Development of High Quality CRISPR/Cas9 Agents
|
|
- Piers Townsend
- 5 years ago
- Views:
Transcription
1 Development of High Quality CRISPR/Cas9 Agents TIDES May 7 th, 2018 Terence Ta editasmedicine.com 1
2 Agenda Overview of CRISPR and Editas platform Development of NGS-based method for guide RNA QC Covalently-coupled dual guide RNA (cc dgrna) Guide RNA contamination Summary and closing 2
3 Agenda Overview of CRISPR and Editas platform Development of NGS-based method for guide RNA QC Covalently-coupled dual guide RNA (cc dgrna) Guide RNA contamination Summary and closing 3
4 CRISPR Unlocks Genome Editing Nuclease DNA HiFi Guide Sequence es Guide RNA PAM Cut Sites Complex of nuclease and guide RNA (RNP) precisely locates and cuts genomic sites Ability to target many sites simultaneously using numerous guide RNAs Nuclease can be engineered to reach more sites and to modulate cutting DNA: Deoxyribonucleic Acid; HiFi: High Fidelity; es: Enhanced Specificity; PAM: Protospacer Adjacent Motif Editas Editas Medicine 4
5 Platform Enables Broad Product Pipeline ~10x Broad Range of Sites SpCas9 SaCas9 SpCas9 Variants SaCas9 Variants Cpf1 Cpf1 Variants Editas Platform Disrupt Remove Replace Insert Diverse Spectrum of Edits SpCas9: Streptococcus pyogenes Cas9; SaCas9: Staphylococcus aureus Cas9 5
6 Ex Vivo Drug Development Engineered autologous High Quality therapy Ribonucleoprotein requires multiple Particle components Delivery RNA Guided Endonuclease + Ribonucleoprotein Particle (RNP) + RNA Guide Engineered Patient Cell Patient Cell 6
7 Challenges with chemical synthesis of grna 5 Single grna 3 Direction of synthesis is 3 to 5, more critical 5 end (Cas9) especially error prone Independent coupling reactions at 98.5% success rate: for 100mer, 20% full-length product Purification to enrich full-length product can introduce low level contamination 7
8 Challenges with chemical synthesis of grna 5 Single grna 3 Direction of synthesis is 3 to 5, more critical 5 end (Cas9) especially error prone Independent coupling reactions at 98.5% success rate: for 100mer, 20% full-length product Purification to enrich full-length product can introduce low level contamination Heterogeneous product Full-length, truncated, errors Need methods to measure guide sequence fidelity and purity 5 3 8
9 Agenda Overview of CRISPR and Editas platform Development of NGS-based method for guide RNA QC Covalently-coupled dual guide RNA (cc dgrna) Guide RNA contamination Summary and closing 9
10 Development of NGS method for grna QC Reverse transcriptase w/template-switching activity generates cdna libraries from grna templates which are then PCR-amplified NGS on PCR product, purity/fidelity evaluated using analysis pipeline developed in-house 10
11 Development of NGS method for grna QC grna input 5 3 OH 3 Polyadenylation 5 AAAA-3 11
12 Development of NGS method for grna QC 5 AAAA-3 TTTT 5 3 dt primer + adapter First-strand synthesis and tailing by RT (adds 3 C s) 5 AAAA-3 3 -CCC TTTT 5 12
13 Development of NGS method for grna QC Template-switching oligo + adapter 5 GGG 5 AAAA-3 3 -CCC TTTT 5 Template switching and extension by RT 5 3 GGG CCC AAAA-3 TTTT 5 13
14 Development of NGS method for grna QC Forward PCR primer + clustering sequence + indexing sequence GGG CCC AAAA-3 TTTT 5 5 Reverse PCR primer + clustering sequence + indexing sequence Addition of Illumina adapters by PCR Read 1 5 AAAA 3 TTTT 3 5 Read 2 14
15 Development of NGS method for grna QC grna input 5 3 OH 3 Polyadenylation 5 AAAA-3 TTTT 5 3 dt primer + adapter Template-switching oligo + adapter 5 GGG 5 AAAA-3 3 -CCC TTTT 5 First-strand synthesis and tailing by RT (adds 3 C s) Template switching and extension by RT Forward PCR primer + clustering sequence + indexing sequence GGG CCC AAAA-3 TTTT 5 5 Reverse PCR primer + clustering sequence + indexing sequence Addition of Illumina adapters by PCR Read 1 5 AAAA 3 TTTT 3 5 Read 2 15
16 Development of NGS method for grna QC ~400k reads sequenced for each oligo that are run through in-house analysis pipeline Reads aligned to expected oligo sequence Reads classified as: Match, Truncation, Contaminant 16
