Nanopore sequencing How it works

Transcription

1 1

2 Nanopore sequencing How it works Nanopore Reader DNA or RNA passes through a nano-scale hole. The fluctuations in current as it passes through are used to understand the DNA or RNA sequence. An electrically resistant membrane means all current must pass through the nanopore, ensuring a clean signal. The nanopore processes the length of DNA or RNA presented to it. The user can control this through the library preparation protocol utilised. (e.g. 950 kb DNA has been recorded). An enzyme motor controls the translocation of the DNA or RNA strand through the nanopore. Once the DNA or RNA has passed through, the motor protein detaches and the nanopore is ready to accept the next fragment. The nanopore signal, captured by the ASIC in the device, is characteristic of the sequence of the DNA fragment. Algorithms are used to convert the signal into basecalls. 2

3 Sequencing with 1D and 1D 2 reads Library prep Whether using 1D or 1D 2, library preparation results in the addition of a sequencing adapter at each end of the fragment. Both the template and complement strands carry the motor protein which means both strands are able to translocate the nanopore. Translocation 1D linear The template and the complement strands are sequenced as individual strands. Translocation 1D 2 1D² library preparation deploys special sequencing adapters that encourage the complement strand to immediately follow the template strand. This method of sequencing when used with 1D² analysis produces a higher accuracy read. Template......Template... (Exit) Template......Template... (Exit)...Complement 3

4 DNA library preparation For minimal preparation time Rapid kit with transposase For maximum throughput Ligation kit Transposome complex gdna High molecular weight gdna 5 min Optional fragmentation End-prep Cleavage and addition of transposase adapters 60 min Ligation of sequencing adapters 5 min Ligation of sequencing adapters and tether attachment + Tether attachment Loading Loading Transposase simultaneously cleaves template molecules and attaches tags to the cleaved ends Sequencing adapters are added to the tagged ends Fragment lengths are a result of the random cleavage DNA ends are repaired and da-tailed Sequencing adapters are ligated onto the prepared end Fragment lengths can be controlled by fragmentation or size selection 4

5 Which DNA kit? These library preparation kits are all PCR-free, allowing the DNA to be sequenced without any PCR bias Ligation 1D (SQK-LSK108) Rapid (SQK-RAD004) Ligation 1D 2 (SQK-LSK308) Use for Highest throughput Rapid and simple prep Highest raw read accuracy Prep time 60 mins 10 mins 80 mins Input amount 1000 ng dsdna 400 ng HMW gdna (>30 kb) 1000 ng dsdna Fragmentation Optional Transposase based Optional Read length Equal to fragment length Random distribution, dependent on input fragment length Equal to fragment length Alternative kits are available for library preparation when: using less input material (sequencing kits including PCR) wishing to multiplex for cost-effective sequencing of multiple samples (barcoding kits) carrying out specific applications e.g. 16S sequencing For full specifications, visit store.nanoporetech.com 5

6 RNA library preparation For full-length transcript analysis with high throughput PCR-cDNA Sequencing Kit For sequencing the RNA molecule directly Direct RNA Kit Full-length RNA AAAAAAAAAAAAAAAAA Full-length RNA AAAAAAAAAAAAAAAAA 40 min Primer annealing Reverse transcription and strand switching GGG CCC TTTTTT AAAAAAAAAA AAAAAAA TTTTTTTTTT AAAAAAAAAA AAAAAAA TTTTTTTTTT 100 min Primer annealing and ligation Reverse transcription TTTTTT AAAAAAAAAAAAAAAAAA TTTTTT 55 min PCR with rapid attachment primers F R AAAAAAAAAAAAAAAAAA TTTTTTTTTTTTTTTTTT 30 min GGG CCC Attachment of rapid 1D sequencing adapters GGG CCC AAAAAAAAAA TTTTTTTTTT AAAAAAAAAA TTTTTTTTTT Attachment of 1D sequencing adapter and dual tethers 15 min + AAAAAAAAAAAAAAAAAA TTTTTTTTTTTTTTTTTT Loading Loading cdna is synthesised using a reverse transcription and strand-switching method, and then is amplified with PCR Utilising a specific primer at the 5 end enriches for full-length transcripts in the PCR step Sequencing adapters are attached to the cdna Optional reverse transcription step improves throughput Sequencing adapters attached to prepared ends cdna strand is not sequenced Read length reflects length of molecules in sample 6

7 Which RNA kit? Direct RNA (SQK-RNA001) PCR-cDNA (SQK-PCS108) Direct cdna (SQK-DCS108) Use for Sequence RNA molecules directly and preserve base modifications Full-length transcripts with high throughput Full-length transcripts without PCR bias Prep time 115 mins 125 mins 210 mins Input recommendation 500 ng RNA (poly A+) 50 ng RNA (poly A+) 250 ng RNA (poly A+) Read length Equal to RNA length Enriched for full-length cdna Equal to cdna length PCR required No Yes No Reverse transcription Optional Yes Yes Barcoding options for the cdna kits are available, and are in development for the Direct RNA Kit. For full specifications, visit store.nanoporetech.com 7

8 Maximising flow cell usage Barcoding Barcoding kits allow users to multiplex samples to generate maximum data from a single flow cell, to separate the reads from sequential library loadings and to lower the cost per sample. Native Barcoding Kit for a PCR-free approach PCR Barcoding Kits for up to 96 samples Barcode libraries of gdna, amplicon or cdna either with a dedicated barcoding kit or a barcoding expansion pack Washing The wash kit allows re-use of flow cells after short sequencing runs, meaning multiple libraries can be run sequentially. Barcode multiple samples Pool and sequence Separate and analyse 8

