PhoreMost Ltd. Phenotypic screening for novel druggable targets using Protein-interference
|
|
- Britton McBride
- 5 years ago
- Views:
Transcription
1 PhoreMost Ltd Phenotypic screening for novel druggable targets using Protein-interference
2 Company Snap-shot PhoreMost Ltd: New Biotech with a mission to drug key underlying causes of unmet diseases, the majority of which are intractable to current drug discovery technologies Ashok Venkitaraman MD, PhD, FMedSci Chris Torrance PhD Novel PROTEINi phenotypic screening platform to identify the best disease targets & how to drug them Building a pipeline of validated targets & drug discovery programs for out-licensing key pharma bottleneck Dir. MRC Cancer Unit, Cambridge University CSO of PhoreMost Founder Horizon Discovery CEO of PhoreMost Cancer focus initially; first program = novel drug target site addressing mutant KRAS cancers Also seeking collaborations on the Protein-i platform
3 The druggable genome, so far The human proteome: >100K (?) possible proteins (including splice variants) >300K (?) predicted high-confidence binary interactions Protein-protein interactions represent a vast untapped repertoire of potential targets Potential drug targets Drugged targets belong to just a few structural classes Only a tiny number of proteome targets has been drugged Eg., 1065 unique drugs (of 1357) target 324 known efficacy targets (of which 266 are human proteins) Overington et al. (2006) 68 targeted cancer therapies (July 2014) Kinases Glycosylated phosphoproteins Nuclear receptors Monoxygenases Growth factors Haemopoietic receptors GPCRs Cytokines Nimgaonkar & Venkitaraman (unpubl.)
4 Why is target-id/validation important? (Cancer e.g.,) Advances in genomics leading to deep genetic understanding of disease biology But few key disease drivers are directly druggable Those that are have largely been done, to good effect Defining novel drug sites (direct or indirect) is now a bottleneck & you can t guess! Not druggable Druggable
5 The underlying potential of phenotypic screens 1) Good targets are hidden in complex disease networks: Targets should be screened exhaustively to link them to a disease trait 2) Good drug sites are hidden in subtle and changing protein shapes in living cells: Targets should ideally be screened in with high-diversity probes that mimic biologic surfaces New solutions are required to uncover targets AND probe cryptic drug sites as they exist in nature
6 Complementary drug discovery approaches Target-based screening Phenotypic screening YES e.g., kinases with deep pockets + natural small ligands to mimic Streamlined drug discovery Validation critical Druggability essential Small list of candidates NO e.g., Protein/Protein interactions with large & discontinuous surface areas Swinney & Anthony NRDD 2011 Direct screening for desired outcome Good source of 1 st in class targets Small molecules>>diversity & target-id? RNAi/CRISPR>>>>>druggablilty? How can systematic target identification and validation be more closely linked to druggability?
7 Overview: PROTEINi phenotypic screening platform Genome-wide target-id & validation: GE Libraries e.g., CRISPR: High Target Specificity Off-targets weakly exploitable Drug sites not identified Size ~30,000 RNAi Libraries Low Target Specificity Off-targets confounding Drug sites not identified Size ~30,000 PROTEINi Libraries (diverse 3D protein-folds) High Target Specificity Off-targets co-exploitable Drug sites identified Size ~1,000,000,000 (dwarfs small mol. diversity)
8 PROTEINi : A live-cell system to find Tx-targets & how to drug them RNAi/CRISPR work indirectly to remove proteins. This is NOT what drugs do & druggable sites are NOT identified Does it usefully affect a disease? Does it spare normal cells Which patients will benefit most? PROTEINi directly inhibits target proteins with a high diversity libraries (10 9 ) of protein-fold shapes that systematically probe for cryptic druggable sites Phenotypic Screening (USP#2)
9 Genome-based 3D protein fold libraries Smaller or random in sequence Bigger e.g., Antibodies No 3D shape = No targets Derived from genomic coding sequences Goldilocks position for size (15-80aa), affinity, 3D potential & shape diversity Large footprint & very high affinity = Lots of targets No drugs Viable drugs But non-viable drugs
