In mice: V H ~250 D ~15 J ~5. L 1 -V H1 -L 2 -V H2 -L 3 -V H3 ---L n -V Hn ----D 1 -D 2 -D 3 ---D n ----J 1 -J J n V L ~250 J ~4

Size: px
Start display at page:

Download "In mice: V H ~250 D ~15 J ~5. L 1 -V H1 -L 2 -V H2 -L 3 -V H3 ---L n -V Hn ----D 1 -D 2 -D 3 ---D n ----J 1 -J J n V L ~250 J ~4"

Transcription

1 Lecture 14 ymes Cont. ymes preferentially stabilize transitions states versus ground states ite directed mutagenesis (Tyr ta synthetase) Transition state analogue inhibitors Design of protein active sites that stabilize the transition state CDs have large sequence variation (protypic diversity system) 1. multiple germline V genes light chain V, J; heavychain V, D, J In mice: V ~250 D ~15 J ~5 Antibodies V L 1 V 1 L 2 V 2 L 3 V 3 L n V n D 1 D 2 D 3 D n J 1 J 2 J n Antibody IgG light chain C L heavy chain 250 AAs C 1 C 2 C 3 constant region variable region (125 AAs) Binding site for antigen, consists of 6 hypervariable loops, 3 from light chain, 3 from heavy chain LV 1 D 2 J 1 V L ~250 J ~4 V L LV L1 LV n J 1 J 2 J n splice together in different combinations in mice ~20,000 different combinations (combinatorial diversity) 2. recombination inaccuracy When you combine D genes insertions and deletions can occur ften use smaller fragments: Fab fragment V scfv fragment CCC CCC TGG Pro Pro Trp joining region C 1 C L CD2 (5865) V L sheet GGG linker C between V L /V gives: CCC CGG Pro Arg near joining region 3. somatic mutation, 320 point mutations into the germline variable regnion to increase affinity. Germiline diversity of ~10 8 variable regions V region point mutations, affinity maturation M 1 CD1 (3036) 4. multiple constant regions Loop CD3 (95109) IgM IgD IgG IgE IgA Antibodies are expressed at the surface of preb cells. When an antigen binds it crosslinks two antibodies on the surface, sending signals to the B cell to proliferate & undergo somatic mutation.

2 Antibodies as catalysts yme have evolved maximal affinity towards T For more complex reactions: Ex. Cope rearrangement ow would you make an enzymelike catalyst for the reaction: sec + Make antibodies to: k cat /k uncat ~10 4 Want an immunogen like: ammond's postulate: for high energy intermediates, the structure of the transition state is similar to that of the intermediate P transition state analogue: tetrahedral, negativelycharged, stable Take albumin, covalently attach the ligand P k cat /k uncat =~

3 Ex. Aldol eaction: ' ' yme catalysis: 1. T stabilization 2. proximity effects 3. covalent catalysis 4. general acid base catalysis 5. cofactors pk a ~20 ymes make a chiffbase: 2 Make an immunogen: ' If any antibodies have a Lysine in the binding pocket: 4. General base catalysis Logk = Bronsted coefficient (pk a ) + C PLP catalyzed reactions: Lys Lys Asp ote pk a is ~67, Lys ~10 Lys C 2 2 C 2 k cat 3 C 2 C 2 C 2 LysE C 2 ' tautomerize ' table adduct 2 C k cat /k m ~10 9 k uncat

4 trategy mutate K258A inactive (with respect to + transfer) <10 6 of wt activity no large changes observed in crystal structure "rescue" activity with exogenous amines Use Lcysteine sulfinate as substrate (Asp analog with greater reactivity) 2 C C 3 + Asp yme Inhibitors: antibiotics Ex. ulfadrugs 2 2 reduced in vivo e / Prodrug chanism of action: paraaminosulfonamide esults linear dependence of rate versus [amine] plot of logk vs pk a was poor plot of log k vs "A 3 " Linear (/Et/Pr/Bu) with same pk a (~10.6) therefore use double linear plot: logk B = = (pk a ) + V + C V =( ) 3 c= % of full + charge on Lys 258 in T total variation: 10x greater due to volume than k cat due to basicity points to the effect of cavities/steric effects 2 2 F 3 C C dihydropteroate synthesis P P 2 dihydrofolate Bacteria utilize paraaminosulfonamide and substitute it into dihydrofolate synthesis, resulting in an inactive cofacter. 2 2

