MicroRNAs and Genome Editing Two Evolving Protagonists in Medicine

Size: px
Start display at page:

Download "MicroRNAs and Genome Editing Two Evolving Protagonists in Medicine"

Transcription

1 MicroRNAs and Genome Editing Two Evolving Protagonists in Medicine Gerald W Dorn II, MD, FACC Needleman Professor and Associate Chair Department of Internal Medicine Washington University in St Louis

2 The burden of proof lies on the person making the claim; there is no 3 rd party burden to disprove.

3 The simplest explanation is the best. William of Ockham (c ) We consider it a good principle to explain the phenomena by the simplest hypothesis possible Ptolemy (c )

4 Francis Crick: While Ockham's razor is a useful tool in the physical sciences, it can be a very dangerous implement in biology. It is thus very rash to use simplicity and elegance as a guide in biological research

5 Only ~2% of the human genome encodes protein coding genes (versus over 98% of a bacterial genome).

6 the Encyclopedia of DNA Elements (ENCODE), has found that 80% of the human genome serves some (generally regulatory) purpose, biochemically speaking. Science 337: , 2012 PLoS Biol 4:e

7 micrornas fine tune mrna stability and suppress protein translation micrornas transcription translation function AAAA Effect gene mrna protein microrna micrornas help define the initial conditions of critical cell pathways that are sequentially amplified, producing a systemic ripple effect that induces large and unanticipated phenotypes

8 The Butterfly Effect Sensitivity to initial conditions in complex systems: x 4 x (1 x) and y x + y if x + y < 1 (x + y 1 otherwise)

9 Circulation : The heart failure mrna signature is not reversed by left ventricular mechanical support, but the mir signature is. Cardiac mrna levels No LVAD LVAD Post-LVAD

10 microrna expression is disconnected from mrna levels Regulated by disease transcription translation function AAAA Effect gene mrna protein microrna Regulated by disease status

11 microrna effects are complex transcription translation function AAAA Effect gene mrna protein microrna kinase/ phosphatase P P transcription factor phosphoprotein

12 Does the flap of a butterfly's wings in Brazil set off a tornado in Texas? Edward Lorenz s presentation at the 139th Annual Meeting of the AAAS (1979) Lorenz EN. Deterministic Nonperiodic Flow. Journal of the Atmospheric Sciences 1963; 20:130 41

13 David Bartel: The (mir) responsive proteins are not necessarily the endogenous (mir) targets, and the magnitude and kinetics of mrna and protein changes are not expected to match those of endogenous targeting. Baek D, et al. The Impact of micrornas on Protein Output. Nature, 2008

14 Translational applications of micrornas Dysregulated in disease Disease markers actively secreted passively released Disease effectors direct effects indirect effects microrna Target disease processes direct effects indirect effects Unrelated Not regulated in disease

15 Anti-miRs as therapeutics

16 the Encyclopedia of DNA Elements (ENCODE), has found that 80% of the human genome serves some (generally regulatory) purpose, biochemically speaking. Science 337: , 2012 PLoS Biol 4:e

17 Transcription Splicing Environment lncrna Scaffolds Chaperones Decoys for proteinprotein interaction s directing proteins to RNA or DNA sequences binding and sequestering proteins, mirs

18 Making the cut CRISPR genome-editing technology shows its power.

19 Gene editing using CRISPR/Cas9

20 Potential applications for CRISPR: Gene drive bias trans-generational inheritance Malaria control Gene editing specifically altering DNA sequence Mutation correction, xenotransplantation Gene delivery modulate activity of a single gene Therapy and discovery

21 Translational applications of gene editing Models of genetic disease human ips cells mice, rats, pigs, etc Screen for gene-gene effects human ips cells Mutational Ds: loss of function correct gene mutation Mutational Ds: gain of function (poison peptide) silence mutant gene

22

23 Splicing mutant eliminates cardiac isoform resulting in ectopic expression of a cardiotoxic skeletal muscle enzyme. Heart (short) isoform STOP STOP Skeletal (long) isoform Heart (short) isoform

24 CRISPR to correct mutation (Fix it) microrna to suppress skeletal isoform (Suppress it) CRISPR to scramble mutant gene (Kill it) STOP STOP Skeletal (long) isoform Heart (short) isoform

25 Try multiple approaches to achieve the best outcome

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via

More information

Control of Eukaryotic Gene Expression (Learning Objectives)

Control of Eukaryotic Gene Expression (Learning Objectives) Control of Eukaryotic Gene Expression (Learning Objectives) 1. Compare and contrast chromatin and chromosome: composition, proteins involved and level of packing. Explain the structure and function of

More information

Chapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko

Chapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko Chapter 11 How Genes Are Controlled PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and

More information

DNA & Protein Synthesis. The source and the process!