10 Harnessing protein-fold biodiversity (Phylomers) Collaboration with Avacta Affimers Collaboration with Medimmune scfvs Coding sequences fragments from 35 bacterial species Thermophillic/Extremophillic High propensity for self-folding subdomains Collaboration with Phylogica Ltd
11 3D bio-active protein folds for new target ID and drug discovery? Seeking the Goldilocks position from nature for high 3D-shape diversity and functionality to probe and then inform innovative low molecular weight NCE-discovery and design across the Site Diversity Site Affinity Site Size Phenotype! ( Pharmacophore ) living proteome
12 Allo-targeting Active site-directed small-molecule drugs competitively inhibit conserved catalytic sites Making it difficult to obtain selectivity, which can confound disease vs normal targeting High potency is also required to compete with natural ligands e.g., ATP in kinases Inhibitors only; principally against primary activity Allostery relies on non-competitive alteration of global 3 o /4 o protein structure Higher specificity & lower hurdles to modulation, especially for P/P interactions Allostery can be functionally effective in um range (c.f. nm for ATP-site directed inhibitors) Inhibitors or activators; primary or secondary activities
13 Historical hit rates for peptide libraries Phylomer hit rate data from Phylogica, unpublished
14 SITE SEEKER : Going rapidly from a target to valuable drug Value inflection point
15 SITE SEEKER : Mammalian cell functional screening PoC AP1 pathway downstream of KRAS Plasmid-based AP1 responsive luciferase construct Co-transfected into U2OS s with Phylomer plasmids 24hrs later PMA stimulated 4hrs later Luciferase read-out
16 SITE SEEKER : Primary AP1 screen data 3120 Phylomers screened well-by-well Pathway inducers and inhibitors obtained in the primary screen 25 pathway reducing hits; 14 repeat-tested positively High hit rate (1 in 200) for a peptide library 3D protein folds key
17 Hit validation data 14 confirmed hits reanalysed on AP1 FF-luc vs HSV TK Renilla-luc 6 hits show selective suppression of AP1 activity Other hits = general transcription inhibitors (>80% FF/Renilla ratio)
18 Hit validation data 3 hits retain activity on endogenous promoter 645nt promoter from sulfiredoxin1; with and without AP1 sites mutated No effect on Notch-ICD or FOXO-driven promoters
19 SITE SECURE : Target-ID
20 SITE SECURE : Target-ID Untransfected Empty vector Pyc36 6G8 25C3 48E6 3 hits taken into pull-downs V5-tagged Phylomers expressed in HEK293s Analysed by PAGE>Mass spec 25C3 (16aa) Phylomer hit: 4 clear bands on Coomassie 3 bands = same kinase Other band shares a common non-kinase domain
21 Target-confirmation Phenotype recapitulated by sirna to Kinase-A (orthogonal validation)
22 Allosteric binding-site confirmation NKD NKD Presumptive allosteric mechanism Tagged phylomer & Kinase-A non-kinase domain (NKD) expressed in U2OS cells IgG NKD IP d and immunoblotted NKD co-precipitates with Phylomer IgG
23 Allosteric binding-site confirmation Studied affinity of 25C3 binding to the Kinase-A non-kinase domain (NKD) Endogenous ligand Kd ~2x10-8 M by Biolayer Interferometry Endogenous ligand binds at Kd ~10-8 M Kinase NKD Phylomer Still determining whether it is a good target not progressing into chemistry yet NKD Substrate-P
24 PoC for drugging an allosteric site Targeting a known allosteric second site in a mitotic kinase Kinase-B previously drugged via ATP-site, but is non-selective w.r.t tumour vs normal cells Substrate-binding domain P/P interaction inhibitors with a narrower MoA may be better?
25 SITE BLOCK : Small molecule discovery Site-Block : Simple FP-based peptide displacement assay format Screened 120K small molecule library for hits Several hits bind an adjacent small druggable pocket
26 Novel KRAS Phenotype of allosteric kinase-b inhibitors In the LO stage; ~20nM on cells (+ve biomarkers) Allosteric-i has > KRAS synthetic lethality than ATPi
27 Novel resistance phenotype of allosteric kinase-b inhibitors ATP-site is easily mutated in cancers to abrogate drug binding Allosteric inhibitors are <<<< susceptible to resistance Allosteric ATPi Allosteric ATPi Many resistant colonies within 3-weeks for ATPi Small # of resistant colonies in 7-weeks with Allosteric-i Allosteric-i still works in ATPi resistant clones
