PhoreMost Ltd. Phenotypic screening for novel druggable targets using Protein-interference

Size: px
Start display at page:

Download "PhoreMost Ltd. Phenotypic screening for novel druggable targets using Protein-interference"

Transcription

1 PhoreMost Ltd Phenotypic screening for novel druggable targets using Protein-interference

2 Company Snap-shot PhoreMost Ltd: New Biotech with a mission to drug key underlying causes of unmet diseases, the majority of which are intractable to current drug discovery technologies Ashok Venkitaraman MD, PhD, FMedSci Chris Torrance PhD Novel PROTEINi phenotypic screening platform to identify the best disease targets & how to drug them Building a pipeline of validated targets & drug discovery programs for out-licensing key pharma bottleneck Dir. MRC Cancer Unit, Cambridge University CSO of PhoreMost Founder Horizon Discovery CEO of PhoreMost Cancer focus initially; first program = novel drug target site addressing mutant KRAS cancers Also seeking collaborations on the Protein-i platform

3 The druggable genome, so far The human proteome: >100K (?) possible proteins (including splice variants) >300K (?) predicted high-confidence binary interactions Protein-protein interactions represent a vast untapped repertoire of potential targets Potential drug targets Drugged targets belong to just a few structural classes Only a tiny number of proteome targets has been drugged Eg., 1065 unique drugs (of 1357) target 324 known efficacy targets (of which 266 are human proteins) Overington et al. (2006) 68 targeted cancer therapies (July 2014) Kinases Glycosylated phosphoproteins Nuclear receptors Monoxygenases Growth factors Haemopoietic receptors GPCRs Cytokines Nimgaonkar & Venkitaraman (unpubl.)

4 Why is target-id/validation important? (Cancer e.g.,) Advances in genomics leading to deep genetic understanding of disease biology But few key disease drivers are directly druggable Those that are have largely been done, to good effect Defining novel drug sites (direct or indirect) is now a bottleneck & you can t guess! Not druggable Druggable

5 The underlying potential of phenotypic screens 1) Good targets are hidden in complex disease networks: Targets should be screened exhaustively to link them to a disease trait 2) Good drug sites are hidden in subtle and changing protein shapes in living cells: Targets should ideally be screened in with high-diversity probes that mimic biologic surfaces New solutions are required to uncover targets AND probe cryptic drug sites as they exist in nature

6 Complementary drug discovery approaches Target-based screening Phenotypic screening YES e.g., kinases with deep pockets + natural small ligands to mimic Streamlined drug discovery Validation critical Druggability essential Small list of candidates NO e.g., Protein/Protein interactions with large & discontinuous surface areas Swinney & Anthony NRDD 2011 Direct screening for desired outcome Good source of 1 st in class targets Small molecules>>diversity & target-id? RNAi/CRISPR>>>>>druggablilty? How can systematic target identification and validation be more closely linked to druggability?

7 Overview: PROTEINi phenotypic screening platform Genome-wide target-id & validation: GE Libraries e.g., CRISPR: High Target Specificity Off-targets weakly exploitable Drug sites not identified Size ~30,000 RNAi Libraries Low Target Specificity Off-targets confounding Drug sites not identified Size ~30,000 PROTEINi Libraries (diverse 3D protein-folds) High Target Specificity Off-targets co-exploitable Drug sites identified Size ~1,000,000,000 (dwarfs small mol. diversity)

8 PROTEINi : A live-cell system to find Tx-targets & how to drug them RNAi/CRISPR work indirectly to remove proteins. This is NOT what drugs do & druggable sites are NOT identified Does it usefully affect a disease? Does it spare normal cells Which patients will benefit most? PROTEINi directly inhibits target proteins with a high diversity libraries (10 9 ) of protein-fold shapes that systematically probe for cryptic druggable sites Phenotypic Screening (USP#2)

9 Genome-based 3D protein fold libraries Smaller or random in sequence Bigger e.g., Antibodies No 3D shape = No targets Derived from genomic coding sequences Goldilocks position for size (15-80aa), affinity, 3D potential & shape diversity Large footprint & very high affinity = Lots of targets No drugs Viable drugs But non-viable drugs

10 Harnessing protein-fold biodiversity (Phylomers) Collaboration with Avacta Affimers Collaboration with Medimmune scfvs Coding sequences fragments from 35 bacterial species Thermophillic/Extremophillic High propensity for self-folding subdomains Collaboration with Phylogica Ltd

11 3D bio-active protein folds for new target ID and drug discovery? Seeking the Goldilocks position from nature for high 3D-shape diversity and functionality to probe and then inform innovative low molecular weight NCE-discovery and design across the Site Diversity Site Affinity Site Size Phenotype! ( Pharmacophore ) living proteome

12 Allo-targeting Active site-directed small-molecule drugs competitively inhibit conserved catalytic sites Making it difficult to obtain selectivity, which can confound disease vs normal targeting High potency is also required to compete with natural ligands e.g., ATP in kinases Inhibitors only; principally against primary activity Allostery relies on non-competitive alteration of global 3 o /4 o protein structure Higher specificity & lower hurdles to modulation, especially for P/P interactions Allostery can be functionally effective in um range (c.f. nm for ATP-site directed inhibitors) Inhibitors or activators; primary or secondary activities

