulins ; which are cell bound
More informationBIO303, Genetics Study Guide II for Spring 2007 Semester
BIO303, Genetics Study Guide II for Spring 2007 Semester 1 Questions from F05 1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with high levels of 5- Bromouracil such that
More informationIntroducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
More informationProblem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.
Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose
More information7.06 Cell Biology QUIZ #3
Recitation Section: 7.06 Cell Biology QUIZ #3 This is an open book exam, and you are allowed access to books and notes, but not computers or any other types of electronic devices. Please write your answers
More informationImmunoglobulins Harry W Schroeder Jr MD PhD
Immunoglobulins Harry W Schroeder Jr MD PhD Division of Developmental and Clinical Immunology Departments of Medicine, Microbiology, and Genetics University of Alabama at Birmingham Immunoglobulin Has
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationBasic Antibody Structure. Multiple myeloma = cancerous plasma cells Monomer = 150,000. Chapter 4. Immunoglobulin Structure and Function
Chapter 4. Immunoglobulin Structure and Function. Functional Regions. Types of chains. Constant & Variable regions 4. Glycoprotein * * * Heavy chain= 446 aa Light chain= 4aa Each heavy and light chain
More information7.014 Quiz II Handout
7.014 Quiz II Handout Quiz II: Wednesday, March 17 12:05-12:55 54-100 **This will be a closed book exam** Quiz Review Session: Friday, March 12 7:00-9:00 pm room 54-100 Open Tutoring Session: Tuesday,
More informationMATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class
More informationThe Stringent Response
The Stringent Response When amino acids are limiting a response is triggered to shut down a wide range of biosynthetic processes This process is called the Stringent Response It results in the synthesis
More informationSTRUCTURAL BIOLOGY. α/β structures Closed barrels Open twisted sheets Horseshoe folds
STRUCTURAL BIOLOGY α/β structures Closed barrels Open twisted sheets Horseshoe folds The α/β domains Most frequent domain structures are α/β domains: A central parallel or mixed β sheet Surrounded by α
More informationChallenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor
Calcium Signals in Biological Systems Lecture 3 (2/9/0) Measuring intracellular Ca 2+ signals II: Genetically encoded Ca 2+ sensors Henry M. Colecraft, Ph.D. Challenges to measuring intracellular Ca 2+
More informationCHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein
CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to
More informationINTRODUCTION TO THE MOLECULAR GENETICS OF THE COLOR MUTATIONS IN ROCK POCKET MICE
The Making of the The Fittest: Making of the Fittest Natural Selection Natural and Adaptation Selection and Adaptation Educator Materials TEACHER MATERIALS INTRODUCTION TO THE MOLECULAR GENETICS OF THE
More informationIntroduction to Protein Purification
Introduction to Protein Purification 1 Day 1) Introduction to Protein Purification. Input for Purification Protocol Development - Guidelines for Protein Purification Day 2) Sample Preparation before Chromatography
More informationAntibodies and Antigens in the Blood Bank 9/7/2015 NAHLA BAKHAMIS 1
Antibodies and Antigens in the Blood Bank NAHLA BAKHAMIS 9/7/2015 NAHLA BAKHAMIS 1 Outline Antibodies structure, classes and functions Most important Abs in the blood bank effective roles of Abs Zeta potential
More informationMolecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
More informationProtein homology. Antigens & Antibodies I. Administrative issues:
Administrative issues: Recommended text: Goldsby/Kuby Immunology, 6th edition (Note that Innate Immunity is not adequately covered in the 5th edition.) Text book reading assignments are to supplement the
More informationT and B cell gene rearrangement October 17, Ram Savan
T and B cell gene rearrangement October 17, 2016 Ram Savan savanram@uw.edu 441 Lecture #9 Slide 1 of 28 Three lectures on antigen receptors Part 1 (Last Friday): Structural features of the BCR and TCR
More informationIn other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0.
In other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0. There are a number of shorthand abbreviations a linear polymer of deoxyribonucleotides. One
More information7.014 Quiz II 3/18/05. Write your name on this page and your initials on all the other pages in the space provided.