5 Ex. lactam penicillins Cell wall biosynthesis: DAla DAla AGAMAG LAla DyGlu L Lys (Gly) 5 2 Fast er (transpeptidase) L Lys (Gly) 5 2 er 2 (Gly) 5 Lys L cytoplasm C 2 cell wall biosynthesis enzymes porins L Lys (Gly) 5 2 (Gly) Lys 5 L inner membrane outer membrane mimic : C 2 peptidoglycan with: C 2 For resistance make a transpeptidase C 2 lactamase er C 2 er C 2 inactivated enzyme er C 2 slow deacylation C 2 2 yme catalyzed fast! C 2

GENETIC BASIS OF ANTIBODY STRUCTURE AND DIVERSITY. Steven J. Norris, Ph.D

GENETIC BASIS OF ANTIBODY STRUCTURE AND DIVERSITY. Steven J. Norris, Ph.D GENETIC BASIS OF ANTIBODY STRUCTURE AND DIVERSITY Steven J. Norris, Ph.D Topics I. General principles II. The heavy chain Ig locus and VDJ rearrangement III. Light chain rearrangement. IV. Mechanisms of

More information

IMMUNOGLOBULIN GENES UNDERGO TWO DNA REARRANGEMENTS

IMMUNOGLOBULIN GENES UNDERGO TWO DNA REARRANGEMENTS A Prototype Ig Gene: Murine Kappa About 10 0 V κ gene segments 4 J Gene Segment s 1 C κ Gene Segmen t Multiple V gene segments, distant from J and C A few J gene segments One C gene segment GERMLINE Ig

More information

Immunoglobulins. Harper s biochemistry Chapter 49

Immunoglobulins. Harper s biochemistry Chapter 49 Immunoglobulins Harper s biochemistry Chapter 49 Immune system Detects and inactivates foreign molecules, viruses, bacteria and microorganisms Two components with 2 strategies B Lymphocytes (humoral immune

More information

Chapter 5. Genetic Models. Organization and Expression of Immunoglobulin Genes 3. The two-gene model: Models to Explain Antibody Diversity

Chapter 5. Genetic Models. Organization and Expression of Immunoglobulin Genes 3. The two-gene model: Models to Explain Antibody Diversity Chapter 5 Organization and Expression of Immunoglobulin Genes 3 4 5 6 Genetic Models How to account for: ) Vast diversity of antibody specificities ) Presence of Variable regions at the amino end of Heavy

More information

Enzymes Part III: regulation I. Dr. Mamoun Ahram Summer, 2017

Enzymes Part III: regulation I. Dr. Mamoun Ahram Summer, 2017 Enzymes Part III: regulation I Dr. Mamoun Ahram Summer, 2017 Mechanisms of regulation Expression of isoenzymes Regulation of enzymatic activity Inhibitors Conformational changes Allostery Modulators Reversible

More information

Antibody Structure. Antibodies

Antibody Structure. Antibodies Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against

More information

Antibody Structure supports Function

Antibody Structure supports Function Antibodies Secreted by B lymphocytes Great diversity and specificity: >10 9 different antibodies; can distinguish between very similar molecules Tag particles for clearance/destruction Protect against

More information

Chapter 4. Antigen Recognition by B-cell and T-cell Receptors

Chapter 4. Antigen Recognition by B-cell and T-cell Receptors Chapter 4 Antigen Recognition by B-cell and T-cell Receptors Antigen recognition by BCR and TCR B cells 2 separate functions of immunoglobulin (Ig) bind pathogen & induce immune responses recruit cells

More information

Speaker: Yu-Chen Ku Professor: Ching-Tsan Huang, Ph. D. Source: Biochemical Journal (2007) 402, Date: December 4th, 2007

Speaker: Yu-Chen Ku Professor: Ching-Tsan Huang, Ph. D. Source: Biochemical Journal (2007) 402, Date: December 4th, 2007 Directed evolution and structural analysis of N-carbamoyl-D-amino acid amidohydrolase provide insights into recombinant protein solubility in Escherichia coli Speaker: Yu-Chen Ku Professor: Ching-Tsan

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Mutagenesis. Classification of mutation. Spontaneous Base Substitution. Molecular Mutagenesis. Limits to DNA Pol Fidelity.