13 Historical hit rates for peptide libraries Phylomer hit rate data from Phylogica, unpublished

14 SITE SEEKER : Going rapidly from a target to valuable drug Value inflection point

15 SITE SEEKER : Mammalian cell functional screening PoC AP1 pathway downstream of KRAS Plasmid-based AP1 responsive luciferase construct Co-transfected into U2OS s with Phylomer plasmids 24hrs later PMA stimulated 4hrs later Luciferase read-out

16 SITE SEEKER : Primary AP1 screen data 3120 Phylomers screened well-by-well Pathway inducers and inhibitors obtained in the primary screen 25 pathway reducing hits; 14 repeat-tested positively High hit rate (1 in 200) for a peptide library 3D protein folds key

17 Hit validation data 14 confirmed hits reanalysed on AP1 FF-luc vs HSV TK Renilla-luc 6 hits show selective suppression of AP1 activity Other hits = general transcription inhibitors (>80% FF/Renilla ratio)

18 Hit validation data 3 hits retain activity on endogenous promoter 645nt promoter from sulfiredoxin1; with and without AP1 sites mutated No effect on Notch-ICD or FOXO-driven promoters

19 SITE SECURE : Target-ID

20 SITE SECURE : Target-ID Untransfected Empty vector Pyc36 6G8 25C3 48E6 3 hits taken into pull-downs V5-tagged Phylomers expressed in HEK293s Analysed by PAGE>Mass spec 25C3 (16aa) Phylomer hit: 4 clear bands on Coomassie 3 bands = same kinase Other band shares a common non-kinase domain

21 Target-confirmation Phenotype recapitulated by sirna to Kinase-A (orthogonal validation)

22 Allosteric binding-site confirmation NKD NKD Presumptive allosteric mechanism Tagged phylomer & Kinase-A non-kinase domain (NKD) expressed in U2OS cells IgG NKD IP d and immunoblotted NKD co-precipitates with Phylomer IgG

23 Allosteric binding-site confirmation Studied affinity of 25C3 binding to the Kinase-A non-kinase domain (NKD) Endogenous ligand Kd ~2x10-8 M by Biolayer Interferometry Endogenous ligand binds at Kd ~10-8 M Kinase NKD Phylomer Still determining whether it is a good target not progressing into chemistry yet NKD Substrate-P

24 PoC for drugging an allosteric site Targeting a known allosteric second site in a mitotic kinase Kinase-B previously drugged via ATP-site, but is non-selective w.r.t tumour vs normal cells Substrate-binding domain P/P interaction inhibitors with a narrower MoA may be better?

25 SITE BLOCK : Small molecule discovery Site-Block : Simple FP-based peptide displacement assay format Screened 120K small molecule library for hits Several hits bind an adjacent small druggable pocket

26 Novel KRAS Phenotype of allosteric kinase-b inhibitors In the LO stage; ~20nM on cells (+ve biomarkers) Allosteric-i has > KRAS synthetic lethality than ATPi

27 Novel resistance phenotype of allosteric kinase-b inhibitors ATP-site is easily mutated in cancers to abrogate drug binding Allosteric inhibitors are <<<< susceptible to resistance Allosteric ATPi Allosteric ATPi Many resistant colonies within 3-weeks for ATPi Small # of resistant colonies in 7-weeks with Allosteric-i Allosteric-i still works in ATPi resistant clones

28 SITE SEEKER : Moving to 10 9 shapes?

29 Emerging high-throughput PROTEINi formats Higher throughput pooled screens needed to access 10 9 library diversity Ideally covering multiple assay types; focussed >> holistic Good assay/selection methods will be key Nano BiT Protein:Protein Sensitive interaction reporters e.g., complementation Promega s NanoBiT Pathway: Turning Off signals into On signals In-house assay development Synthetic Lethal Viability drop-out screens NGS readout

30 Next-Gen sorting: Microfluidics 1) Single cells, each expressing a single protein-fold, added to individual picodroplets, and queued in a microfluidic biochip channel Picodroplets: i) FACS-like sorting rates ii) Multiple read-outs possible i) Luciferase or GFP ii) Mass-spec iii) Secreted protein detection iii) Enables high cell-viability 2) Luciferase reagent added sequentially to each individual picodroplet 3) Dark vs light cells sorted and collected for NGS determination of PROTEINi hits

31 Next-Gen sorting: Microfluidics 1) Single cells, each expressing a single protein-fold, added to individual picodroplets, and queued in a microfluidic biochip channel Picodroplets: i) FACS-like sorting rates ii) Multiple read-outs possible i) Luciferase or GFP ii) Mass-spec iii) Secreted protein detection iii) Enables high cell-viability 2) Luciferase reagent added sequentially to each individual picodroplet 3) Dark vs light cells sorted and collected for NGS determination of PROTEINi hits

32 Summary Core novel SiteSeeker Protein-interference platform to de-orphan undruggable targets/pathways Advantages over RNAi/CRISPR in assaying the proteome directly for cryptic druggable sites Early PoC stage: Good hit rates in small scale functional screens Commercial ops established to scale up screens & disease models seeking collaborations

How Targets Are Chosen. Chris Wayman 12 th April 2012

How Targets Are Chosen. Chris Wayman 12 th April 2012 How Targets Are Chosen Chris Wayman 12 th April 2012 A few questions How many ideas does it take to make a medicine? 10 20 20-50 50-100 A few questions How long does it take to bring a product from bench