DNA & Protein Synthesis. The source and the process! DNA & Protein Synthesis The source and the process! Agenda I. DNA and Genes II. Protein Synthesis III. The Genetic Code I. DNA & Genes: The beauty of DNA Remember: DNA is a macromolecule that stores information

More information

d. reading a DNA strand and making a complementary messenger RNA

d. reading a DNA strand and making a complementary messenger RNA Biol/ MBios 301 (General Genetics) Spring 2003 Second Midterm Examination A (100 points possible) Key April 1, 2003 10 Multiple Choice Questions-4 pts. each (Choose the best answer) 1. Transcription involves:

More information

Genome Engineering. Brian Petuch

Genome Engineering. Brian Petuch Genome Engineering Brian Petuch Guiding Principles An understanding of the details of gene engineering is essential for understanding protocols when making recommendations on: Risk assessment Containment

More information

Lecture 1. Basic Definitions and Nucleic Acids. Basic Definitions you should already know

Lecture 1. Basic Definitions and Nucleic Acids. Basic Definitions you should already know Lecture 1. Basic Definitions and Nucleic Acids Basic Definitions you should already know apple DNA: Deoxyribonucleic Acid apple RNA: Ribonucleic Acid apple mrna: messenger RNA: contains the genetic information(coding

More information

New Plant Breeding Technologies

New Plant Breeding Technologies New Plant Breeding Technologies Ricarda A. Steinbrecher, PhD EcoNexus / ENSSER Berlin, 07 May 2015 r.steinbrecher@econexus.info distributed by EuropaBio What are the NPBTs? *RNAi *Epigenetic alterations

More information

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

More information

How Targets Are Chosen. Chris Wayman 12 th April 2012

How Targets Are Chosen. Chris Wayman 12 th April 2012 How Targets Are Chosen Chris Wayman 12 th April 2012 A few questions How many ideas does it take to make a medicine? 10 20 20-50 50-100 A few questions How long does it take to bring a product from bench

More information

Quick Review of Protein Synthesis

Quick Review of Protein Synthesis Collin College BIOL. 2401 Quick Review of Protein Synthesis. Proteins and Protein Synthesis Proteins are the molecular units that do most of the work in a cell. They function as molecular catalysts, help

More information

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.

Synthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design. Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Bart Williams, PhD Van Andel Research Center

Bart Williams, PhD Van Andel Research Center A History of Genome Editing in the Laboratory Implications for Translational Applications Bart Williams, PhD Van Andel Research Center Introduction by Matthew Denenberg, MD DeVos Childrens Hospital Disclosures:

More information

OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells

OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna clone collections consist of lentiviral, and other mammalian expression vector based small hairpin RNA (shrna)

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

Chapter 1. from genomics to proteomics Ⅱ

Chapter 1. from genomics to proteomics Ⅱ Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more

More information

RNA Structure and the Versatility of RNA. Mitesh Shrestha

RNA Structure and the Versatility of RNA. Mitesh Shrestha RNA Structure and the Versatility of RNA Mitesh Shrestha Ribonucleic Acid (RNA) Nitrogenous Bases (Adenine, Uracil, Guanine, Cytosine) Ribose Sugar Ribonucleic Acid (RNA) Phosphate Group RNA world Hypothesis

More information

Course Agenda. Day One

Course Agenda. Day One Course Agenda BioImmersion: Biotech for the Non-Scientist A three-day, in-depth course that provides the background required for understanding today s fast-paced biotech marketplace. Beginning with an

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

RNA genes. Functional non-coding RNAs (ncrna) Jan 31 st 2018.

RNA genes. Functional non-coding RNAs (ncrna) Jan 31 st 2018. RNA genes Functional non-coding RNAs (ncrna) Jan 31 st 2018. After human genome sequencing it became obvious that human genome consists of many non-protein coding genes, genes that code for different RNAs

More information

Biochemistry. Central dogma. Structure and Function of Biomolecules II

Biochemistry. Central dogma. Structure and Function of Biomolecules II . Paper : 03 Module : 07 Principal Investigator: Dr. Sunil Kumar Khare, Professor Dept. of Chemistry, I.I.T. Delhi Paper Coordinator: Content Writer: Dr. Sunil Kumar Khare and Prof. M. N. Gupta Dr. Sunil