Mutagenesis. Classification of mutation. Spontaneous Base Substitution. Molecular Mutagenesis. Limits to DNA Pol Fidelity. Mutagenesis 1. Classification of mutation 2. Base Substitution 3. Insertion Deletion 4. s 5. Chromosomal Aberration 6. Repair Mechanisms Classification of mutation 1. Definition heritable change in DNA

More information

Enzymes III. Dr. Kevin Ahern

Enzymes III. Dr. Kevin Ahern Enzymes III Dr. Kevin Ahern Enzyme Inhibition Enzyme Inhibition Competitive Inhibitor Resembles Natural Substrate and Competes with it for Binding to the Active Site Enzyme Inhibition Normal Substrate

More information

AB. ANTIBODY CATALYSIS

AB. ANTIBODY CATALYSIS AB. ANTIBODY CATALYSIS By 1947 it had become clear that proteins are responsible for carrying out the majority of biological functions of interest. Two common modes of action by proteins were known. Receptors

More information

1 Name. 1. (3 pts) What is apoptosis and how does it differ from necrosis? Which is more likely to trigger inflammation?

1 Name. 1. (3 pts) What is apoptosis and how does it differ from necrosis? Which is more likely to trigger inflammation? 1 Name MCB 150 Midterm Eam #1 (100 points total) Please write your full name on each page of the eam!! The eam consists of 17 questions (6 pages). Each has a different point count as indicated. Please

More information

DNA Begins the Process

DNA Begins the Process Biology I D N A DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells DNA Begins the Process

More information

LECTURE: 22 IMMUNOGLOBULIN DIVERSITIES LEARNING OBJECTIVES: The student should be able to:

LECTURE: 22 IMMUNOGLOBULIN DIVERSITIES LEARNING OBJECTIVES: The student should be able to: LECTURE: 22 Title IMMUNOGLOBULIN DIVERSITIES LEARNING OBJECTIVES: The student should be able to: Identify the chromosome that contains the gene segments that encode the surface immunoglobulin heavy chain

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Exam Chapter 17 Genes to Proteins Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. The following questions refer to Figure 17.1, a simple metabolic

More information

Germ-line vs somatic-variation theories

Germ-line vs somatic-variation theories BME 128 Tuesday April 26 (1) Filling in the gaps Antibody diversity, how is it achieved? - by specialised (!) mechanisms Chp6 (Protein Diversity & Sequence Analysis) - more about the main concepts in this

More information

Disease and selection in the human genome 3

Disease and selection in the human genome 3 Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression

More information

ENZYMES. Unit 3 - Energy

ENZYMES. Unit 3 - Energy ENZYMES Unit 3 - Energy What is an enzyme? What do they do? What is an enzyme? What do they do? Key Things to remember: They are proteins They are catalysts They are reusable - not consumed in reaction

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Atlas of Genetics and Cytogenetics in Oncology and Haematology. IMMUNOGLOBULIN GENES: CONCEPT OF DNA REARRANGEMENT * Introduction

Atlas of Genetics and Cytogenetics in Oncology and Haematology. IMMUNOGLOBULIN GENES: CONCEPT OF DNA REARRANGEMENT * Introduction Atlas of Genetics and Cytogenetics in Oncology and Haematology IMMUNOGLOBULIN GENES: CONCEPT OF DNA REARRANGEMENT * Introduction I Historical questions II Answers II.1 Light chains (kappa or lambda) II.1.1

More information

Degenerate Code. Translation. trna. The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism

Degenerate Code. Translation. trna. The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism Translation The Code is Degenerate trna / Proofreading Ribosomes Translation Mechanism Degenerate Code There are 64 possible codon triplets There are 20 naturally-encoding amino acids Several codons specify

More information

Lecture 25 (11/15/17)

Lecture 25 (11/15/17) Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);

More information

MOLECULAR RECOGNITION

MOLECULAR RECOGNITION MOLECULAR RECOGNITION Bioanalytical Methods Classification 1. Biassay: molecular recognition, signal generation and detection in solution or on inert solid phase 2. Biosensor: molecular recognition system

More information

In vitro cultures of bone marrow stromal cells and progenitor B cells can accurately recapitulate the normal steps of B cell development.