More information

OriGene GFC-Arrays for High-throughput Overexpression Screening of Human Gene Phenotypes

OriGene GFC-Arrays for High-throughput Overexpression Screening of Human Gene Phenotypes OriGene GFC-Arrays for High-throughput Overexpression Screening of Human Gene Phenotypes High-throughput Gene Function Validation Tool Introduction sirna screening libraries enable scientists to identify

More information

Hitting the target in phenotypic drug discovery: Advances in receptor deconvolution

Hitting the target in phenotypic drug discovery: Advances in receptor deconvolution Hitting the target in phenotypic drug discovery: Advances in receptor deconvolution Jim Freeth, Retrogenix, UK Jim.Freeth@retrogenix.com ELRIG Research and Innovation Meeting March 11th 2014 The right

More information

Dharmacon TM solutions for studying gene function

Dharmacon TM solutions for studying gene function GE Healthcare Capabilities Overview Dharmacon TM solutions for studying gene function RNAi Gene Expression Gene Editing RNA Interference Our RNAi products encompass the most complete portfolio of innovative

More information

Advanced Therapeutic Antibody Discovery with Multiplexed Screening

Advanced Therapeutic Antibody Discovery with Multiplexed Screening Advanced Therapeutic Antibody Discovery with Multiplexed Screening White Paper Scientists need powerful tools that can deliver results to fully understand the ability of candidate antibodies to interrupt

More information

CRISPR GENOMIC SERVICES PRODUCT CATALOG

CRISPR GENOMIC SERVICES PRODUCT CATALOG CRISPR GENOMIC SERVICES PRODUCT CATALOG DESIGN BUILD ANALYZE The experts at Desktop Genetics can help you design, prepare and manufacture all of the components needed for your CRISPR screen. We provide

More information

TARGET VALIDATION. Maaike Everts, PhD (with slides from Dr. Suto)

TARGET VALIDATION. Maaike Everts, PhD (with slides from Dr. Suto) TARGET VALIDATION Maaike Everts, PhD (with slides from Dr. Suto) Drug Discovery & Development Source: http://dlab.cl/molecular-design/drug-discovery-phases/ How do you identify a target? Target: the naturally

More information

Recent Progress of Interprotein s Research Activities. Interprotein Corporation

Recent Progress of Interprotein s Research Activities. Interprotein Corporation Recent Progress of Interprotein s Research Activities - INTENDD and AI-guided INTENDD - Interprotein Corporation 1 Interprotein Corporation Location: Osaka, Japan Year Established: 2001 CEO & President:

More information

Accessing advanced TIDVAL technology at cost in return for sharing the up-side

Accessing advanced TIDVAL technology at cost in return for sharing the up-side HORIZON DISCOVERY Accessing advanced TIDVAL technology at cost in return for sharing the up-side On Helix, Cambridge UK, July 2015 Jon Moore CSO Disclaimer This Presentation does not constitute or form

More information

Use of a Label-Free Platform in a preclinical Contract Research Organization Environment

Use of a Label-Free Platform in a preclinical Contract Research Organization Environment Use of a Label-Free Platform in a preclinical Contract Research Organization Environment Scott Perschke Director, Assay Development Contents Introduction 2 Problem Statement 2 Previous Options 2 Solution

More information

Affinity Reagents: The Landscape and Affimer Technology Competitive Advantages

Affinity Reagents: The Landscape and Affimer Technology Competitive Advantages Affinity Reagents: The Landscape and Affimer Technology Competitive Advantages Introduction It is well accepted that the limitations of antibodies present valuable commercial opportunities for alternative

More information

Antibodies to Challenging Receptor Targets through NGS and Cell-Based Antibody Phage Panning. Mark Tornetta

Antibodies to Challenging Receptor Targets through NGS and Cell-Based Antibody Phage Panning. Mark Tornetta Antibodies to Challenging Receptor Targets through NGS and Cell-Based Antibody Phage Panning Mark Tornetta Points to convey regarding receptor targets Antigen diversity- cells and engineered ECDs Be creative

More information

Drug Targets - an overview of historical success and protein kinase inhibitors - successes and attrition. John P. Overington

Drug Targets - an overview of historical success and protein kinase inhibitors - successes and attrition. John P. Overington Drug Targets - an overview of historical success and protein kinase inhibitors - successes and attrition John P. Overington jpo@ebi.ac.uk Assay/Target ChEMBL The Organisation of Drug Discovery 1. Scientific

More information

FRAUNHOFER IME SCREENINGPORT

FRAUNHOFER IME SCREENINGPORT FRAUNHOFER IME SCREENINGPORT Detection technologies used in drug discovery Introduction Detection technologies in drug discovery is unlimited only a biased snapshot can be presented Differences can presented

More information

Targeting Proteins for Degradation: Characterizing PROTAC Kinetics and Mode of Action using Live-Cell Assays. Kristin M. Riching, Ph.