17 Development of NGS method for grna QC High level metrics for fidelity and purity Contaminant profiles for individual guides Guide % Perfect Contaminant (%) Contaminant sequence Frequency (%) Alternate Sequence Alternate Sequence Alternate Sequence Alternate Sequence % Perfect: fraction of total reads that have a perfect guide sequence Identify, quantify contaminant sequences 17
18 Development of NGS method for grna QC High level metrics for fidelity and purity Contaminant profiles for individual guides Guide % Perfect Contaminant (%) Contaminant sequence Frequency (%) Alternate Sequence Alternate Sequence Alternate Sequence Alternate Sequence % Perfect: fraction of total reads that have a perfect guide sequence Identify, quantify contaminant sequences Tool for measuring guide quality Can we improve it? How important are these attributes? 18
19 Agenda Overview of CRISPR and Editas platform Development of NGS-based method for guide RNA QC Covalently-coupled dual guide RNA (cc dgrna) Guide RNA contamination Summary and closing 19
20 Synthetic Covalently-Coupled Dual grna A completely non-enzymatic process for guide production Targeted chemistries anywhere in the molecule Unhindered ends and modifications Scale up and purity are more compatible with CMC requirements covalently-coupled dual grna (cc dgrna) 20
21 Synthetic Covalently-Coupled Dual grna A completely non-enzymatic process for guide production Targeted chemistries anywhere in the molecule Unhindered ends and modifications Scale up and purity are more compatible with CMC requirements Well-defined product Full-length, less errors 5 3 covalently-coupled dual grna (cc dgrna) 21
22 cc dgrnas demonstrate greater sequence fidelity as determined by NGS assay * Vendor A sgrna Vendor B sgrna Vendor C sgrna * Editas cc dgrna * PolyA 22
23 cc dgrna process generates less impurities Vendor A sgrna Total 1.70% Alternate Sequence % Alternate Sequence % Ordered with parent oligo Unknown sequences 0.08% Vendor B sgrna Total 0.76% Alternate Sequence % Unknown sequences 0.08% Ordered with parent oligo Vendor C sgrna Total 0.19% Alternate Sequence % Unknown sequences 0.02% Editas cc dgrna Unknown sequences Total 0.09% 0.09% 23
24 Agenda Overview of CRISPR and Editas platform Development of NGS-based method for guide RNA QC Covalently-coupled dual guide RNA (cc dgrna) Guide RNA contamination Summary and closing 24
25 Measurement of cellular editing Cellular assay Cells transfected with ribonucleoproteingrna complex Amplicon assessed for editing (NGS) Editing events measured across amplicon Symmetric cutting profile with peak in editing at target site Target cut site 25
26 Contaminating oligos can cut Case where contamination caused extension in editing region: Expected oligo 9 th synthesized Observed in >20 oligos Contamination appears to be directional, in the order of synthesis Observed with multiple vendors Not picked up by mass spec Alternate Sequence 1 8 th synthesized Alternate Sequence 2 7 th synthesized Alternate Sequence 3 5 th synthesized 26
27 Sequencing reveals poor sequence fidelity and high contaminant levels Contaminated set Standard panel 27
28 Primary oligo Sequencing detects directional contamination Agilent % % % 0.576% % 0.063% 0.121% % 0.031% 0.349% % 0.088% Contaminated by % 0.021% 0.023% 0.585% % 0.022% 0.144% 0.579% % 0.016% 0.022% 0.082% 0.248% % 0.024% 0.021% 0.359% Order of synthesis Order of synthesis Confirms directionality of contamination observed in cellular editing assay, at the oligo level: For given oligo, the major contaminating sequence is almost always the oligo synthesized/purified immediately prior Many instances of multiple contaminating species where sequences closer in synthesis order to the primary oligo are present at greater levels 28
29 Quantifying contaminants and impact on editing 99.01% Expected oligo 9 th synthesized 0.58% Alternate Sequence 1 8 th synthesized 0.14% Alternate Sequence 2 7 th synthesized 0.02% Alternate sequence 3 5 th synthesized 29
30 Sequencing assay reveals critical mutation in nexus region C-001: C to U mutation (<1 Da difference) at base of nexus (position 61) G U 30
31 Sequencing assay reveals critical mutation in nexus region C-001: C to U mutation (<1 Da difference) at base of nexus (position 61) G U No activity in HSCs 31