In vitro cultures of bone marrow stromal cells and progenitor B cells can accurately recapitulate the normal steps of B cell development. Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina, Tim, and I encourage all confused

More information

B cell development The stages of B cell development

B cell development The stages of B cell development Regular Office Hours: Tuesdays 11-12 Extra office hours: Wed, Feb 7 12-1pm Thurs, Feb 8 11am-12 Fri, Feb 9 2-4pm I WILL NOT BE HOLDING OFFICE HOURS ON TUESDAY Feb 13!! Dina, Tim, and I encourage all confused

More information

Big Idea 3C Basic Review

Big Idea 3C Basic Review Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end

More information

CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES

CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES I. Introduction A. No operon structures in eukaryotes B. Regulation of gene expression is frequently tissue specific.

More information

Introduction to Proteins

Introduction to Proteins Introduction to Proteins Lecture 4 Module I: Molecular Structure & Metabolism Molecular Cell Biology Core Course (GSND5200) Matthew Neiditch - Room E450U ICPH matthew.neiditch@umdnj.edu What is a protein?

More information

SPHERO TM Coated Particles

SPHERO TM Coated Particles SPHERO TM Coated Particles Manufactured by either passive adsorption or covalent coupling depending upon the intended application Stable for several years under proper storage condition Available in a

More information

بسم هللا الرحمن الرحيم. Today we're going to talk about the generation of diversity of the receptors of the lymphocytes

بسم هللا الرحمن الرحيم. Today we're going to talk about the generation of diversity of the receptors of the lymphocytes بسم هللا الرحمن الرحيم Today we're going to talk about the generation of diversity of the receptors of the lymphocytes The receptors of lymphocytes are : 1. B cells : immunoglobulins ; which are cell bound

More information

BIO303, Genetics Study Guide II for Spring 2007 Semester

BIO303, Genetics Study Guide II for Spring 2007 Semester BIO303, Genetics Study Guide II for Spring 2007 Semester 1 Questions from F05 1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with high levels of 5- Bromouracil such that

More information

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome. Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

More information

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below.

Problem Set Unit The base ratios in the DNA and RNA for an onion (Allium cepa) are given below. Problem Set Unit 3 Name 1. Which molecule is found in both DNA and RNA? A. Ribose B. Uracil C. Phosphate D. Amino acid 2. Which molecules form the nucleotide marked in the diagram? A. phosphate, deoxyribose

More information

7.06 Cell Biology QUIZ #3

7.06 Cell Biology QUIZ #3 Recitation Section: 7.06 Cell Biology QUIZ #3 This is an open book exam, and you are allowed access to books and notes, but not computers or any other types of electronic devices. Please write your answers

More information

Immunoglobulins Harry W Schroeder Jr MD PhD

Immunoglobulins Harry W Schroeder Jr MD PhD Immunoglobulins Harry W Schroeder Jr MD PhD Division of Developmental and Clinical Immunology Departments of Medicine, Microbiology, and Genetics University of Alabama at Birmingham Immunoglobulin Has

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

Basic Antibody Structure. Multiple myeloma = cancerous plasma cells Monomer = 150,000. Chapter 4. Immunoglobulin Structure and Function

Basic Antibody Structure. Multiple myeloma = cancerous plasma cells Monomer = 150,000. Chapter 4. Immunoglobulin Structure and Function Chapter 4. Immunoglobulin Structure and Function. Functional Regions. Types of chains. Constant & Variable regions 4. Glycoprotein * * * Heavy chain= 446 aa Light chain= 4aa Each heavy and light chain