Targeting Proteins for Degradation: Characterizing PROTAC Kinetics and Mode of Action using Live-Cell Assays. Kristin M. Riching, Ph. Targeting Proteins for Degradation: Characterizing PROTAC Kinetics and Mode of Action using Live-Cell Assays Kristin M. Riching, Ph.D PROTACs: An Attractive Drug Discovery Strategy PROTACs, or Proteolysis

More information

CHAPTER 4. Milestones of the drug discovery

CHAPTER 4. Milestones of the drug discovery CHAPTER 4 Milestones of the drug discovery 4.Milestones of the drug discovery: Highlights the importance of the below critical milestones of the drug discovery and correlated to the current research. 1.

More information

Cellular Assays. A Strategic Market Analysis. Sample Slides

Cellular Assays. A Strategic Market Analysis. Sample Slides A Strategic Market Analysis Sample Slides 2002 For information contact: Frontline Strategic Consulting, Inc. 1065 E. Hillsdale Blvd, Suite 403, Foster City, CA 94404 650-525-1500 x125, x135 or x145 info@frontlinesmc.com

More information

Peptide libraries: applications, design options and considerations. Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST

Peptide libraries: applications, design options and considerations. Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST Peptide libraries: applications, design options and considerations Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST Overview 1 2 3 4 5 Introduction Peptide library basics Peptide library design considerations

More information

Monitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology. Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics

Monitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology. Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics Monitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics Proteomics and studying dynamic interactions AP-MS Proteomics

More information

Personalized CAR-T Immunotherapy Platform

Personalized CAR-T Immunotherapy Platform GLP, GMP, and CLIA-Certified Lab Personalized CAR-T Immunotherapy Platform Accelerate your cancer research and drug discovery Platform Overview 1500 Existing Hybridomas and Antibody Engineering Custom

More information

SureSilencing sirna Array Technology Overview

SureSilencing sirna Array Technology Overview SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference

More information

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11 Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the

More information

Scanning the protein surface to uncover new small molecule. binding sites using fragments. Gregg Siegal ZoBio

Scanning the protein surface to uncover new small molecule. binding sites using fragments. Gregg Siegal ZoBio Scanning the protein surface to uncover new small molecule binding sites using fragments Gregg Siegal ZoBio Increasing Interest in Alternative Small Molecule Binding Sites 1. Enhanced specificity 2. Adress

More information

Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme

Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the

More information

LARGE-SCALE PROTEIN INTERACTOMICS. Karl Frontzek Institute of Neuropathology

LARGE-SCALE PROTEIN INTERACTOMICS. Karl Frontzek Institute of Neuropathology LARGE-SCALE PROTEIN INTERACTOMICS Karl Frontzek Institute of Neuropathology STUDYING THE INTERACTOME A yeast 2 hybrid (DB: DNA binding domain, AD: activation domain) B tandem affinity purification (dashed

More information

Recent years have witnessed an expansion in the disciplines encompassing drug

Recent years have witnessed an expansion in the disciplines encompassing drug Course overview Recent years have witnessed an expansion in the disciplines encompassing drug discovery outside the pharmaceutical industry. This is most notable with a significant number of Universities

More information

Kinase Cell-Based Assays for Selectivity Assessment and Personalized Medicine

Kinase Cell-Based Assays for Selectivity Assessment and Personalized Medicine Kinase Cell-Based Assays for Selectivity Assessment and Personalized Medicine Deborah J. Moshinsky, PhD January 16, 13 Cell Assay Innovations, Inc. 1 Outline of Presentation Focus on Cellular Assays More

More information

TITLE: Genomewide Screen for Synthetic Lethal Interactions with Mutant KRAS in Lung Cancer

TITLE: Genomewide Screen for Synthetic Lethal Interactions with Mutant KRAS in Lung Cancer Award Number: W81XWH-16-1-0287 TITLE: Genomewide Screen for Synthetic Lethal Interactions with Mutant KRAS in Lung Cancer PRINCIPAL INVESTIGATOR: Yin-Yuan Mo CONTRACTING ORGANIZATION: University of Mississippi

More information

Propelling GPCR drug discovery through innovative products and services Be the change the market seeks

Propelling GPCR drug discovery through innovative products and services Be the change the market seeks Propelling GPCR drug discovery through innovative products and services Be the change the market seeks With the cost of bringing a new therapeutic agent to market now estimated at around $2 billion and

More information

Investigating Compound Mechanism of Action

Investigating Compound Mechanism of Action Investigating Compound Mechanism of Action Using Genetic Interaction Screens Lisa Marshall, Priya Mitty, Michael Ollmann, and Paul Kassner Michael Ollmann, Ph.D. Principal Scientist, Therapeutic Discovery

More information

The Two-Hybrid System

The Two-Hybrid System Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe

More information

How To Choose a GeneCopoeia Luciferase System. Ed Davis, Ph.D.