32 Sequencing assay reveals critical mutation in nexus region C-001: C to U mutation (<1 Da difference) at base of nexus (position 61) G U No activity in HSCs C-002: NGS assay confirms correction G C 32
33 Sequencing assay reveals critical mutation in nexus region C-001: C to U mutation (<1 Da difference) at base of nexus (position 61) G U No activity in HSCs C-002: NGS assay confirms correction G C > 40% editing in HSCs 33
34 Summary grna quality is important as these are potent enzymes Sequence fidelity and purity are critical, we have developed methods to assess these Minor contaminants can have activity, we have developed methods to identify and quantify them Orthogonal mass spec assays also being developed Sensitivity of MS: 1-5% Sensitivity of sequencing assay: 0.1% Editas has developed state of the art synthesis and analytics for guide RNAs 34
35 Thank you! editasmedicine.com 35
Genome Editing: Considerations for Therapeutic Applications Cecilia Fernandez TIDES,
Genome Editing: Considerations for Therapeutic Applications Cecilia Fernandez TIDES, 2017 www.editasmedicine.com 1 The Potential to Repair Any Broken Gene Transformative new category of medicines for genetically-defined
More informationCRISPR Genome Editing: Considerations for Therapeutic Applications
CRISPR Genome Editing: Considerations for Therapeutic Applications November 9, 2017 Cecilia Fernandez editasmedicine.com 1 Medicines that Aim to Repair Any Broken Gene Potential to create the next major
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationImproving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm
Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Anja Smith Director R&D Dharmacon, part of GE Healthcare Imagination at work crrna:tracrrna program Cas9 nuclease Active crrna is
More informationIncorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows
Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Stephen Jackson, Ph.D 27 May 2017 The world leader in serving science Key Applications for Genome Editing Research
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationOptimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing
Optimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing Mark Behlke MD, PhD Chief Scientific Officer February 24, 2016 1 Implementing CRISPR/Cas9 gene editing 2 To focus on RNA
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationCRISPR/Cas9 Genome Editing: Transfection Methods
CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the
More informationApplications of Cas9 nickases for genome engineering
application note genome editing Applications of Cas9 nickases for genome engineering Shuqi Yan, Mollie Schubert, Maureen Young, Brian Wang Integrated DNA Technologies, 17 Commercial Park, Coralville, IA,
More informationMaximizing your NGS sequencing with IDT. Adam Chernick, PhD Field Applications Manager, Functional Genomics
Maximizing your NGS sequencing with IDT Adam Chernick, PhD Field Applications Manager, Functional Genomics 1 Contents Expanding our NGS portfolio what s next? xgen technology and Lockdown probe advantages
More informationOptimizing CRISPR ribonucleoprotein components for precision genome editing
Optimizing CRISPR ribonucleoprotein components for precision genome editing Justin Barr Sr. Product Manager, Integrated DNA Technologies VIB CRISPR User Meeting 18 September 2018 1 Agenda Overview of CRISPR-Cas9
More informationA Guide to CRISPR/Cas9
Genome editing and beyond freepik A Guide to CRISPR/Cas9 The latest advance in genomic DNA editing is the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system. This simple-touse
More informationSUREGUIDE CRISPR LIBRARIES
SUREGUIDE CRISPR LIBRARIES Fidelity The Agilent Advantage Guide Representation Customization The Agilent Advantage Fidelity What is fidelity? Fidelity in DNA synthesis is simple to understand but can be
More informationSureGuide CRISPR Libraries
SureGuide CRISPR Libraries Fidelity The Agilent Advantage Guide Representation Customization Fidelity What is fidelity? Fidelity in DNA synthesis is simple to understand but can be difficult to achieve.