More information

7.014 Quiz II Handout

7.014 Quiz II Handout 7.014 Quiz II Handout Quiz II: Wednesday, March 17 12:05-12:55 54-100 **This will be a closed book exam** Quiz Review Session: Friday, March 12 7:00-9:00 pm room 54-100 Open Tutoring Session: Tuesday,

More information

MATH 5610, Computational Biology

MATH 5610, Computational Biology MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class

More information

The Stringent Response

The Stringent Response The Stringent Response When amino acids are limiting a response is triggered to shut down a wide range of biosynthetic processes This process is called the Stringent Response It results in the synthesis

More information

STRUCTURAL BIOLOGY. α/β structures Closed barrels Open twisted sheets Horseshoe folds

STRUCTURAL BIOLOGY. α/β structures Closed barrels Open twisted sheets Horseshoe folds STRUCTURAL BIOLOGY α/β structures Closed barrels Open twisted sheets Horseshoe folds The α/β domains Most frequent domain structures are α/β domains: A central parallel or mixed β sheet Surrounded by α

More information

Challenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor

Challenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor Calcium Signals in Biological Systems Lecture 3 (2/9/0) Measuring intracellular Ca 2+ signals II: Genetically encoded Ca 2+ sensors Henry M. Colecraft, Ph.D. Challenges to measuring intracellular Ca 2+

More information

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to

More information

INTRODUCTION TO THE MOLECULAR GENETICS OF THE COLOR MUTATIONS IN ROCK POCKET MICE

INTRODUCTION TO THE MOLECULAR GENETICS OF THE COLOR MUTATIONS IN ROCK POCKET MICE The Making of the The Fittest: Making of the Fittest Natural Selection Natural and Adaptation Selection and Adaptation Educator Materials TEACHER MATERIALS INTRODUCTION TO THE MOLECULAR GENETICS OF THE

More information

Introduction to Protein Purification

Introduction to Protein Purification Introduction to Protein Purification 1 Day 1) Introduction to Protein Purification. Input for Purification Protocol Development - Guidelines for Protein Purification Day 2) Sample Preparation before Chromatography

More information

Antibodies and Antigens in the Blood Bank 9/7/2015 NAHLA BAKHAMIS 1

Antibodies and Antigens in the Blood Bank 9/7/2015 NAHLA BAKHAMIS 1 Antibodies and Antigens in the Blood Bank NAHLA BAKHAMIS 9/7/2015 NAHLA BAKHAMIS 1 Outline Antibodies structure, classes and functions Most important Abs in the blood bank effective roles of Abs Zeta potential

More information

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct

More information

Protein homology. Antigens & Antibodies I. Administrative issues:

Protein homology. Antigens & Antibodies I. Administrative issues: Administrative issues: Recommended text: Goldsby/Kuby Immunology, 6th edition (Note that Innate Immunity is not adequately covered in the 5th edition.) Text book reading assignments are to supplement the

More information

T and B cell gene rearrangement October 17, Ram Savan

T and B cell gene rearrangement October 17, Ram Savan T and B cell gene rearrangement October 17, 2016 Ram Savan savanram@uw.edu 441 Lecture #9 Slide 1 of 28 Three lectures on antigen receptors Part 1 (Last Friday): Structural features of the BCR and TCR

More information

In other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0.

In other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0. In other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0. There are a number of shorthand abbreviations a linear polymer of deoxyribonucleotides. One

More information

7.014 Quiz II 3/18/05. Write your name on this page and your initials on all the other pages in the space provided.

7.014 Quiz II 3/18/05. Write your name on this page and your initials on all the other pages in the space provided. 7.014 Quiz II 3/18/05 Your Name: TA's Name: Write your name on this page and your initials on all the other pages in the space provided. This exam has 10 pages including this coversheet. heck that you

More information

4 Themes in B cell development + Ig class switch and somatic mutation Tony DeFranco, 10/28/13 Checkpoints in B cell development: feedback from Ig

4 Themes in B cell development + Ig class switch and somatic mutation Tony DeFranco, 10/28/13 Checkpoints in B cell development: feedback from Ig 4 Themes in B cell development + Ig class switch and somatic mutation Tony DeFranco, 10/28/13 Checkpoints in B cell development: feedback from Ig gene rearrangements Lineage commitment: transcription factors