How To Choose a GeneCopoeia Luciferase System. Ed Davis, Ph.D. TECHNICAL NOTE How To Choose a GeneCopoeia Luciferase System Ed Davis, Ph.D. Introduction Luciferase reporter systems are invaluable tools for several applications, including regulation of gene expression

More information

Opportunities for Accelerating Cell Line Development and Beyond

Opportunities for Accelerating Cell Line Development and Beyond Opportunities for Accelerating Cell Line Development and Beyond European CM&C Strategy Forum May 24, 2017 Christopher Frye, Ph.D. Research Advisor & Group Leader Bioprocess R&D Presentation Outline CM&C

More information

Innovative Pharmaceutical Solutions for Discovery Chemistry, Biology and cgmp Manufacturing

Innovative Pharmaceutical Solutions for Discovery Chemistry, Biology and cgmp Manufacturing Innovative Pharmaceutical Solutions for Discovery Chemistry, Biology and cgmp Manufacturing Overview Serving biotech and pharma community since 1998 Proven track record of advancing small molecules from

More information

Cyto-Mine. The Single Cell Analysis and Monoclonality Assurance System

Cyto-Mine. The Single Cell Analysis and Monoclonality Assurance System Cyto-Mine The Single Cell Analysis and Monoclonality Assurance System Biopharmaceutical discovery and cell line development workflows streamlined like never before w w w. s p h e ref l u i d i c s. c o

More information

ProCode TM. Life Science, Inc. A Rapid Flexible MAb-Like Discovery Platform for Creating Diagnostic Antibodies.

ProCode TM. Life Science, Inc. A Rapid Flexible MAb-Like Discovery Platform for Creating Diagnostic Antibodies. ProCode TM A Rapid Flexible MAb-Like Discovery Platform for Creating Diagnostic Antibodies Life Science, Inc. www.meridianlifescience.com Custom Monoclonal Development Meridian Life Science, Inc. (MLS)

More information

Fragment-based screening of enzyme drug targets: Microfluidic mobility shift assay improves confidence in candidate selection

Fragment-based screening of enzyme drug targets: Microfluidic mobility shift assay improves confidence in candidate selection Fragment-based screening of enzyme drug targets: Microfluidic mobility shift assay improves confidence in candidate selection Introduction Fragment-based lead discovery is establishing itself as valuable

More information

Partnered Discovery of High-Quality Antibody Drug Candidates. Company Presentation

Partnered Discovery of High-Quality Antibody Drug Candidates. Company Presentation Partnered Discovery of High-Quality Antibody Drug Candidates Company Presentation AbCheck s Unique Offering A unique source of human antibodies with one of the industry's most versatile technology platforms

More information

HORIZON DISCOVERY Joint Venture between Horizon Discovery & Centauri Therapeutics

HORIZON DISCOVERY Joint Venture between Horizon Discovery & Centauri Therapeutics HORIZON DISCOVERY Joint Venture between Horizon Discovery & Centauri Therapeutics Briefing 2 nd March 2016 Exec Summary Horizon Discovery Group plc Enters Immuno-Oncology Therapeutic Development and Forms

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design. Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research

More information

The ChEMBL Database. ICIC 2012 Berlin, Germany October John P. Overington EMBL- EBI.

The ChEMBL Database. ICIC 2012 Berlin, Germany October John P. Overington EMBL- EBI. The ChEMBL Database ICIC 2012 Berlin, Germany October 2012 John P. Overington EMBL- EBI jpo@ebi.ac.uk Chemical Space All compounds Drug-like compounds Available compounds Only certain molecules have features

More information

ProteoGenix. Life Sciences Services and Products. From gene to biotherapeutics Target Validation to Lead optimisation

ProteoGenix. Life Sciences Services and Products. From gene to biotherapeutics Target Validation to Lead optimisation ProteoGenix Life Sciences Services and Products From gene to biotherapeutics Target Validation to Lead optimisation ProteoGenix Philippe FUNFROCK, founder and CEO French company located in Strasbourg,

More information

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the prey clones identified in the yeast two hybrid screen.

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

Supplementary Information

Supplementary Information Supplementary Information Peroxiredoxin-2 and STAT3 form a redox relay for H 2 O 2 signaling Mirko C. Sobotta 1, Willy Liou 1, Sarah Stöcker 1, Deepti Talwar 1, Michael Oehler 1, Thomas Ruppert 2, Annette

More information

27041, Week 02. Review of Week 01

27041, Week 02. Review of Week 01 27041, Week 02 Review of Week 01 The human genome sequencing project (HGP) 2 CBS, Department of Systems Biology Systems Biology and emergent properties 3 CBS, Department of Systems Biology Different model

More information

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and

Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary

More information

Non-coding Function & Variation, MPRAs II. Mike White Bio /5/18

Non-coding Function & Variation, MPRAs II. Mike White Bio /5/18 Non-coding Function & Variation, MPRAs II Mike White Bio 5488 3/5/18 MPRA Review Problem 1: Where does your CRE DNA come from? DNA synthesis Genomic fragments Targeted regulome capture Problem 2: How do

More information

CS262 Lecture 12 Notes Single Cell Sequencing Jan. 11, 2016

CS262 Lecture 12 Notes Single Cell Sequencing Jan. 11, 2016 CS262 Lecture 12 Notes Single Cell Sequencing Jan. 11, 2016 Background A typical human cell consists of ~6 billion base pairs of DNA and ~600 million bases of mrna. It is time-consuming and expensive to

More information

A new strategy for genetics & pharmacogenomics (GpGx) Robert M. Plenge, MD, PhD Vice President Head of Genetics & Pharmacogenomics

A new strategy for genetics & pharmacogenomics (GpGx) Robert M. Plenge, MD, PhD Vice President Head of Genetics & Pharmacogenomics A new strategy for genetics & pharmacogenomics (GpGx) Robert M. Plenge, MD, PhD Vice President Head of Genetics & Pharmacogenomics 1 Robert Plenge Our Shared Goals Impact the entire pipeline Drive early