More information

Videos. Lesson Overview. Fermentation

Videos. Lesson Overview. Fermentation Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

RNA Interference and the World of Small RNAs

RNA Interference and the World of Small RNAs RNA Interference and the World of Small RNAs O, I die, Horatio; The potent poison quite o'er-crows my spirit: I cannot live to hear the news from England; But I do prophesy the election lights On Fortinbras:

More information

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS. !! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,

More information

Stalking the Genetic Basis of a Trait

Stalking the Genetic Basis of a Trait INTRODUCTION The short film Popped Secret: The Mysterious Origin of Corn describes how the evolution of corn was mostly a mystery until George Beadle proposed a bold new hypothesis in 1939: corn evolved

More information

MicroRNAs Sequencing, analysis and then what? Click to edit Master subtitle. Pamela Mukhopadhyay Winter School 5 th July 2016

MicroRNAs Sequencing, analysis and then what? Click to edit Master subtitle. Pamela Mukhopadhyay Winter School 5 th July 2016 MicroRNAs Sequencing, analysis and then what? Click to edit Master subtitle Pamela Mukhopadhyay Winter School 5 th July 2016 Presentation overview Introduction sequencing analysis Identifying targets biogenesis

More information

Applicazioni biotecnologiche

Applicazioni biotecnologiche Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence

More information

microrna Shifra Ben-Dor March 2010

microrna Shifra Ben-Dor March 2010 microrna Shifra Ben-Dor March 2010 Outline Biology of mirna Prediction of mirna mirna Databases Prediction of mirna Targets micrornas (mirna) Naturally expressed small RNAs Involved in regulation of target

More information

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write. Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After

More information

Videos. Bozeman Transcription and Translation: Drawing transcription and translation:

Videos. Bozeman Transcription and Translation:   Drawing transcription and translation: Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Transcriptomics. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona

Transcriptomics. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Transcriptomics Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Central dogma of molecular biology Central dogma of molecular biology Genome Complete DNA content of

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Unit 8: Genomics Guided Reading Questions (150 pts total)

Unit 8: Genomics Guided Reading Questions (150 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 18 The Genetics of Viruses and Bacteria Unit 8: Genomics Guided

More information

BIOL 205. Fall Term (2017)

BIOL 205. Fall Term (2017) 1 BIOL 205 Fall Term (2017) CALENDAR DESCRIPTION An introduction to Mendelian and Molecular Genetics covering the basic mechanisms of genetic transmission, gene structure and function, as well as the application

More information

From Gene to Protein. Lesson 3

From Gene to Protein. Lesson 3 From Gene to Protein Lesson 3 Gregor Mendel Mendel hypothesized that certain factors were responsible for the traits that were inherited by pea plants Today, these factors are known as genes A sequence

More information

Value Correct Answer Feedback. Student Response. A. Dicer enzyme. complex. C. the Dicer-RISC complex D. none of the above

Value Correct Answer Feedback. Student Response. A. Dicer enzyme. complex. C. the Dicer-RISC complex D. none of the above 1 RNA mediated interference is a post-transcriptional gene silencing mechanism Which component of the RNAi pathway have been implicated in cleavage of the target mrna? A Dicer enzyme B the RISC-siRNA complex

More information

Chapter 13 - Concept Mapping

Chapter 13 - Concept Mapping Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin

More information

Introduction to Algorithms in Computational Biology Lecture 1

Introduction to Algorithms in Computational Biology Lecture 1 Introduction to Algorithms in Computational Biology Lecture 1 Background Readings: The first three chapters (pages 1-31) in Genetics in Medicine, Nussbaum et al., 2001. This class has been edited from

More information

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide

More information

Image adapted from: National Human Genome Research Institute

Image adapted from: National Human Genome Research Institute Jargon buster Image 1: The structure of DNA A double helix with base pairing 1 Image adapted from: National Human Genome Research Institute Allele An allele is one of two or more versions of a gene. An

More information

Gene Regulation 10/19/05

Gene Regulation 10/19/05 10/19/05 Gene Regulation (formerly Gene Prediction - 2) Gene Prediction & Regulation Mon - Overview & Gene structure review: Eukaryotes vs prokaryotes Wed - Regulatory regions: Promoters & enhancers -

More information

Introduction to Genomic Medicine Exeter Expert Series: Cardiology

Introduction to Genomic Medicine Exeter Expert Series: Cardiology Introduction to Genomic Medicine Exeter Expert Series: Cardiology 2-3 November, 2017 Session I. Introductory concepts of genomics: gene, genome and variants Presented by Júlia Baptista PhD Clinical Scientist

More information

Data Mining for Biological Data Analysis

Data Mining for Biological Data Analysis Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han

More information

Introduction to Genome Biology

Introduction to Genome Biology Introduction to Genome Biology Sandrine Dudoit, Wolfgang Huber, Robert Gentleman Bioconductor Short Course 2006 Copyright 2006, all rights reserved Outline Cells, chromosomes, and cell division DNA structure

More information

Thyroid hormone transcriptome and cerebellum development.

