The Genomic Transformation of Health

Transcription

1 The Genomic Transformation of Health or: an introduction to the potential of genomics in healthcare Dr Tom Connor School of Biosciences and Systems Immunity University Research Institute Cardiff

2 Beyond the hype What is genomics? Current research and applications : coming to a clinic near you The challenge of translation and exploitation Future Potential Overview

3 Genomics Genomics is a term given to a group of technologies These technologies allow us to explore the genome sequence of an organism

4 What does that mean? That blueprint defines the features of the cell in which it is found DNA encodes the blueprint for virtually every cell of every organism on the planet Genomics enables us to read this blueprint

5 So what? If we can read the blueprint of cells, then we can In the case of humans Understand how human cells work and interact Understand when a change in a cell s DNA will lead to disease Understand how the whole organism (i.e. us) may respond to external stimuli (such as treatment) Work out ways to get around defense mechanisms In the case of pathogens Understand how they cause disease Understand how they are related to other pathogens Understand which ones are worse, and to be able to track them in real time So in theory this allows us to unpick virtually any and all disease to understand the health of an individual at the highest resolution possible

6 Genomics is older than you think 96 gattatccttcgctcaatctggggcaggcggtgatggtctattgctatcaattagcaacattaatacaacaaccggcgaaaagtgatgcaacggcagacc + BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB Illumina: 500,000,000 reads/run 454: 1,000,000 reads/run Roche 454 Pac Bio Ion Torrent Solexa / Illumina ABI Sanger sequencers ,000 human genomes published Evolution of PMEN1 (240 genomes) Evolution of MRSA ST239 (63 genomes) Evolution of Typhi (19 genomes) Human Genome finished Draft of the Human Genome First Bacterial Genome Sequence

7 Cost of sequencing a human genome

8 Genomics Genomics is a term given to a group of technologies These technologies allow us to explore the genome sequence of an organism But not an end in of itself

9 Precision medicine harnesses genomics for patient benefit Sequence data Genomics Lifestyle Biomedical analysis tools e-health data Big Data Analytics Environment Precision medicine brings together information about a persons genome, their environment and their lifestyle for disease prevention and treatment Genomics makes precision medicine possible Genomics is unambiguous and much more easily measurable on a population level than other factors

10 Translating potential Genomics is moving from the research lab into healthcare Genomics can offer improvements over some current approaches; Cost* Speed Unambiguous Several key fields already use it And that usage is growing

11 Where genomics is already working Drug Development Public Health Target Identification Diagnostics Treatment Selection

12 Infectious Disease Diagnostics >36 hours From Didelot et al, 2012, Nature Reviews Genetics

13 Tracking intercontinental transmission Wave 1 Wave 2 Wave 3 Mutreja, Kim, Thomson, Connor et al, Nature, 2011

14 Tracking within-country spread From He et al, Nature Genetics, 2012

15 Cancer diagnostics In the old days, we had a limited number of features we could test for With genomics we can test multiple genes simultaneously Genomics has enabled the identification of new cancerassociated genes Genomics has also identified mutations associated with drug resistance This means as well as testing for patient risk, we can also profile tumors Doing this at point of diagnosis potentially enables the optimization of treatment from day 1

16 Neuroscience Neurological disease can have a genetic basis, and it can be complex Genomics enables the simultaneous testing of hundreds, or thousands, of genes This has already enabled the identification of sets of genes involved in disease Opens up the potential for early diagnostics Allows identification of disease pathways Enables the identification of drug development targets

17 Researchers in Wales already work across all of these areas, and more Challenge is to translate the possibilities into practice More than just rolling results into clinical labs Reproducibility Accreditation Validation Already in Wales

18 Future Potential Diagnostics are low hanging fruit Identifying disease markers is relatively easy We have been doing it for >25 years Gets even easier as you generate more data Real potential is in other areas Integrated, precision approaches are much harder

19 Genomics-guided public health Real-time sequencing enables Real-time surveillance Pathogen transmission can be tracked in real time Opens up the possibility for automated public health responses in response to surveillance data

20 Epigenetics Modifications to DNA can modulate gene expression These modifications can relate to lifestyle and/or environment These DNA modifications can play a role in a range of diseases from Cancer to Obesity, by turning genes off, on or very on It might be that many diseases have an epigenetic component, blurring the line between nature and nurture The same technologies that can read the human genome can also read these modifications

21 Moving towards point of care genomics Current technologies are mostly benchtop at best Oxford Nanopore is the next step; a USB stick sized sequencing instrument

22 Instant diagnostics, targeted treatment Imagine a world where our genomics could be used to immediately identify the best drug for us? Imagine a world where we could enable a patients own immune cells to fight cancer Imagine a world where we could remove immune cells that cause autoimmune disease Genomics unlocks all of these possibilities Huge potential ; lots of work required

23 A Genomics Revolution? GENOMICS Not a revolution Change isn t occurring overnight But it is a new era Genomics is a fundamental tool Genomics opens up many new possibilities And, like most technologies it is developing fast Challenge is for us to use it And for the regulators to keep up

24 What we need in Wales To be Genomic Pioneers There are many who would have you believe that the genomics revolution is a long way in It isn t ; others talk a good game, but there are a huge number of areas that are yet to be exploited Wales is a perfect size We have enormous potential locally What we need is a vision from the top Building on what we have Informed by the needs of patients Genomics isn t intrinsically harder, challenges are different, but the rewards are potentially huge

25 The Genomic Transformation of Health or: an introduction to the potential of genomics in healthcare Dr Tom Connor School of Biosciences and Systems Immunity University Research Institute Cardiff