More information

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology. G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic

More information

Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with

Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated

More information

The Confo body technology, a new platform to enable fragment screening on GPCRs

The Confo body technology, a new platform to enable fragment screening on GPCRs The Confo body technology, a new platform to enable fragment screening on GPCRs Christel Menet, PhD CSO Miptec, 216 Confo Therapeutics Incorporated in June 215 Located in Brussels, Belgium Confo Therapeutics

More information

Xpress CF+ : A Cell-Free Platform for the Rapid Screening and Production of Homogeneous ADCs

Xpress CF+ : A Cell-Free Platform for the Rapid Screening and Production of Homogeneous ADCs Xpress CF+ : A Cell-Free Platform for the Rapid Screening and Production of Homogeneous ADCs Alexander R. Steiner, M.S. Director, Protein Biochemistry Tuesday Feb 3 rd, 215 Making novel drugs is Pammolli

More information

Pharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001

Pharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 Pharmacogenetics: A SNPshot of the Future Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 1 I. What is pharmacogenetics? It is the study of how genetic variation affects drug response

More information

Accelerate Your Antibody Discovery and Cell Line Development Workflows with Cyto-Mine

Accelerate Your Antibody Discovery and Cell Line Development Workflows with Cyto-Mine Accelerate Your Antibody Discovery and Cell Line Development Workflows with Cyto-Mine Cyto-Mine The Single Cell Analysis Platform Cyto-Mine is the world s first fully integrated platform for high-throughput

More information

Data Sheet. Application Monitor glucocorticoid signaling pathway activity. Screen activators or inhibitors of the glucocorticoid signaling pathway.

Data Sheet. Application Monitor glucocorticoid signaling pathway activity. Screen activators or inhibitors of the glucocorticoid signaling pathway. Data Sheet GAL4 Reporter Kit (Glucocorticoid Receptor Pathway) Catalog #: w70533 Background The glucocorticoid signaling pathway plays an important role in development, fluid homeostasis, cognition, immune

More information

Engage with us on Twitter: #Molecule2Miracle

Engage with us on Twitter: #Molecule2Miracle Engage with us on Twitter: #Molecule2Miracle Kassy Perry President & CEO Perry Communications Group PhRMA Alliance Development Consultant.@kassyperry Emily Burke, Ph.D. Director of Curriculum BioTech

More information

Applications of HTRF and Tag-lite Assays for HTP Antibody Screening

Applications of HTRF and Tag-lite Assays for HTP Antibody Screening Applications of HTRF and Tag-lite Assays for HTP Antibody Screening Brigitte Devaux, PhD Bristol Myers Squibb, Redwood City CA HTRF Symposium April 25, 2013 1 Introduction Generate human therapeutic antibodies

More information

Course Agenda. Day One

Course Agenda. Day One Course Agenda BioImmersion: Biotech for the Non-Scientist A three-day, in-depth course that provides the background required for understanding today s fast-paced biotech marketplace. Beginning with an

More information

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). 1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well

More information

MicroRNAs and Genome Editing Two Evolving Protagonists in Medicine

MicroRNAs and Genome Editing Two Evolving Protagonists in Medicine MicroRNAs and Genome Editing Two Evolving Protagonists in Medicine Gerald W Dorn II, MD, FACC Needleman Professor and Associate Chair Department of Internal Medicine Washington University in St Louis The

More information

An Automated, Cell-based Platform for the Rapid Detection of Novel Androgen Receptor Modulators

An Automated, Cell-based Platform for the Rapid Detection of Novel Androgen Receptor Modulators A p p l i c a t i o n N o t e An Automated, Cell-based Platform for the Rapid Detection of Novel Androgen Receptor Modulators Brad Larson and Peter Banks, BioTek Instruments, Inc., Winooski, VT Bruce Sherf,

More information

How to Screen a Billion Drug Candidates?

How to Screen a Billion Drug Candidates? How to Screen a Billion Drug Candidates? Single Cell Functional Assays: Ultra-sensitive, Ultra-fast, Ultrahigh-throughput Next-Generation Drug Discovery The advantages of de novo protein engineering for

More information

Phylogica. Harnessing Biodiversity for Peptide Therapies. Life Sciences Showcase, 23 August 2011 Nick Woolf: CFO & VP Corporate Development

Phylogica. Harnessing Biodiversity for Peptide Therapies. Life Sciences Showcase, 23 August 2011 Nick Woolf: CFO & VP Corporate Development Phylogica Harnessing Biodiversity for Peptide Therapies Life Sciences Showcase, 23 August 2011 Nick Woolf: CFO & VP Corporate Development Introduction Biotech company offering leading peptide drug discovery

More information

transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,

transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1, Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected

More information

Future of Novel Drugs: DUBs Drug Discovery Platform LifeSensors Inc.