28 SITE SEEKER : Moving to 10 9 shapes?
29 Emerging high-throughput PROTEINi formats Higher throughput pooled screens needed to access 10 9 library diversity Ideally covering multiple assay types; focussed >> holistic Good assay/selection methods will be key Nano BiT Protein:Protein Sensitive interaction reporters e.g., complementation Promega s NanoBiT Pathway: Turning Off signals into On signals In-house assay development Synthetic Lethal Viability drop-out screens NGS readout
30 Next-Gen sorting: Microfluidics 1) Single cells, each expressing a single protein-fold, added to individual picodroplets, and queued in a microfluidic biochip channel Picodroplets: i) FACS-like sorting rates ii) Multiple read-outs possible i) Luciferase or GFP ii) Mass-spec iii) Secreted protein detection iii) Enables high cell-viability 2) Luciferase reagent added sequentially to each individual picodroplet 3) Dark vs light cells sorted and collected for NGS determination of PROTEINi hits
31 Next-Gen sorting: Microfluidics 1) Single cells, each expressing a single protein-fold, added to individual picodroplets, and queued in a microfluidic biochip channel Picodroplets: i) FACS-like sorting rates ii) Multiple read-outs possible i) Luciferase or GFP ii) Mass-spec iii) Secreted protein detection iii) Enables high cell-viability 2) Luciferase reagent added sequentially to each individual picodroplet 3) Dark vs light cells sorted and collected for NGS determination of PROTEINi hits
32 Summary Core novel SiteSeeker Protein-interference platform to de-orphan undruggable targets/pathways Advantages over RNAi/CRISPR in assaying the proteome directly for cryptic druggable sites Early PoC stage: Good hit rates in small scale functional screens Commercial ops established to scale up screens & disease models seeking collaborations
How Targets Are Chosen. Chris Wayman 12 th April 2012
How Targets Are Chosen Chris Wayman 12 th April 2012 A few questions How many ideas does it take to make a medicine? 10 20 20-50 50-100 A few questions How long does it take to bring a product from bench
More informationOriGene GFC-Arrays for High-throughput Overexpression Screening of Human Gene Phenotypes
OriGene GFC-Arrays for High-throughput Overexpression Screening of Human Gene Phenotypes High-throughput Gene Function Validation Tool Introduction sirna screening libraries enable scientists to identify
More informationHitting the target in phenotypic drug discovery: Advances in receptor deconvolution
Hitting the target in phenotypic drug discovery: Advances in receptor deconvolution Jim Freeth, Retrogenix, UK Jim.Freeth@retrogenix.com ELRIG Research and Innovation Meeting March 11th 2014 The right
More informationDharmacon TM solutions for studying gene function
GE Healthcare Capabilities Overview Dharmacon TM solutions for studying gene function RNAi Gene Expression Gene Editing RNA Interference Our RNAi products encompass the most complete portfolio of innovative
More informationAdvanced Therapeutic Antibody Discovery with Multiplexed Screening
Advanced Therapeutic Antibody Discovery with Multiplexed Screening White Paper Scientists need powerful tools that can deliver results to fully understand the ability of candidate antibodies to interrupt
More informationCRISPR GENOMIC SERVICES PRODUCT CATALOG
CRISPR GENOMIC SERVICES PRODUCT CATALOG DESIGN BUILD ANALYZE The experts at Desktop Genetics can help you design, prepare and manufacture all of the components needed for your CRISPR screen. We provide
More informationTARGET VALIDATION. Maaike Everts, PhD (with slides from Dr. Suto)
TARGET VALIDATION Maaike Everts, PhD (with slides from Dr. Suto) Drug Discovery & Development Source: http://dlab.cl/molecular-design/drug-discovery-phases/ How do you identify a target? Target: the naturally
More informationRecent Progress of Interprotein s Research Activities. Interprotein Corporation
Recent Progress of Interprotein s Research Activities - INTENDD and AI-guided INTENDD - Interprotein Corporation 1 Interprotein Corporation Location: Osaka, Japan Year Established: 2001 CEO & President:
More informationAccessing advanced TIDVAL technology at cost in return for sharing the up-side
HORIZON DISCOVERY Accessing advanced TIDVAL technology at cost in return for sharing the up-side On Helix, Cambridge UK, July 2015 Jon Moore CSO Disclaimer This Presentation does not constitute or form
More informationUse of a Label-Free Platform in a preclinical Contract Research Organization Environment
Use of a Label-Free Platform in a preclinical Contract Research Organization Environment Scott Perschke Director, Assay Development Contents Introduction 2 Problem Statement 2 Previous Options 2 Solution
More informationAffinity Reagents: The Landscape and Affimer Technology Competitive Advantages
Affinity Reagents: The Landscape and Affimer Technology Competitive Advantages Introduction It is well accepted that the limitations of antibodies present valuable commercial opportunities for alternative
More informationAntibodies to Challenging Receptor Targets through NGS and Cell-Based Antibody Phage Panning. Mark Tornetta
Antibodies to Challenging Receptor Targets through NGS and Cell-Based Antibody Phage Panning Mark Tornetta Points to convey regarding receptor targets Antigen diversity- cells and engineered ECDs Be creative
More informationDrug Targets - an overview of historical success and protein kinase inhibitors - successes and attrition. John P. Overington
Drug Targets - an overview of historical success and protein kinase inhibitors - successes and attrition John P. Overington jpo@ebi.ac.uk Assay/Target ChEMBL The Organisation of Drug Discovery 1. Scientific
More informationFRAUNHOFER IME SCREENINGPORT
FRAUNHOFER IME SCREENINGPORT Detection technologies used in drug discovery Introduction Detection technologies in drug discovery is unlimited only a biased snapshot can be presented Differences can presented
More informationTargeting Proteins for Degradation: Characterizing PROTAC Kinetics and Mode of Action using Live-Cell Assays. Kristin M. Riching, Ph.