Thyroid hormone transcriptome and cerebellum development. Thyroid hormone transcriptome and cerebellum development. 1) Developmental biology: General concepts 2) Genomic data: mouse and human genomes global view 3) A biological problem: mouse cerebellum and thyroid

More information

A primer on the structure and function of genes

A primer on the structure and function of genes A primer on the structure and function of genes What is the definition of a gene? GENE: the genetic element which is transmitted from parent to offspring during the process of reproduction that influences

More information

Wake Acceleration Academy - Biology Note Guide Unit 5: Molecular Genetics

Wake Acceleration Academy - Biology Note Guide Unit 5: Molecular Genetics Wake Acceleration Academy - Biology Note Guide Unit 5: Molecular Genetics Extra Resources Website: http://waa-science.weebly.com Module 1: Overview of DNA Vocabulary Term Definition (You may use an Internet

More information

Genomics and Proteomics *

Genomics and Proteomics * OpenStax-CNX module: m44558 1 Genomics and Proteomics * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will

More information

Chapter 13 - Regulation of Gene Expression

Chapter 13 - Regulation of Gene Expression Chapter 13 - Regulation of Gene Expression 1. Describe the typical components of an operon in an E. coli (prokaryotic) cell. (p. 238-239) a. regulator gene - b. promoter - c. operator - d. structural gene

More information

F 11/23 Happy Thanksgiving! 8 M 11/26 Gene identification in the genomic era Bamshad et al. Nature Reviews Genetics 12: , 2011

F 11/23 Happy Thanksgiving! 8 M 11/26 Gene identification in the genomic era Bamshad et al. Nature Reviews Genetics 12: , 2011 3 rd Edition 4 th Edition Lecture Day Date Topic Reading Problems Reading Problems 1 M 11/5 Complementation testing reveals that genes are distinct entities Ch. 7 224-232 2 W 11/7 One gene makes one protein

More information

CRISPR/Cas9 From Yoghurt to Designer Babies. Source: nextbigfuture.com

CRISPR/Cas9 From Yoghurt to Designer Babies. Source: nextbigfuture.com CRISPR/Cas9 From Yoghurt to Designer Babies Source: nextbigfuture.com OBJECTIVES 1. Relate the functioning of bacterial CRISPR/Cas systems to acquired immunity 2. Describe how CRISPR/Cas9 cuts DNA 3. Explain

More information

Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms

Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Duncanrig Secondary JHM&MHC 2015 Page 1 of 18 On completion of this

More information

CBA #4 Practice Exam Genetics. 1) (TEKS 5A) Which of the diagrams below shows the process of transcription:

CBA #4 Practice Exam Genetics. 1) (TEKS 5A) Which of the diagrams below shows the process of transcription: CBA #4 Practice Exam Genetics 1) (TEKS 5A) Which of the diagrams below shows the process of transcription: 2) (TEKS 5C) All of the following are true statements about cell differentiation EXCEPT A. Cell

More information

7.06 Cell Biology QUIZ #3

7.06 Cell Biology QUIZ #3 Recitation Section: 7.06 Cell Biology QUIZ #3 This is an open book exam, and you are allowed access to books and notes, but not computers or any other types of electronic devices. Please write your answers

More information

NCEA Level 2 Biology (91159) 2017 page 1 of 6. Achievement Achievement with Merit Achievement with Excellence

NCEA Level 2 Biology (91159) 2017 page 1 of 6. Achievement Achievement with Merit Achievement with Excellence NCEA Level 2 Biology (91159) 2017 page 1 of 6 Assessment Schedule 2017 Biology: Demonstrate understanding of gene expression (91159) Assessment Criteria with Merit with Excellence Demonstrate understanding

More information

College- and Career Readiness Standards for Science Genetics

College- and Career Readiness Standards for Science Genetics College- and Career Readiness Genetics Mississippi 2018 GEN.1 Structure and Function of DNA GEN.1A Students will demonstrate that all cells contain genetic material in the form of DNA. GEN.1A.1 Model the

More information

Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. A. Fire et al. (1998) Nature Vol 391:

Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. A. Fire et al. (1998) Nature Vol 391: Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans A. Fire et al. (1998) Nature Vol 391: 806-810 1 Outline 1. Introduction 2. Objective 3. Results 4. Mechanism 5.