Future of Novel Drugs: DUBs Drug Discovery Platform LifeSensors Inc. Future of Novel Drugs: DUBs Drug Discovery Platform LifeSensors Inc. 271 Great Valley Parkway Malvern PA 19355 Phone: 610-644-8845 Fax: 610-644-8616 www.lifesensors.com LifeSensors Capabilities ~35 active

More information

Proteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125

Proteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125 Proteomics Manickam Sugumaran Department of Biology University of Massachusetts Boston, MA 02125 Genomic studies produced more than 75,000 potential gene sequence targets. (The number may be even higher

More information

Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm

Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Anja Smith Director R&D Dharmacon, part of GE Healthcare Imagination at work crrna:tracrrna program Cas9 nuclease Active crrna is

More information

Introduction to Assay Development

Introduction to Assay Development Introduction to Assay Development A poorly designed assay can derail a drug discovery program before it gets off the ground. While traditional bench-top assays are suitable for basic research and target

More information

A New Peptide Drug Modality; Helix-Loop-Helix Technology. Interprotein Corporation

A New Peptide Drug Modality; Helix-Loop-Helix Technology. Interprotein Corporation A New Peptide Drug Modality; Helix-Loop-Helix Technology Interprotein Corporation 1 Interprotein Corporation Location: Osaka, Japan Year Established: 2001 CEO & President: Masato Hosoda www.interprotein.com

More information

Fluorescent protein. Origin of fluorescent proteins. Structural and biophysical analysis of FPs. Application in molecular biology and biotechnology

Fluorescent protein. Origin of fluorescent proteins. Structural and biophysical analysis of FPs. Application in molecular biology and biotechnology Origin of fluorescent proteins types of FPs mechanism of fluorescence Fluorescent protein Structural and biophysical analysis of FPs Application in molecular biology and biotechnology Variety of organisms

More information

KREX World s only proteomics technology that produces full-length, correctly folded, functionally verified proteins

KREX World s only proteomics technology that produces full-length, correctly folded, functionally verified proteins THE functional proteomics company KREX World s only proteomics technology that produces full-length, correctly folded, functionally verified proteins SENGENICS IS A CAMBRIDGE UNIVERSITY SPIN-OFF COMPANY

More information

CHAPTERS 16 & 17: DNA Technology

CHAPTERS 16 & 17: DNA Technology CHAPTERS 16 & 17: DNA Technology 1. What is the function of restriction enzymes in bacteria? 2. How do bacteria protect their DNA from the effects of the restriction enzymes? 3. How do biologists make

More information

Custom Antibodies & Recombinant Proteins

Custom Antibodies & Recombinant Proteins Custom Antibodies & Recombinant Proteins INTRODUCTION Custom services to meet your research and development requirements Improvements in health, medicine and diagnostics over the past century can be largely

More information

supplementary information

supplementary information DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and

More information

Discovery on Target. Short Course Preview Deck

Discovery on Target. Short Course Preview Deck Discovery on Target Short Course Preview Deck Targeting of GPCRs with Monoclonal Antibodies Barbara Swanson, Ph.D. Sorrento Therapeutics, Inc. October 2014 GPCR Short Course Overview Introductions Brief

More information

Partnered Discovery of High-quality Antibody Drug Candidates COMPANY PRESENTATION DECEMBER 2016

Partnered Discovery of High-quality Antibody Drug Candidates COMPANY PRESENTATION DECEMBER 2016 Partnered Discovery of High-quality Antibody Drug Candidates COMPANY PRESENTATION DECEMBER 2016 Corporate Overview A unique source of therapeutic human antibodies with one of the industry's most versatile

More information

Conference Calendar. healthtech.com. January High-Content Analysis January 8-11 San Francisco, CA

Conference Calendar. healthtech.com. January High-Content Analysis January 8-11 San Francisco, CA High-Content Analysis January 8-11 San Francisco, CA www.highcontentanalysis.com January 2013 PepTalk January 21-25 Palm Springs, CA www.chi-peptalk.com January 24-25 Pipeline 1: Formulation: Optimizing

More information

High Throughput Suspension Cell and Bead Analysis. Intellicyt ique Screener PLUS

High Throughput Suspension Cell and Bead Analysis. Intellicyt ique Screener PLUS High Throughput Suspension Cell and Bead Analysis Intellicyt ique Screener PLUS High Throughput Suspension Cell and Bead Analysis Intellicyt ique Screener PLUS the fastest path to actionable results Whether

More information

Supplementary Information

Supplementary Information Supplementary Information Sam68 modulates the promoter specificity of NF-κB and mediates expression of CD25 in activated T cells Kai Fu 1, 6, Xin Sun 1, 6, Wenxin Zheng 1, 6, Eric M. Wier 1, Andrea Hodgson

More information

CIGNAL REPORTER ASSAYS & ARRAYS

CIGNAL REPORTER ASSAYS & ARRAYS CIGNAL REPORTER ASSAYS & ARRAYS TM Cell-Based for Measuring Activity Cancer Cell Cycle Cytokines / Inflammation Neuroscience Stem Cell / Development Toxicology Focus on your CIGNAL TM REPORTER ASSAY SYSTEM

More information

Discovery of a First-In-Class Topically Bioavailable Kit Inhibitor With Clinical Activity Using Computational Chemogenomics Technology

Discovery of a First-In-Class Topically Bioavailable Kit Inhibitor With Clinical Activity Using Computational Chemogenomics Technology 20131009-03 Discovery of a First-In-Class Topically Bioavailable Kit Inhibitor With Clinical Activity Using Computational Chemogenomics Technology James Hendrix, Ph.D. President - Technology Med Chem &

More information

University of Pennsylvania Perelman School of Medicine High Throughput Screening Core