Targeting Proteins for Degradation: Characterizing PROTAC Kinetics and Mode of Action using Live-Cell Assays Kristin M. Riching, Ph.D PROTACs: An Attractive Drug Discovery Strategy PROTACs, or Proteolysis
More informationCHAPTER 4. Milestones of the drug discovery
CHAPTER 4 Milestones of the drug discovery 4.Milestones of the drug discovery: Highlights the importance of the below critical milestones of the drug discovery and correlated to the current research. 1.
More informationCellular Assays. A Strategic Market Analysis. Sample Slides
A Strategic Market Analysis Sample Slides 2002 For information contact: Frontline Strategic Consulting, Inc. 1065 E. Hillsdale Blvd, Suite 403, Foster City, CA 94404 650-525-1500 x125, x135 or x145 info@frontlinesmc.com
More informationPeptide libraries: applications, design options and considerations. Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST
Peptide libraries: applications, design options and considerations Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST Overview 1 2 3 4 5 Introduction Peptide library basics Peptide library design considerations
More informationMonitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology. Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics
Monitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics Proteomics and studying dynamic interactions AP-MS Proteomics
More informationPersonalized CAR-T Immunotherapy Platform
GLP, GMP, and CLIA-Certified Lab Personalized CAR-T Immunotherapy Platform Accelerate your cancer research and drug discovery Platform Overview 1500 Existing Hybridomas and Antibody Engineering Custom
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More information11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11
Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the
More informationScanning the protein surface to uncover new small molecule. binding sites using fragments. Gregg Siegal ZoBio
Scanning the protein surface to uncover new small molecule binding sites using fragments Gregg Siegal ZoBio Increasing Interest in Alternative Small Molecule Binding Sites 1. Enhanced specificity 2. Adress
More informationEnhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme
Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the
More informationLARGE-SCALE PROTEIN INTERACTOMICS. Karl Frontzek Institute of Neuropathology
LARGE-SCALE PROTEIN INTERACTOMICS Karl Frontzek Institute of Neuropathology STUDYING THE INTERACTOME A yeast 2 hybrid (DB: DNA binding domain, AD: activation domain) B tandem affinity purification (dashed
More informationRecent years have witnessed an expansion in the disciplines encompassing drug
Course overview Recent years have witnessed an expansion in the disciplines encompassing drug discovery outside the pharmaceutical industry. This is most notable with a significant number of Universities
More informationKinase Cell-Based Assays for Selectivity Assessment and Personalized Medicine
Kinase Cell-Based Assays for Selectivity Assessment and Personalized Medicine Deborah J. Moshinsky, PhD January 16, 13 Cell Assay Innovations, Inc. 1 Outline of Presentation Focus on Cellular Assays More
More informationTITLE: Genomewide Screen for Synthetic Lethal Interactions with Mutant KRAS in Lung Cancer
Award Number: W81XWH-16-1-0287 TITLE: Genomewide Screen for Synthetic Lethal Interactions with Mutant KRAS in Lung Cancer PRINCIPAL INVESTIGATOR: Yin-Yuan Mo CONTRACTING ORGANIZATION: University of Mississippi
More informationPropelling GPCR drug discovery through innovative products and services Be the change the market seeks
Propelling GPCR drug discovery through innovative products and services Be the change the market seeks With the cost of bringing a new therapeutic agent to market now estimated at around $2 billion and
More informationInvestigating Compound Mechanism of Action
Investigating Compound Mechanism of Action Using Genetic Interaction Screens Lisa Marshall, Priya Mitty, Michael Ollmann, and Paul Kassner Michael Ollmann, Ph.D. Principal Scientist, Therapeutic Discovery
More informationThe Two-Hybrid System
Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe
More informationHow To Choose a GeneCopoeia Luciferase System. Ed Davis, Ph.D.