9 VolTRAX Towards the analysis of any living thing, by any person, in any environment Consumable cartridge converting any biological samples to a form ready for application to a nanopore sensing device. Automation of library preparation methods integrating capabilities such as PCR. Only minutes of hands-on time, even for novel/complex experiments. USB powered and portable, liquids are moved around the cartridge in a path programmed, by software, performing individual reactions in sequence. Weight 302 g including cartridge Size Device & cartridge: W 129 mm, H 47 mm, D 77 mm The VolTRAX TM Introduction Programme (VIP) is available to members of the Nanopore Community. Visit nanoporetech.com/vip 9

10 MinION Portable DNA/RNA sequencing for anyone Consumable flow cell where the biology and electronics come together for nanopore sequencing. Sample added to flow cell here. USB powered device; link to laptop or computer to operate. Bespoke sensor array with multiple nanopores for scaled-up sequencing. Flow cell with 512 active channels. Sensor chip works with custom ASIC for control and data acquisition. Weight 87 g (103 g with a flow cell) Size W 105 mm, H 23 mm, D 33 mm 10

11 Which MinION starter pack? Recommended Basic Enhanced Development MinION TM 1 1 Up to 2* Flow cells Sequencing kits Wash kits Community Support Included Included Included Enhanced Support Optional 8 weeks included 8 weeks included Rapid Start Day Optional Optional Optional $1, $4, $15, For full specifications, visit store.nanoporetech.com 11

12 GridION X5 High-throughput, benchtop system with integrated compute module Consumable flow cell where the biology and electronics come together for nanopore sequencing. Sample added to flow cell here. 5 individual flow cells can be operated individually or together, suitable for fee-for-service operations. Up to 2,560 active channels can be sequencing at one time on the GridION TM X5. Onboard data analysis offering real-time local analysis, generating up to 100 Gb data over 48 hours. Weight 10 kg Size W 360 mm, H 200 mm, D 360 mm Oxford NANOPORE Service Certified 12

13 Which GridION plan? GridION X5 Starter Pack GridION X5 CapEX GridION X5 OpEX GridION Flow cells included Price per flow cell - $ $ Sequencing kits included 10 Bought separately Bought separately Enhanced Support Included Included Included Device maintenance and service Included (6 months)* Included (12 months)* Included (12 months)* Shipping Included Included Included $49, $126, $158, Service provider certification is available for the GridION. * Subsequent service charge is $10,000 per annum. For full specifications, visit store.nanoporetech.com 13

14 PromethION High-throughput, high-sample number benchtop system No capital cost required; consumable packages available Suitable for fee-for-service operations Each flow cell comprises up to 3,000 active channels and has four sample inputs. Sample added to flow cell here. Compatible with multichannel pipette. Compute module. Sequencing module. Up to 144,000 active channels can be sequencing at one time on the PromethION TM. 48 individual flow cells can be operated individually or together. Inside the PromethION The PromethION Early Access Programme (PEAP) is available to members of the Nanopore Community. Visit nanoporetech.com/community/promethion-early-accessprogramme to find out more. Weight Main unit: 40 kg Compute module: 22 kg Size Main unit: W 437 mm, H 258 mm, D 410 mm Compute module: W 178 mm, H 462 mm, D 673 mm Oxford NANOPORE Service Certified 14

15 Future: Flongle and SmidgION Flongle TM Suited to frequent, cost-effective analyses Smaller flow cell utilises same nanopore sensing technology as MinION, GridION and PromethION SmidgION TM The smallest sequencing device so far Same nanopore sensing technology as MinION, GridION and PromethION Designed for use with a smartphone in any location Single-use flow cell. Adapter. MinION. 15

16 Data analysis and basecalling As a DNA or RNA strand passes through the nanopore, the current is measured several thousand times per second. These current samples are known as raw data. The raw data: is processed using machine-learning techniques into basecalled data the sequence of DNA or RNA bases captures biological features such as base modifications. It is down to the algorithm to correctly interpret that information can be accessed for the development of new analysis tools Tools such as new basecallers can be accessed through a developer licence available to nanopore technology users. Data structure Raw data Raw data straight off ASIC Sequence CCGACTCCGGTTACCCGCGTTGATTTGCTGGGGCAGGGCCG Basecalled 16

17 Data analysis and basecalling Basecalling can be run on the host computer or on local infrastructure; the options available include: Fully supported provided in the product Host computer MinKNOW TM basecaller or Device control Data acquisition Albacore basecaller Onward analysis Local infrastructure Albacore basecaller Onward analysis Research algorithms available through developer licence on GitHub Nanonet basecaller Device control Data acquisition Onward analysis Scrappie basecaller Community basecallers developed by and available from nanopore technology customers, see nanoporetech.com/publications 17

18 Onward analysis Oxford Nanopore provides analytical real-time, end-to-end workflows to support researchers, using the EPI2ME TM platform. Alternatively, the raw data and basecalled data can be obtained in either.fast5 or.fastq for use in customised analysis pipelines. Basecalled data.fastq /.fast5 Community tools Available by EPI2ME In development by EPI2ME Variant calling Workflow builder de novo assembly... and many more Assembly Consensus 18

19 19

20 Oxford Nanopore Technologies, the Wheel icon, EPI2ME, Flongle, GridION, Metrichor, MinION, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore Technologies in various countries. All other brands and names are the property of their respective owners Oxford Nanopore Technologies. All rights reserved. Flongle, GridION, MinION, PromethION and VolTRAX are for research use only. 20