7.014 Quiz II 3/18/05 Your Name: TA's Name: Write your name on this page and your initials on all the other pages in the space provided. This exam has 10 pages including this coversheet. heck that you
More information4 Themes in B cell development + Ig class switch and somatic mutation Tony DeFranco, 10/28/13 Checkpoints in B cell development: feedback from Ig
4 Themes in B cell development + Ig class switch and somatic mutation Tony DeFranco, 10/28/13 Checkpoints in B cell development: feedback from Ig gene rearrangements Lineage commitment: transcription factors
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationFrom Gene to Protein. How Genes Work (Ch. 17)
From Gene to Protein How Genes Work (Ch. 17) What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA proteins cells bodies The Central
More informationBiomolecules: lecture 6
Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized
More informationA Modified Digestion-Circularization PCR (DC-PCR) Approach to Detect Hypermutation- Associated DNA Double-Strand Breaks
A Modified Digestion-Circularization PCR (DC-PCR) Approach to Detect Hypermutation- Associated DNA Double-Strand Breaks SARAH K. DICKERSON AND F. NINA PAPAVASILIOU Laboratory of Lymphocyte Biology, The
More informationProteoGenix. Life Sciences Services and Products. From gene to biotherapeutics Target Validation to Lead optimisation
ProteoGenix Life Sciences Services and Products From gene to biotherapeutics Target Validation to Lead optimisation ProteoGenix Philippe FUNFROCK, founder and CEO French company located in Strasbourg,
More informationproduces an RNA copy of the coding region of a gene
1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the
More informationANTIBODIES. Agents of Immunity
ANTIBODIES Agents of Immunity - Antibodies are: The Organization What are they? Protective agents of the immune system Neutralize foreign agents called antigens Essential part of the Adaptive Immune System
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More information(a) Rearrange the Michaelis Menten equation to give V 0 as a function of V 0 /[S]. (b) What is the significance of the slope, the vertical intercept,
1. Active yet responsive. What is the biochemical advantage of having a K M approximately equal to the substrate con- centration normally available to an enzyme? 2. Destroying the Trojan horse. Penicillin
More informationBi 8 Lecture 7. Ellen Rothenberg 26 January Reading: Ch. 3, pp ; panel 3-1
Bi 8 Lecture 7 PROTEIN STRUCTURE, Functional analysis, and evolution Ellen Rothenberg 26 January 2016 Reading: Ch. 3, pp. 109-134; panel 3-1 (end with free amine) aromatic, hydrophobic small, hydrophilic
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationCambridge International Examinations Cambridge International Advanced Subsidiary and Advanced Level
Cambridge International Examinations Cambridge International Advanced Subsidiary and Advanced Level *2249654089* BIOLOGY 9700/21 Paper 2 AS Level Structured Questions October/November 2016 1 hour 15 minutes
More informationDNA.notebook March 08, DNA Overview
DNA Overview Deoxyribonucleic Acid, or DNA, must be able to do 2 things: 1) give instructions for building and maintaining cells. 2) be copied each time a cell divides. DNA is made of subunits called nucleotides
More informationMicrobial Metabolism. PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R
PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R 5 Microbial Metabolism Big Picture: Metabolism Metabolism is the buildup and breakdown of nutrients
More informationProblem Set 4
7.016- Problem Set 4 Question 1 Arginine biosynthesis is an example of multi-step biochemical pathway where each step is catalyzed by a specific enzyme (E1, E2 and E3) as is outlined below. E1 E2 E3 A
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More information7.013 Problem Set 3 FRIDAY October 8th, 2004
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert. Weinberg, Dr. laudette ardel Name: T: 7.013 Problem Set 3 FRIDY October 8th, 2004 Problem
More informationChem 465 Biochemistry II
Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Which of the following is not true of trna molecules? A) The 3'-terminal sequence is -CCA. B) Their anticodons are complementary
More informationwww.lessonplansinc.com Topic: Gene Mutations WS Summary: Students will learn about frame shift mutations and base substitution mutations. Goals & Objectives: Students will be able to demonstrate how mutations
More informationChapter 13: Biotechnology
Chapter Review 1. Explain why the brewing of beer is considered to be biotechnology. The United Nations defines biotechnology as any technological application that uses biological system, living organism,
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationProtein Synthesis. Application Based Questions
Protein Synthesis Application Based Questions MRNA Triplet Codons Note: Logic behind the single letter abbreviations can be found at: http://www.biology.arizona.edu/biochemistry/problem_sets/aa/dayhoff.html
More informationPurification of (recombinant) proteins. Pekka Lappalainen, Institute of Biotechnology, University of Helsinki
Purification of (recombinant) proteins Pekka Lappalainen, Institute of Biotechnology, University of Helsinki Physical properties of proteins that can be applied for purification -size -charge (isoelectric
More informationSection 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?
Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist
More informationGeneration of Recombinant Antibodies and Means for Increasing Their Affinity
ISSN 0006-2979, Biochemistry (Moscow), 2010, Vol. 75, No. 13, pp. 1584-1605. Pleiades Publishing, Ltd., 2010. Original Russian Text E. P. Altshuler, D. V. Serebryanaya, A. G. Katrukha, 2010, published
More informationImmunoglobulins. Light chain ~22-23 KDa whereas the heavy chain ~55-60 KDa
Immunoglobulins Immunoglobulin (Ig) has a common name which is "Antibody (Ab)", but actually we should say Ig, why? Because the proteins, which are involved, are actually globular proteins "known as globulins"
More informationDr. Jeffrey P. Thompson bio350
Chapter 8 Enzymes Green light GFP Blue light Modern day catalysis Catalysis (reaction promotion) may have gotten its beginning g in an RNA- dominated world. Most catalysis today has evolved into using
More informationDNA Replication and Transcription: Biosynthesis of DNA and RNA 阮雪芬
DNA Replication and Transcription: Biosynthesis of DNA and RNA 阮雪芬 2004/05/21 @NTU Outline Introduction Replication of DNA Action of DNA Polymerases DNA Damage and Repair Synthesis of RNA Post-transcriptional
More informationChapter 2 - DNA MC [37 marks]
Chapter 2 - N MC [37 marks] 1. The image shows a N nucleotide. Which correctly identifies the parts labelled I and II? C 2. Which model represents transcription? 3. Which sequence represents the order
More informationImmunogenicity of Therapeutic Proteins. Steven J Swanson, Ph.D. Executive Director, Clinical Immunology
Immunogenicity of Therapeutic Proteins Steven J Swanson, Ph.D. Executive Director, Clinical Immunology swanson@amgen.com Causes of Immunogenicity Sequence differences between therapeutic protein and endogenous
More information466 Asn (N) to Ala (A) Generate beta dimer Interface
Table S1: Amino acid changes to the HexA α-subunit to convert the dimer interface from α to β and to introduce the putative GM2A binding surface from β- onto the α- subunit Residue position (α-numbering)
More informationBIOLOGY. Chapter 15 Genes & Proteins
BIOLOGY Chapter 15 Genes & Proteins CMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 17 Protein Synthesis 2014 Pearson Education, Inc. Fig. 17-1 Figure 17.1a n albino racoon Condition
More informationEnzymes and Coenzymes I. Dr. Sumbul Fatma Clinical Chemistry Unit Department of Pathology
Enzymes and Coenzymes I Dr. Sumbul Fatma Clinical Chemistry Unit Department of Pathology What are Enzymes? Enzymes are biological catalysts that speed up the rate of a reaction without being changed in
More informationAntibodies and Antigens In the blood bank
Antibodies and Antigens In the blood bank 1 Nice game!! http://nobelprize.org/ 2 Karl Landsteiner discovered blood groups in 1901. Awarded Nobel Prize for Physiology or Medicine in 1930 3 Why we study
More informationCombinatorial RNA libraries
SELEX and Artificial Ribozymes Some definitions SELEX: Systematic Evolution of Ligands by EXponential Enrichment (alternatively: in vitro selection, in vitro evolution) Aptamer: nucleic acid ligand (from
More informationCellular [mrna] depends on synthesis and degradation. RNA-dependent DNA and RNA synthesis. Reverse transcriptase
Chem 431c-Lecture 7c Reminder: Midterm is Wednesday, Nov. 18,2009 On Chapters 25 and 26 Chapter 26: Reverse retroviruses Telomerase RNA replicase RNA World Selex Copyright 2004 by W. H. Freeman & Company
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationChapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus".
Chapter 13 The Nucleus The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus". Fig.13.1. The EM of the Nucleus of a Eukaryotic Cell 13.1. The Nuclear Envelope
More informationMutations and Disease
Mutations and Disease Objectives and lecture plan Describe what are mutations Explain how do we identify mutations Explain how and why mutant proteins lead to disease Describe what kinds of DNA mutations
More information1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
More informationSolutions to Quiz II
MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Solutions to 7.014 Quiz II Class Average = 79 Median = 82 Grade Range % A 90-100 27 B 75-89 37 C 59 74 25 D 41 58 7 F 0 40 2 Question 1
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationBIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
More information14 Gene Expression: From Gene to Protein
CMPBELL BIOLOY IN FOCS rry Cain Wasserman Minorsky Jackson Reece 14 ene Expression: From ene to Protein Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge Overview: The Flow of enetic Information
More informationFrom Gene to Phenotype- part 3. Lecture Outline 11/9/05. The genetic code. Translation: overview
DN mrn From ene to Phenotype- part 3 TRNSRIPTION DN 1 RN is transcribed from a DN template. 5 RN RN transcript polymerase RN PROESSIN Exon 2 In eukaryotes, the RN transcript RN transcript (premrn) is spliced
More informationMMG 301, Lec. 25 Mutations and Bacteriophage
MMG 301, Lec. 25 Mutations and Bacteriophage Questions for today: 1. What are mutations and how do they form? 2. How are mutant bacteria used in research? 3. What are the general properties of bacteriophage
More information