TECHNICAL NOTE How To Choose a GeneCopoeia Luciferase System Ed Davis, Ph.D. Introduction Luciferase reporter systems are invaluable tools for several applications, including regulation of gene expression
More informationOpportunities for Accelerating Cell Line Development and Beyond
Opportunities for Accelerating Cell Line Development and Beyond European CM&C Strategy Forum May 24, 2017 Christopher Frye, Ph.D. Research Advisor & Group Leader Bioprocess R&D Presentation Outline CM&C
More informationInnovative Pharmaceutical Solutions for Discovery Chemistry, Biology and cgmp Manufacturing
Innovative Pharmaceutical Solutions for Discovery Chemistry, Biology and cgmp Manufacturing Overview Serving biotech and pharma community since 1998 Proven track record of advancing small molecules from
More informationCyto-Mine. The Single Cell Analysis and Monoclonality Assurance System
Cyto-Mine The Single Cell Analysis and Monoclonality Assurance System Biopharmaceutical discovery and cell line development workflows streamlined like never before w w w. s p h e ref l u i d i c s. c o
More informationProCode TM. Life Science, Inc. A Rapid Flexible MAb-Like Discovery Platform for Creating Diagnostic Antibodies.
ProCode TM A Rapid Flexible MAb-Like Discovery Platform for Creating Diagnostic Antibodies Life Science, Inc. www.meridianlifescience.com Custom Monoclonal Development Meridian Life Science, Inc. (MLS)
More informationFragment-based screening of enzyme drug targets: Microfluidic mobility shift assay improves confidence in candidate selection
Fragment-based screening of enzyme drug targets: Microfluidic mobility shift assay improves confidence in candidate selection Introduction Fragment-based lead discovery is establishing itself as valuable
More informationPartnered Discovery of High-Quality Antibody Drug Candidates. Company Presentation
Partnered Discovery of High-Quality Antibody Drug Candidates Company Presentation AbCheck s Unique Offering A unique source of human antibodies with one of the industry's most versatile technology platforms
More informationHORIZON DISCOVERY Joint Venture between Horizon Discovery & Centauri Therapeutics
HORIZON DISCOVERY Joint Venture between Horizon Discovery & Centauri Therapeutics Briefing 2 nd March 2016 Exec Summary Horizon Discovery Group plc Enters Immuno-Oncology Therapeutic Development and Forms
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationSynthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.
Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research
More informationThe ChEMBL Database. ICIC 2012 Berlin, Germany October John P. Overington EMBL- EBI.
The ChEMBL Database ICIC 2012 Berlin, Germany October 2012 John P. Overington EMBL- EBI jpo@ebi.ac.uk Chemical Space All compounds Drug-like compounds Available compounds Only certain molecules have features
More informationProteoGenix. Life Sciences Services and Products. From gene to biotherapeutics Target Validation to Lead optimisation
ProteoGenix Life Sciences Services and Products From gene to biotherapeutics Target Validation to Lead optimisation ProteoGenix Philippe FUNFROCK, founder and CEO French company located in Strasbourg,
More informationSupplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the
Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationSupplementary Information
Supplementary Information Peroxiredoxin-2 and STAT3 form a redox relay for H 2 O 2 signaling Mirko C. Sobotta 1, Willy Liou 1, Sarah Stöcker 1, Deepti Talwar 1, Michael Oehler 1, Thomas Ruppert 2, Annette
More information27041, Week 02. Review of Week 01
27041, Week 02 Review of Week 01 The human genome sequencing project (HGP) 2 CBS, Department of Systems Biology Systems Biology and emergent properties 3 CBS, Department of Systems Biology Different model
More informationSupplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
More informationNon-coding Function & Variation, MPRAs II. Mike White Bio /5/18
Non-coding Function & Variation, MPRAs II Mike White Bio 5488 3/5/18 MPRA Review Problem 1: Where does your CRE DNA come from? DNA synthesis Genomic fragments Targeted regulome capture Problem 2: How do
More informationCS262 Lecture 12 Notes Single Cell Sequencing Jan. 11, 2016
CS262 Lecture 12 Notes Single Cell Sequencing Jan. 11, 2016 Background A typical human cell consists of ~6 billion base pairs of DNA and ~600 million bases of mrna. It is time-consuming and expensive to
More informationA new strategy for genetics & pharmacogenomics (GpGx) Robert M. Plenge, MD, PhD Vice President Head of Genetics & Pharmacogenomics
A new strategy for genetics & pharmacogenomics (GpGx) Robert M. Plenge, MD, PhD Vice President Head of Genetics & Pharmacogenomics 1 Robert Plenge Our Shared Goals Impact the entire pipeline Drive early
More informationThis place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.