University of Pennsylvania Perelman School of Medicine High Throughput Screening Core University of Pennsylvania Perelman School of Medicine High Throughput Screening Core Sara Cherry, Ph. D. David C. Schultz, Ph. D. dschultz@mail.med.upenn.edu (215) 573 9641 67 John Morgan Building Mission

More information

Phylogica Harnessing biodiversity for biologics discovery

Phylogica Harnessing biodiversity for biologics discovery Phylogica Harnessing biodiversity for biologics discovery AGM November 2010 Introductions to Speakers Dr Douglas Wilson - Executive Chairman Former Senior Vice-President, Medicine for Boehringer Ingelheim

More information

sherwood - UltramiR shrna Collections

sherwood - UltramiR shrna Collections sherwood - UltramiR shrna Collections Incorporating advances in shrna design and processing for superior potency and specificity sherwood - UltramiR shrna Collections Enabling Discovery Across the Genome

More information

Figure S1. Verification of ihog Mutation by Protein Immunoblotting Figure S2. Verification of ihog and boi

Figure S1. Verification of ihog Mutation by Protein Immunoblotting Figure S2. Verification of ihog and boi Figure S1. Verification of ihog Mutation by Protein Immunoblotting Extracts from S2R+ cells, embryos, and adults were analyzed by immunoprecipitation and immunoblotting with anti-ihog antibody. The Ihog

More information

Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95

Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95 Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:

More information

Experimental Techniques 2

Experimental Techniques 2 Experimental Techniques 2 High-throughput interaction detection Yeast two-hybrid - pairwise organisms as machines to learn about organisms yeast, worm, fly, human,... low intersection between repeated

More information

In Vitro Pharmacology Services

In Vitro Pharmacology Services In Vitro Pharmacology Services Simplify Your Drug Discovery Workflow What s What s Inside: Inside: Why DiscoverX Services x GPCR Screening & Profiling x Kinase Screening & Profiling x Safety Screening

More information

Dennis Wright, Ph.D. Professor of Medicinal Chemistry NPDD Initiative UCONN School of Pharmacy University of Connecticut

Dennis Wright, Ph.D. Professor of Medicinal Chemistry NPDD Initiative UCONN School of Pharmacy University of Connecticut Craig M. Crews, Ph.D. Lewis B. Cullman Professor of Molecular, Cellular, and Developmental Biology Chemistry, Pharmacology Center for Molecular Discovery Yale University Dennis Wright, Ph.D. Professor

More information

Implementation of the Next Generation Effector Function Assays for Comparability Assessments

Implementation of the Next Generation Effector Function Assays for Comparability Assessments Implementation of the Next Generation Effector Function Assays for Comparability Assessments March 25, 2014 Poonam Aggarwal Bioassays 2014: Scientific Approaches & Regulatory Strategies to be held March

More information

CRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611

CRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611 Data Sheet CRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611 Background The main role of the camp response element, or CRE, is mediating the effects of Protein Kinase A (PKA)

More information

Engineering the Medicines of Tomorrow The Path to Platinum: The Evolution of Human Combinatorial Antibody Libraries (HuCAL )

Engineering the Medicines of Tomorrow The Path to Platinum: The Evolution of Human Combinatorial Antibody Libraries (HuCAL ) Engineering the Medicines of Tomorrow The Path to Platinum: The Evolution of Human Combinatorial Antibody Libraries (HuCAL ) Antibody Engineering December 2008, San Diego Dr. Stefanie Urlinger, Associate

More information

7.012 Problem Set 5. Question 1

7.012 Problem Set 5. Question 1 Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much

More information

The Road to Functional Bioanalysis: Development and Validation of a Cell-Based Assay for Neutralizing Anti-Drug Antibody Analysis

The Road to Functional Bioanalysis: Development and Validation of a Cell-Based Assay for Neutralizing Anti-Drug Antibody Analysis The Road to Functional Bioanalysis: Development and Validation of a Cell-Based Assay for Neutralizing Anti-Drug Antibody Analysis Christelle Pythoud, PhD 2 nd EBF YSS, Barcelona Spain Celerion Switzerland

More information

Streamline Your Antibody Enrichment Using Scalable Magnetic Bead-Based Chemistries

Streamline Your Antibody Enrichment Using Scalable Magnetic Bead-Based Chemistries Streamline Your Antibody Enrichment Using Scalable Magnetic Bead-Based Chemistries Samantha Lewis, Ph.D. 2013. Webinar Outline Introduction Magnetic Bead-Based Method Overview Scalability Chemistries o

More information

TITLE: Cell-penetrating Bispecific Antibodies for Targeting Oncogenic Transcription Factors in Advanced Prostate Cancer

TITLE: Cell-penetrating Bispecific Antibodies for Targeting Oncogenic Transcription Factors in Advanced Prostate Cancer AD Award Number: W81XWH-12-1-0534 TITLE: Cell-penetrating Bispecific Antibodies for Targeting Oncogenic Transcription Factors in Advanced Prostate Cancer PRINCIPAL INVESTIGATOR: Michael Lilly, MD, Principal

More information

Upstream mammalian cell processing challenges and prospects

Upstream mammalian cell processing challenges and prospects BioProcess International Berlin, April 11-14, 2005 Upstream mammalian cell processing challenges and prospects John Birch Lonza Significance of Mammalian Cell Processes Commercial significance of biopharmaceutical

More information