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

From Gene to Protein. How Genes Work (Ch. 17)

From Gene to Protein. How Genes Work (Ch. 17) From Gene to Protein How Genes Work (Ch. 17) What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA proteins cells bodies The Central

More information

Biomolecules: lecture 6

Biomolecules: lecture 6 Biomolecules: lecture 6 - to learn the basics on how DNA serves to make RNA = transcription - to learn how the genetic code instructs protein synthesis - to learn the basics on how proteins are synthesized

More information

A Modified Digestion-Circularization PCR (DC-PCR) Approach to Detect Hypermutation- Associated DNA Double-Strand Breaks

A Modified Digestion-Circularization PCR (DC-PCR) Approach to Detect Hypermutation- Associated DNA Double-Strand Breaks A Modified Digestion-Circularization PCR (DC-PCR) Approach to Detect Hypermutation- Associated DNA Double-Strand Breaks SARAH K. DICKERSON AND F. NINA PAPAVASILIOU Laboratory of Lymphocyte Biology, The

More information

ProteoGenix. Life Sciences Services and Products. From gene to biotherapeutics Target Validation to Lead optimisation

ProteoGenix. Life Sciences Services and Products. From gene to biotherapeutics Target Validation to Lead optimisation ProteoGenix Life Sciences Services and Products From gene to biotherapeutics Target Validation to Lead optimisation ProteoGenix Philippe FUNFROCK, founder and CEO French company located in Strasbourg,

More information

produces an RNA copy of the coding region of a gene

produces an RNA copy of the coding region of a gene 1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the

More information

ANTIBODIES. Agents of Immunity

ANTIBODIES. Agents of Immunity ANTIBODIES Agents of Immunity - Antibodies are: The Organization What are they? Protective agents of the immune system Neutralize foreign agents called antigens Essential part of the Adaptive Immune System

More information

Chapter 10: Gene Expression and Regulation

Chapter 10: Gene Expression and Regulation Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must

More information

(a) Rearrange the Michaelis Menten equation to give V 0 as a function of V 0 /[S]. (b) What is the significance of the slope, the vertical intercept,

(a) Rearrange the Michaelis Menten equation to give V 0 as a function of V 0 /[S]. (b) What is the significance of the slope, the vertical intercept, 1. Active yet responsive. What is the biochemical advantage of having a K M approximately equal to the substrate con- centration normally available to an enzyme? 2. Destroying the Trojan horse. Penicillin

More information

Bi 8 Lecture 7. Ellen Rothenberg 26 January Reading: Ch. 3, pp ; panel 3-1

Bi 8 Lecture 7. Ellen Rothenberg 26 January Reading: Ch. 3, pp ; panel 3-1 Bi 8 Lecture 7 PROTEIN STRUCTURE, Functional analysis, and evolution Ellen Rothenberg 26 January 2016 Reading: Ch. 3, pp. 109-134; panel 3-1 (end with free amine) aromatic, hydrophobic small, hydrophilic

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

Cambridge International Examinations Cambridge International Advanced Subsidiary and Advanced Level

Cambridge International Examinations Cambridge International Advanced Subsidiary and Advanced Level Cambridge International Examinations Cambridge International Advanced Subsidiary and Advanced Level *2249654089* BIOLOGY 9700/21 Paper 2 AS Level Structured Questions October/November 2016 1 hour 15 minutes

More information

DNA.notebook March 08, DNA Overview

DNA.notebook March 08, DNA Overview DNA Overview Deoxyribonucleic Acid, or DNA, must be able to do 2 things: 1) give instructions for building and maintaining cells. 2) be copied each time a cell divides. DNA is made of subunits called nucleotides

More information

Microbial Metabolism. PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R

Microbial Metabolism. PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R 5 Microbial Metabolism Big Picture: Metabolism Metabolism is the buildup and breakdown of nutrients

More information

Problem Set 4

Problem Set 4 7.016- Problem Set 4 Question 1 Arginine biosynthesis is an example of multi-step biochemical pathway where each step is catalyzed by a specific enzyme (E1, E2 and E3) as is outlined below. E1 E2 E3 A