G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic
More informationSupplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with
Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated
More informationThe Confo body technology, a new platform to enable fragment screening on GPCRs
The Confo body technology, a new platform to enable fragment screening on GPCRs Christel Menet, PhD CSO Miptec, 216 Confo Therapeutics Incorporated in June 215 Located in Brussels, Belgium Confo Therapeutics
More informationXpress CF+ : A Cell-Free Platform for the Rapid Screening and Production of Homogeneous ADCs
Xpress CF+ : A Cell-Free Platform for the Rapid Screening and Production of Homogeneous ADCs Alexander R. Steiner, M.S. Director, Protein Biochemistry Tuesday Feb 3 rd, 215 Making novel drugs is Pammolli
More informationPharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001
Pharmacogenetics: A SNPshot of the Future Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 1 I. What is pharmacogenetics? It is the study of how genetic variation affects drug response
More informationAccelerate Your Antibody Discovery and Cell Line Development Workflows with Cyto-Mine
Accelerate Your Antibody Discovery and Cell Line Development Workflows with Cyto-Mine Cyto-Mine The Single Cell Analysis Platform Cyto-Mine is the world s first fully integrated platform for high-throughput
More informationData Sheet. Application Monitor glucocorticoid signaling pathway activity. Screen activators or inhibitors of the glucocorticoid signaling pathway.
Data Sheet GAL4 Reporter Kit (Glucocorticoid Receptor Pathway) Catalog #: w70533 Background The glucocorticoid signaling pathway plays an important role in development, fluid homeostasis, cognition, immune
More informationEngage with us on Twitter: #Molecule2Miracle
Engage with us on Twitter: #Molecule2Miracle Kassy Perry President & CEO Perry Communications Group PhRMA Alliance Development Consultant.@kassyperry Emily Burke, Ph.D. Director of Curriculum BioTech
More informationApplications of HTRF and Tag-lite Assays for HTP Antibody Screening
Applications of HTRF and Tag-lite Assays for HTP Antibody Screening Brigitte Devaux, PhD Bristol Myers Squibb, Redwood City CA HTRF Symposium April 25, 2013 1 Introduction Generate human therapeutic antibodies
More informationCourse Agenda. Day One
Course Agenda BioImmersion: Biotech for the Non-Scientist A three-day, in-depth course that provides the background required for understanding today s fast-paced biotech marketplace. Beginning with an
More informationCell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
More informationMicroRNAs and Genome Editing Two Evolving Protagonists in Medicine
MicroRNAs and Genome Editing Two Evolving Protagonists in Medicine Gerald W Dorn II, MD, FACC Needleman Professor and Associate Chair Department of Internal Medicine Washington University in St Louis The
More informationAn Automated, Cell-based Platform for the Rapid Detection of Novel Androgen Receptor Modulators
A p p l i c a t i o n N o t e An Automated, Cell-based Platform for the Rapid Detection of Novel Androgen Receptor Modulators Brad Larson and Peter Banks, BioTek Instruments, Inc., Winooski, VT Bruce Sherf,
More informationHow to Screen a Billion Drug Candidates?
How to Screen a Billion Drug Candidates? Single Cell Functional Assays: Ultra-sensitive, Ultra-fast, Ultrahigh-throughput Next-Generation Drug Discovery The advantages of de novo protein engineering for
More informationPhylogica. Harnessing Biodiversity for Peptide Therapies. Life Sciences Showcase, 23 August 2011 Nick Woolf: CFO & VP Corporate Development
Phylogica Harnessing Biodiversity for Peptide Therapies Life Sciences Showcase, 23 August 2011 Nick Woolf: CFO & VP Corporate Development Introduction Biotech company offering leading peptide drug discovery
More informationtranscription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,
Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected
More informationFuture of Novel Drugs: DUBs Drug Discovery Platform LifeSensors Inc.