More informationCRISPR 101: Optimizing Your Gene Editing Experiments
CRISPR 101: Optimizing Your Gene Editing Experiments PRESENTER Michele Auldridge, Ph.D. Senior Scientist, R&D MODERATOR Beth Frey Product Manager Agenda 1 Technology Overview 2 Experimental Decisions 3
More informationSimple protocol for gene editing using GenCrisprTM Cas9 nuclease
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of
More informationGenome edi3ng with the CRISPR-Cas9 system
CRISPR-Cas9 Genome Edi3ng Bootcamp AHA Council on Func3onal Genomics and Transla3onal Biology Narrated video link: hfps://youtu.be/h18hmftybnq Genome edi3ng with the CRISPR-Cas9 system Kiran Musunuru,
More informationNext-generation sequencing technologies
Next-generation sequencing technologies NGS applications Illumina sequencing workflow Overview Sequencing by ligation Short-read NGS Sequencing by synthesis Illumina NGS Single-molecule approach Long-read
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationAlt-Ring the genome with CRISPR- Cas9
Alt-Ring the genome with CRISPR- Cas9 Genome editing done easily and fast CHIA Jin Ngee Regional Application Specialist 1 Integrated DNA Technologies The Custom Biology Company 2 IDT was founded by a scientist
More informationIncreased transcription detection with the NEBNext Single Cell/Low Input RNA Library Prep Kit
be INSPIRED drive DISCOVERY stay GENUINE TECHNICAL NOTE Increased transcription detection with the NEBNext Single Cell/Low Input RNA Library Prep Kit Highly sensitive, robust generation of high quality
More informationAutomated Electrophoresis Applications for Synthetic Biology
Automated Electrophoresis Applications for Synthetic Biology Melissa Huang Liu, Ph.D. Product Manager, Electrophoresis Agilent Technologies 1 Outline 2100 Bioanalyzer & 4200 TapeStation Systems Automated
More informationAmplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events
Amplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events Steve Siembieda, MS MBA VP Commercialization ABRF Conference February 2015 What Is CRISPR? Clustered
More informationUser Instructions:Transfection-ready CRISPR/Cas9 Reagents. Target DNA. NHEJ repair pathway. Nucleotide deletion. Nucleotide insertion Gene disruption
User Instructions:Transfection-ready CRISPR/Cas9 Reagents Background Introduction to CRISPR/Cas9 genome editing In bacteria and archaea, clustered regularly interspaced short palindromic repeats (CRISPR)
More informationProtocols for cell lines using CRISPR/CAS
Protocols for cell lines using CRISPR/CAS Procedure overview Map Preparation of CRISPR/CAS plasmids Expression vectors for guide RNA (U6-gRNA) and Cas9 gene (CMV-p-Cas9) are ampicillin-resist ant and stable
More informationBasics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm
Basics of Recombinant DNA Technology Biochemistry 302 March 5, 2004 Bob Kelm Applications of recombinant DNA technology Mapping and identifying genes (DNA cloning) Propagating genes (DNA subcloning) Modifying
More informationGetting started with CRISPR: A review of gene knockout and homology-directed repair
Getting started with CRISPR: A review of gene knockout and homology-directed repair Justin Barr Product Manager, Functional Genomics Integrated DNA Technologies 1 Agenda: Getting started with CRISPR Background
More information454 Sample Prep / Workflow at the BioMedical Genomics Center (BMGC) University of Minnesota. Sushmita Singh
454 Sample Prep / Workflow at the BioMedical Genomics Center (BMGC) University of Minnesota Sushmita Singh 1 Consultation 2 Sample Prep (client) 3 Sample Prep (Core) Sequencing 4 Data QC 1 Consultation
More informationCRISPR GENOMIC SERVICES PRODUCT CATALOG
CRISPR GENOMIC SERVICES PRODUCT CATALOG DESIGN BUILD ANALYZE The experts at Desktop Genetics can help you design, prepare and manufacture all of the components needed for your CRISPR screen. We provide
More informationCRISPR Ribonucleoprotein (RNP) User Manual
CRISPR Ribonucleoprotein (RNP) User Manual Description This user manual describes how to use GenScript s CRISPR Ribonucleoprotein (RNP) products for targeted genome editing. The RNP system is comprised
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationReverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
More informationIMPROVEMENT OF CRISPR GENE EDITING EFFICIENCY AND BEYONDS
IMPROVEMENT OF CRISPR GENE EDITING EFFICIENCY AND BEYONDS YONGLUN LUO (ALUN) ALUN@BIOMED.AU.DK VIB, NOV. 21. 2017 Associate Professor, Department of Biomedicine, Aarhus University, Denmark Executive Director,
More informationNovel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.
Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART
More informationSMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
More informationPooled CRISPR guide RNA libraries for functional genomics screening: Do you know what s in your library?
Pooled CRISPR guide RNA libraries for functional genomics screening: Do you know what s in your library? Peter Sheffield R&D Scientific Program Director Agilent Technologies INTRODUCTION CRISPR: A Programmable
More informationProcomcure Biotech. PCR Reagents
Procomcure Biotech PCR Reagents valid for 2018 VitaTaq DNA Polymerase is a standard Taq DNA polymerase suitable for all common PCR applications like colonypcr, cloning applications, high-throughput PCR
More informationGuide-it sgrna In Vitro Transcription and Screening Systems User Manual
Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 632638, 632639, 632635, 632636, 632637 (040618) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support:
More informationDNA concentration and purity were initially measured by NanoDrop 2000 and verified on Qubit 2.0 Fluorometer.
DNA Preparation and QC Extraction DNA was extracted from whole blood or flash frozen post-mortem tissue using a DNA mini kit (QIAmp #51104 and QIAmp#51404, respectively) following the manufacturer s recommendations.
More informationGuide-it sgrna In Vitro Transcription and Screening Systems User Manual
Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra
More informationIncorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits
Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing
More informationLabBOOK VIROMER CRISPR. for RNP delivery
LabBOOK VIROMER CRISPR for RNP delivery General information Technology Viromer are polymer-based transfection reagents featuring a viral mechanism of membrane fusion. They do form transfection complexes
More informationReverse Transcription & RT-PCR
Creating Gene Expression Solutions Reverse Transcription & RT-PCR Reverse transcription, a process that involves a reverse transcriptase (RTase) which uses RNA as the template to make complementary DNA
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
More informationAlt-R CRISPR-Cas9 system:
Alt-R CRISPR-Cas9 system: Delivery of ribonucleoprotein complexes into Jurkat T cells using the Bio-Rad Gene Pulser Xcell Electroporation System See what more we can do for you at www.idtdna.com. For Research
More informationDharmacon TM solutions for studying gene function
GE Healthcare Capabilities Overview Dharmacon TM solutions for studying gene function RNAi Gene Expression Gene Editing RNA Interference Our RNAi products encompass the most complete portfolio of innovative
More informationTECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA
TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA Stranded, Illumina ready library construction in
More informationMolecular Genetics II - Genetic Engineering Course (Supplementary notes)
1 von 12 21.02.2015 15:13 Molecular Genetics II - Genetic Engineering Course (Supplementary notes) Figures showing examples of cdna synthesis (currently 11 figures) cdna is a DNA copy synthesized from
More informationjetcrispr RNP transfection reagent PROTOCOL
jetcrispr RNP transfection reagent PROTOCOL DESCRIPTION jetcrispr is a RiboNucleoProtein (RNP) transfection reagent designed to perform CRISPR-Cas9 genome editing in mammalian cells. This reagent has been
More informationCRISPR cas : Presented By: Pooya Rashvand Advised By: Dr. M.Aslanimehr
Journal Club & MSc Seminar CRISPR cas : Presented By: Pooya Rashvand Advised By: Dr. M.Aslanimehr CRISPR - cas : A New tool for Genetic Manipulations from Bacterial Immunity Systems Viral SS DNA RNA Guide
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationCRISPR/Cas9: Tools and Applications for Eukaryotic Genome Editing
CRISPR/Cas9: Tools and Applications for Eukaryotic Genome Editing Fei Ann Ran Broad Institute Cambridge, Massachusetts ran@fas.harvard.edu I will provide some background on the CRISPR/Cas9 technology,
More informationElectroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System)
Electroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System) BACKGROUND This protocol describes how to transfect cultured cells with ribonucleoprotein
More informationRecitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
More informationInhibition of HSV-1 Replication by Gene Editing Strategy. Running Title: Targeting HSV-1 Infection by CRISPR/Cas9
SUPPLEMENTARY MATERIALS 2/4/16 Inhibition of HSV-1 Replication by Gene Editing Strategy Running Title: Targeting HSV-1 Infection by CRISPR/Cas9 Pamela C. Roehm 1,2,3*, Masoud Shekarabi 1, Hassen Wollebo