More information

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons, From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes

More information

7.013 Problem Set 3 FRIDAY October 8th, 2004

7.013 Problem Set 3 FRIDAY October 8th, 2004 MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert. Weinberg, Dr. laudette ardel Name: T: 7.013 Problem Set 3 FRIDY October 8th, 2004 Problem

More information

Chem 465 Biochemistry II

Chem 465 Biochemistry II Chem 465 Biochemistry II Name: 2 points Multiple choice (4 points apiece): 1. Which of the following is not true of trna molecules? A) The 3'-terminal sequence is -CCA. B) Their anticodons are complementary

More information

www.lessonplansinc.com Topic: Gene Mutations WS Summary: Students will learn about frame shift mutations and base substitution mutations. Goals & Objectives: Students will be able to demonstrate how mutations

More information

Chapter 13: Biotechnology

Chapter 13: Biotechnology Chapter Review 1. Explain why the brewing of beer is considered to be biotechnology. The United Nations defines biotechnology as any technological application that uses biological system, living organism,

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

Protein Synthesis. Application Based Questions

Protein Synthesis. Application Based Questions Protein Synthesis Application Based Questions MRNA Triplet Codons Note: Logic behind the single letter abbreviations can be found at: http://www.biology.arizona.edu/biochemistry/problem_sets/aa/dayhoff.html

More information

Purification of (recombinant) proteins. Pekka Lappalainen, Institute of Biotechnology, University of Helsinki

Purification of (recombinant) proteins. Pekka Lappalainen, Institute of Biotechnology, University of Helsinki Purification of (recombinant) proteins Pekka Lappalainen, Institute of Biotechnology, University of Helsinki Physical properties of proteins that can be applied for purification -size -charge (isoelectric

More information

Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?

Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist

More information

Generation of Recombinant Antibodies and Means for Increasing Their Affinity

Generation of Recombinant Antibodies and Means for Increasing Their Affinity ISSN 0006-2979, Biochemistry (Moscow), 2010, Vol. 75, No. 13, pp. 1584-1605. Pleiades Publishing, Ltd., 2010. Original Russian Text E. P. Altshuler, D. V. Serebryanaya, A. G. Katrukha, 2010, published

More information

Immunoglobulins. Light chain ~22-23 KDa whereas the heavy chain ~55-60 KDa

Immunoglobulins. Light chain ~22-23 KDa whereas the heavy chain ~55-60 KDa Immunoglobulins Immunoglobulin (Ig) has a common name which is "Antibody (Ab)", but actually we should say Ig, why? Because the proteins, which are involved, are actually globular proteins "known as globulins"

More information

Dr. Jeffrey P. Thompson bio350

Dr. Jeffrey P. Thompson bio350 Chapter 8 Enzymes Green light GFP Blue light Modern day catalysis Catalysis (reaction promotion) may have gotten its beginning g in an RNA- dominated world. Most catalysis today has evolved into using

More information

DNA Replication and Transcription: Biosynthesis of DNA and RNA 阮雪芬

DNA Replication and Transcription: Biosynthesis of DNA and RNA 阮雪芬 DNA Replication and Transcription: Biosynthesis of DNA and RNA 阮雪芬 2004/05/21 @NTU Outline Introduction Replication of DNA Action of DNA Polymerases DNA Damage and Repair Synthesis of RNA Post-transcriptional

More information

Chapter 2 - DNA MC [37 marks]

Chapter 2 - DNA MC [37 marks] Chapter 2 - N MC [37 marks] 1. The image shows a N nucleotide. Which correctly identifies the parts labelled I and II? C 2. Which model represents transcription? 3. Which sequence represents the order

More information

Immunogenicity of Therapeutic Proteins. Steven J Swanson, Ph.D. Executive Director, Clinical Immunology

Immunogenicity of Therapeutic Proteins. Steven J Swanson, Ph.D. Executive Director, Clinical Immunology Immunogenicity of Therapeutic Proteins Steven J Swanson, Ph.D. Executive Director, Clinical Immunology swanson@amgen.com Causes of Immunogenicity Sequence differences between therapeutic protein and endogenous