Future of Novel Drugs: DUBs Drug Discovery Platform LifeSensors Inc. 271 Great Valley Parkway Malvern PA 19355 Phone: 610-644-8845 Fax: 610-644-8616 www.lifesensors.com LifeSensors Capabilities ~35 active
More informationProteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125
Proteomics Manickam Sugumaran Department of Biology University of Massachusetts Boston, MA 02125 Genomic studies produced more than 75,000 potential gene sequence targets. (The number may be even higher
More informationImproving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm
Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Anja Smith Director R&D Dharmacon, part of GE Healthcare Imagination at work crrna:tracrrna program Cas9 nuclease Active crrna is
More informationIntroduction to Assay Development
Introduction to Assay Development A poorly designed assay can derail a drug discovery program before it gets off the ground. While traditional bench-top assays are suitable for basic research and target
More informationA New Peptide Drug Modality; Helix-Loop-Helix Technology. Interprotein Corporation
A New Peptide Drug Modality; Helix-Loop-Helix Technology Interprotein Corporation 1 Interprotein Corporation Location: Osaka, Japan Year Established: 2001 CEO & President: Masato Hosoda www.interprotein.com
More informationFluorescent protein. Origin of fluorescent proteins. Structural and biophysical analysis of FPs. Application in molecular biology and biotechnology
Origin of fluorescent proteins types of FPs mechanism of fluorescence Fluorescent protein Structural and biophysical analysis of FPs Application in molecular biology and biotechnology Variety of organisms
More informationKREX World s only proteomics technology that produces full-length, correctly folded, functionally verified proteins
THE functional proteomics company KREX World s only proteomics technology that produces full-length, correctly folded, functionally verified proteins SENGENICS IS A CAMBRIDGE UNIVERSITY SPIN-OFF COMPANY
More informationCHAPTERS 16 & 17: DNA Technology
CHAPTERS 16 & 17: DNA Technology 1. What is the function of restriction enzymes in bacteria? 2. How do bacteria protect their DNA from the effects of the restriction enzymes? 3. How do biologists make
More informationCustom Antibodies & Recombinant Proteins
Custom Antibodies & Recombinant Proteins INTRODUCTION Custom services to meet your research and development requirements Improvements in health, medicine and diagnostics over the past century can be largely
More informationsupplementary information
DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and
More informationDiscovery on Target. Short Course Preview Deck
Discovery on Target Short Course Preview Deck Targeting of GPCRs with Monoclonal Antibodies Barbara Swanson, Ph.D. Sorrento Therapeutics, Inc. October 2014 GPCR Short Course Overview Introductions Brief
More informationPartnered Discovery of High-quality Antibody Drug Candidates COMPANY PRESENTATION DECEMBER 2016
Partnered Discovery of High-quality Antibody Drug Candidates COMPANY PRESENTATION DECEMBER 2016 Corporate Overview A unique source of therapeutic human antibodies with one of the industry's most versatile
More informationConference Calendar. healthtech.com. January High-Content Analysis January 8-11 San Francisco, CA
High-Content Analysis January 8-11 San Francisco, CA www.highcontentanalysis.com January 2013 PepTalk January 21-25 Palm Springs, CA www.chi-peptalk.com January 24-25 Pipeline 1: Formulation: Optimizing
More informationHigh Throughput Suspension Cell and Bead Analysis. Intellicyt ique Screener PLUS
High Throughput Suspension Cell and Bead Analysis Intellicyt ique Screener PLUS High Throughput Suspension Cell and Bead Analysis Intellicyt ique Screener PLUS the fastest path to actionable results Whether
More informationSupplementary Information
Supplementary Information Sam68 modulates the promoter specificity of NF-κB and mediates expression of CD25 in activated T cells Kai Fu 1, 6, Xin Sun 1, 6, Wenxin Zheng 1, 6, Eric M. Wier 1, Andrea Hodgson
More informationCIGNAL REPORTER ASSAYS & ARRAYS
CIGNAL REPORTER ASSAYS & ARRAYS TM Cell-Based for Measuring Activity Cancer Cell Cycle Cytokines / Inflammation Neuroscience Stem Cell / Development Toxicology Focus on your CIGNAL TM REPORTER ASSAY SYSTEM
More informationDiscovery of a First-In-Class Topically Bioavailable Kit Inhibitor With Clinical Activity Using Computational Chemogenomics Technology