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Guide-it Products for Successful CRISPR/Cas9 Gene Editing - Why choose Guide-it products? Optimized methods designed for speed and ease of use Complete kits that don t
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Sox2 localizes in neutrophils of mouse spleen. (a) Microscopy analysis of Sox2 and MPO in wild-type mouse spleen. Nucl, nucleus. (b) Immunohistochemistry staining of Sox2 and MPO
More informationInvestor Presentation
Investor Presentation September 1, 2018 editasmedicine.com 1 Forward Looking Statements This presentation contains forward-looking statements within the meaning of the safe harbor provisions of The Private
More informationSupplementary Information
Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA
More informationLipofection of Cas9/synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Thermo CRISPRMAX Kit)
Lipofection of Cas9/synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Thermo CRISPRMAX Kit) BACKGROUND This protocol describes how to transfect cultured cells with ribonucleoprotein
More informationTECHNOLOGIES. 3/19/18 Kayla Nygaard. https://i.ytimg.com/vi/pxw5yya-kh0/maxresdefault.jpg
TECHNOLOGIES 3/19/18 Kayla Nygaard https://i.ytimg.com/vi/pxw5yya-kh0/maxresdefault.jpg CRISPR IN THE NEWS CRISPR in 2018: Coming to a Human Near You Sickle-cell treatment clinical trials CRISPR Therapeutics
More informationBEST QUALITY HIGHEST PURITY. Recombinant ENZYMES & PROTEINS
BEST QUALITY HIGHEST PURITY Recombinant ENZYMES & PROTEINS We offer a wide range of highest quality enzymes and proteins for molecular biology including DNA polymerases, reverse transcriptases, DNA ligases,
More informationRoche Molecular Biochemicals Technical Note No. LC 9/2000
Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats
More informationDNA Matters Constructing Genes, Enzymes and Pathways by the Plate
DNA Matters Constructing Genes, Enzymes and Pathways by the Plate Leda Notchey May 19, 2015 Agenda 1. The Synthetic Biology Opportunity 2. The Gen9 Advantage 3. Working with Gen9: o o Custom Gene Synthesis
More informationBi 8 Lecture 5. Ellen Rothenberg 19 January 2016
Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA
More informationRIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)
Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information
More informationMonsterScript Reverse Transcriptase
MonsterScript Reverse Transcriptase Cat. Nos. MSTA5110, and MSTA5124 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com
More informationMMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit
MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis
More informationOpportunities for Accelerating Cell Line Development and Beyond
Opportunities for Accelerating Cell Line Development and Beyond European CM&C Strategy Forum May 24, 2017 Christopher Frye, Ph.D. Research Advisor & Group Leader Bioprocess R&D Presentation Outline CM&C
More informationab High Sensitivity DNA Library Preparation Kit (For Illumina )
ab185905 High Sensitivity DNA Library Preparation Kit (For Illumina ) Instructions for Use For the preparation of a DNA library using sub-nanogram amounts of DNA input for next generation sequencing applications
More informationab High Sensitivity DNA Library Preparation Kit (For Illumina )
ab185905 High Sensitivity DNA Library Preparation Kit (For Illumina ) Instructions for Use For the preparation of a DNA library using sub-nanogram amounts of DNA input for next generation sequencing applications
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationDefining the Activities and Specificities of CRISPR Nucleases in Human Cells
Defining the Activities and Specificities of CRISPR Nucleases in Human Cells CRISPR Congress Ben Kleinstiver Joung Lab Massachusetts General Hospital Harvard Medical School February 21 st, 2017 Areas of
More informationNanopore sequencing How it works
1 Nanopore sequencing How it works Nanopore Reader DNA or RNA passes through a nano-scale hole. The fluctuations in current as it passes through are used to understand the DNA or RNA sequence. An electrically
More informationSupplementary Information
Supplementary Information Super-resolution imaging of fluorescently labeled, endogenous RNA Polymerase II in living cells with CRISPR/Cas9-mediated gene editing Won-Ki Cho 1, Namrata Jayanth 1, Susan Mullen
More informationRecent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)
Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on
More informationPerformance Characteristics drmid Dx for Illumina NGS systems
Performance Characteristics drmid Dx for Illumina NGS systems MANUFACTURER Multiplicom N.V. Galileïlaan 18 2845 Niel BELGIUM Revision date: August, 2017 Page 1 of 7 TABLE OF CONTENTS 1. TEST PRINCIPLE...
More informationGenetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID peptidylglycine alpha-amidating monooxygenase PAM Human This gene encodes a multifunctional
More informationEPIGENTEK. EpiNext DNA Library Preparation Kit (Illumina) Base Catalog # P-1051 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiNext DNA Library Preparation Kit (Illumina) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The EpiNext DNA Library Preparation Kit (Illumina) is suitable for preparing a DNA library
More informationII First Strand cdna Synthesis Kit
DNA AMPLIFICATION & PCR ProtoScript II First Strand cdna Synthesis Kit Instruction Manual NEB #E6560S/L 30/150 reactions Version 1.5 12/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
More informationAccuScript High Fidelity 1 st Strand cdna Synthesis Kit
AccuScript High Fidelity 1 st Strand cdna Synthesis Kit INSTRUCTION MANUAL Catalog #200820 Revision B.01 For In Vitro Use Only 200820-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement
More informationUsing CRISPR for genetic alteration
Using CRISPR for genetic alteration Joffrey Mianné. j.mianne@har.mrc.ac.uk Mary Lyon Centre, MRC Harwell. CRISPR/Cas origins Origin of the CRISPR/Cas system: Clustered-Regularly Interspaced Short Palindromic
More informationProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.
DNA AMPLIFICATION & PCR ProtoScript First Strand cdna Synthesis Kit Instruction Manual NEB #E6300S/L 30/150 reactions Version 2.2 11/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
More informationPrimePCR Assay Validation Report
Gene Information Gene Name 3-hydroxybutyrate dehydrogenase, type 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID BDH1 Human This gene encodes a member of
More informationTargeted Gene Mutation in Rice Using a CRISPR-Cas9 System Kabin Xie 1, Bastian Minkenberg 2 and Yinong Yang 2*
Targeted Gene Mutation in Rice Using a CRISPR-Cas9 System Kabin Xie 1, Bastian Minkenberg 2 and Yinong Yang 2* 1 Department of Plant Pathology and Environmental Microbiology, Pennsylvania State University,
More informationSMRT Analysis Barcoding Overview (v6.0.0)
SMRT Analysis Barcoding Overview (v6.0.0) Introduction This document applies to PacBio RS II and Sequel Systems using SMRT Link v6.0.0. Note: For information on earlier versions of SMRT Link, see the document
More informationNature Biotechnology: doi: /nbt.4199
Supplementary Figure 1 Base editing activities of engineered A3A-BE3 variants with mutations designed to disrupt non-specific interactions with substrate ssdna. Graphs illustrating the frequencies of C
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More informationSupplementary Figure 1. Comparison of RNA yield between kits.
Supplementary Figure 1 Comparison of RNA yield between kits. 1µg DNA was used for RNA synthesis according to each manufacturer s protocol. The RNA samples in lanes 1 and 2 were synthesized using kits from
More informationSunScript TM Reverse Transcriptase RNaseH+
Reverse Transcriptase RNaseH+ INDEX Ordering Information...3 Kit Contents...3 Source...3 Activity Unit Definition...3 Inactivation...3 Shipping and Storage...3 Handling...3 Quality Control Assays...4 Reagents
More informationUnique, dual-matched adapters mitigate index hopping between NGS samples. Kristina Giorda, PhD
Unique, dual-matched adapters mitigate index hopping between NGS samples Kristina Giorda, PhD 1 Outline NGS workflow and cross-talk Sources of sample cross-talk and mitigation strategies Adapter recommendations
More informationSupplementary Protocol: CIRCLE-seq Library Preparation
Supplementary Protocol: CIRCLE-seq Library Preparation Reagent Gentra Puregene Tissue Kit Qubit dsdna BR Assay Kit Agencourt AMPure XP magnetic beads High throughput, with bead, PCR-free Library Preparation
More informationPrimeScript II 1st strand cdna Synthesis Kit
Cat. # 6210A/B For Research Use PrimeScript II 1st strand cdna Synthesis Kit Product Manual Table of Content I. Description... 3 II. Components... 3 III. Storage... 4 IV. 1st Strand cdna Synthesis Reaction...
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Separations Simply Spectacular INDELS Identify indels Determine if one or both copies of your gene have indels The Guide-it Genotype Confirmation Kit: Simple detection
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID myeloperoxidase MPO Human Myeloperoxidase (MPO) is a heme protein synthesized during
More informationHuman Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased
Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased exponentially since the 1990s. In 2005, with the introduction
More information