More information

466 Asn (N) to Ala (A) Generate beta dimer Interface

466 Asn (N) to Ala (A) Generate beta dimer Interface Table S1: Amino acid changes to the HexA α-subunit to convert the dimer interface from α to β and to introduce the putative GM2A binding surface from β- onto the α- subunit Residue position (α-numbering)

More information

BIOLOGY. Chapter 15 Genes & Proteins

BIOLOGY. Chapter 15 Genes & Proteins BIOLOGY Chapter 15 Genes & Proteins CMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 17 Protein Synthesis 2014 Pearson Education, Inc. Fig. 17-1 Figure 17.1a n albino racoon Condition

More information

Enzymes and Coenzymes I. Dr. Sumbul Fatma Clinical Chemistry Unit Department of Pathology

Enzymes and Coenzymes I. Dr. Sumbul Fatma Clinical Chemistry Unit Department of Pathology Enzymes and Coenzymes I Dr. Sumbul Fatma Clinical Chemistry Unit Department of Pathology What are Enzymes? Enzymes are biological catalysts that speed up the rate of a reaction without being changed in

More information

Antibodies and Antigens In the blood bank

Antibodies and Antigens In the blood bank Antibodies and Antigens In the blood bank 1 Nice game!! http://nobelprize.org/ 2 Karl Landsteiner discovered blood groups in 1901. Awarded Nobel Prize for Physiology or Medicine in 1930 3 Why we study

More information

Combinatorial RNA libraries

Combinatorial RNA libraries SELEX and Artificial Ribozymes Some definitions SELEX: Systematic Evolution of Ligands by EXponential Enrichment (alternatively: in vitro selection, in vitro evolution) Aptamer: nucleic acid ligand (from

More information

Cellular [mrna] depends on synthesis and degradation. RNA-dependent DNA and RNA synthesis. Reverse transcriptase

Cellular [mrna] depends on synthesis and degradation. RNA-dependent DNA and RNA synthesis. Reverse transcriptase Chem 431c-Lecture 7c Reminder: Midterm is Wednesday, Nov. 18,2009 On Chapters 25 and 26 Chapter 26: Reverse retroviruses Telomerase RNA replicase RNA World Selex Copyright 2004 by W. H. Freeman & Company

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Chapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus".

Chapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a true nucleus. Chapter 13 The Nucleus The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus". Fig.13.1. The EM of the Nucleus of a Eukaryotic Cell 13.1. The Nuclear Envelope

More information

Mutations and Disease

Mutations and Disease Mutations and Disease Objectives and lecture plan Describe what are mutations Explain how do we identify mutations Explain how and why mutant proteins lead to disease Describe what kinds of DNA mutations

More information

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation

1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation 1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous

More information

Solutions to Quiz II

Solutions to Quiz II MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Solutions to 7.014 Quiz II Class Average = 79 Median = 82 Grade Range % A 90-100 27 B 75-89 37 C 59 74 25 D 41 58 7 F 0 40 2 Question 1

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested

More information

14 Gene Expression: From Gene to Protein

14 Gene Expression: From Gene to Protein CMPBELL BIOLOY IN FOCS rry Cain Wasserman Minorsky Jackson Reece 14 ene Expression: From ene to Protein Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge Overview: The Flow of enetic Information

More information

From Gene to Phenotype- part 3. Lecture Outline 11/9/05. The genetic code. Translation: overview

From Gene to Phenotype- part 3. Lecture Outline 11/9/05. The genetic code. Translation: overview DN mrn From ene to Phenotype- part 3 TRNSRIPTION DN 1 RN is transcribed from a DN template. 5 RN RN transcript polymerase RN PROESSIN Exon 2 In eukaryotes, the RN transcript RN transcript (premrn) is spliced

More information

MMG 301, Lec. 25 Mutations and Bacteriophage

MMG 301, Lec. 25 Mutations and Bacteriophage MMG 301, Lec. 25 Mutations and Bacteriophage Questions for today: 1. What are mutations and how do they form? 2. How are mutant bacteria used in research? 3. What are the general properties of bacteriophage

More information