20131009-03 Discovery of a First-In-Class Topically Bioavailable Kit Inhibitor With Clinical Activity Using Computational Chemogenomics Technology James Hendrix, Ph.D. President - Technology Med Chem &
More informationUniversity of Pennsylvania Perelman School of Medicine High Throughput Screening Core
University of Pennsylvania Perelman School of Medicine High Throughput Screening Core Sara Cherry, Ph. D. David C. Schultz, Ph. D. dschultz@mail.med.upenn.edu (215) 573 9641 67 John Morgan Building Mission
More informationPhylogica Harnessing biodiversity for biologics discovery
Phylogica Harnessing biodiversity for biologics discovery AGM November 2010 Introductions to Speakers Dr Douglas Wilson - Executive Chairman Former Senior Vice-President, Medicine for Boehringer Ingelheim
More informationsherwood - UltramiR shrna Collections
sherwood - UltramiR shrna Collections Incorporating advances in shrna design and processing for superior potency and specificity sherwood - UltramiR shrna Collections Enabling Discovery Across the Genome
More informationFigure S1. Verification of ihog Mutation by Protein Immunoblotting Figure S2. Verification of ihog and boi
Figure S1. Verification of ihog Mutation by Protein Immunoblotting Extracts from S2R+ cells, embryos, and adults were analyzed by immunoprecipitation and immunoblotting with anti-ihog antibody. The Ihog
More informationRegulation of transcription by the MLL2 complex and MLL complex-associated AKAP95
Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:
More informationExperimental Techniques 2
Experimental Techniques 2 High-throughput interaction detection Yeast two-hybrid - pairwise organisms as machines to learn about organisms yeast, worm, fly, human,... low intersection between repeated
More informationIn Vitro Pharmacology Services
In Vitro Pharmacology Services Simplify Your Drug Discovery Workflow What s What s Inside: Inside: Why DiscoverX Services x GPCR Screening & Profiling x Kinase Screening & Profiling x Safety Screening
More informationDennis Wright, Ph.D. Professor of Medicinal Chemistry NPDD Initiative UCONN School of Pharmacy University of Connecticut
Craig M. Crews, Ph.D. Lewis B. Cullman Professor of Molecular, Cellular, and Developmental Biology Chemistry, Pharmacology Center for Molecular Discovery Yale University Dennis Wright, Ph.D. Professor
More informationImplementation of the Next Generation Effector Function Assays for Comparability Assessments
Implementation of the Next Generation Effector Function Assays for Comparability Assessments March 25, 2014 Poonam Aggarwal Bioassays 2014: Scientific Approaches & Regulatory Strategies to be held March
More informationCRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611
Data Sheet CRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611 Background The main role of the camp response element, or CRE, is mediating the effects of Protein Kinase A (PKA)
More informationEngineering the Medicines of Tomorrow The Path to Platinum: The Evolution of Human Combinatorial Antibody Libraries (HuCAL )
Engineering the Medicines of Tomorrow The Path to Platinum: The Evolution of Human Combinatorial Antibody Libraries (HuCAL ) Antibody Engineering December 2008, San Diego Dr. Stefanie Urlinger, Associate
More information7.012 Problem Set 5. Question 1
Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much
More informationThe Road to Functional Bioanalysis: Development and Validation of a Cell-Based Assay for Neutralizing Anti-Drug Antibody Analysis
The Road to Functional Bioanalysis: Development and Validation of a Cell-Based Assay for Neutralizing Anti-Drug Antibody Analysis Christelle Pythoud, PhD 2 nd EBF YSS, Barcelona Spain Celerion Switzerland
More informationStreamline Your Antibody Enrichment Using Scalable Magnetic Bead-Based Chemistries
Streamline Your Antibody Enrichment Using Scalable Magnetic Bead-Based Chemistries Samantha Lewis, Ph.D. 2013. Webinar Outline Introduction Magnetic Bead-Based Method Overview Scalability Chemistries o
More informationTITLE: Cell-penetrating Bispecific Antibodies for Targeting Oncogenic Transcription Factors in Advanced Prostate Cancer
AD Award Number: W81XWH-12-1-0534 TITLE: Cell-penetrating Bispecific Antibodies for Targeting Oncogenic Transcription Factors in Advanced Prostate Cancer PRINCIPAL INVESTIGATOR: Michael Lilly, MD, Principal
More informationUpstream mammalian cell processing challenges and prospects
BioProcess International Berlin, April 11-14, 2005 Upstream mammalian cell processing challenges and prospects John Birch Lonza Significance of Mammalian Cell Processes Commercial significance of biopharmaceutical
More information