More information

Chapter 17 From Gene to Protein

Chapter 17 From Gene to Protein Chapter 17 From Gene to Protein Question? How does DNA control a cell? By controlling Protein Synthesis. Proteins are the link between genotype and phenotype. For tests: Name(s) of experimenters Outline

More information

BACTERIAL GENETICS. How does the DNA in the bacterial cell replicate

BACTERIAL GENETICS. How does the DNA in the bacterial cell replicate BACTERIAL GENETICS Bacterial genetics is the study of gene structure and function in bacteria. Genetics itself is concerned with determining the number, location, and character of the genes of an organism.

More information

Regulation of enzyme synthesis

Regulation of enzyme synthesis Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example

More information

I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics

I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics Ch 12 Lecture Notes - DNA I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics 1 II. Griffith and Transformation

More information

Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?

Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist

More information

Chapter 2. An Introduction to Genes and Genomes

Chapter 2. An Introduction to Genes and Genomes PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents

More information

Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology

Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated

More information

Genetics Faculty of Agriculture and Veterinary Medicine. Instructor: Dr. Jihad Abdallah Topic 16: Biotechnology

Genetics Faculty of Agriculture and Veterinary Medicine. Instructor: Dr. Jihad Abdallah Topic 16: Biotechnology Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 16: Biotechnology 1 Biotechnology is defined as the technology that involves the use of living organisms

More information

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells

More information

Therapeutic & Prevention Application of Nucleic Acids

Therapeutic & Prevention Application of Nucleic Acids Therapeutic & Prevention Application of Nucleic Acids Seyed Amir Hossein Jalali Institute of Biotechnology and Bioengineering, Isfahan University Of Technology (IUT). 30.7.2015 * Plasmids * DNA Aptamers

More information

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA 21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule

More information

Prions Other molecules besides organelle DNA are inherited in non-mendelian patterns.

Prions Other molecules besides organelle DNA are inherited in non-mendelian patterns. Prions Other molecules besides organelle DNA are inherited in non-mendelian patterns. Examples of non-mendelian patterns of inheritance extend beyond the inheritance of organelle DNA. Certain DNA and RNA

More information

ksierzputowska.com Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster

ksierzputowska.com Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster Research plan: Specific aims: 1. To successfully engineer transgenic Drosophila expressing TALENs

More information

Name AP Biology Mrs. Laux Take home test #11 on Chapters 14, 15, and 17 DUE: MONDAY, DECEMBER 21, 2009

Name AP Biology Mrs. Laux Take home test #11 on Chapters 14, 15, and 17 DUE: MONDAY, DECEMBER 21, 2009 MULTIPLE CHOICE QUESTIONS 1. Inducible genes are usually actively transcribed when: A. the molecule degraded by the enzyme(s) is present in the cell. B. repressor molecules bind to the promoter. C. lactose

More information

Course Information. Introduction to Algorithms in Computational Biology Lecture 1. Relations to Some Other Courses

Course Information. Introduction to Algorithms in Computational Biology Lecture 1. Relations to Some Other Courses Course Information Introduction to Algorithms in Computational Biology Lecture 1 Meetings: Lecture, by Dan Geiger: Mondays 16:30 18:30, Taub 4. Tutorial, by Ydo Wexler: Tuesdays 10:30 11:30, Taub 2. Grade:

More information

Test Bank for Molecular Cell Biology 7th Edition by Lodish

Test Bank for Molecular Cell Biology 7th Edition by Lodish Test Bank for Molecular Cell Biology 7th Edition by Lodish Link download full: http://testbankair.com/download/test-bank-formolecular-cell-biology-7th-edition-by-lodish/ Chapter 5 Molecular Genetic Techniques

More information

Biomedical Sciences Graduate Program

Biomedical Sciences Graduate Program 1 of 6 Graduate School 250 University Hall 230 North Oval Mall Columbus, OH 43210-1366 January 11, 2013 Phone (614) 292-6031 Fax (614) 292-3656 Jeff Parvin, Joanna Groden Co-Graduate Studies Chairs Biomedical

More information

Ecological genomics and molecular adaptation: state of the Union and some research goals for the near future.

Ecological genomics and molecular adaptation: state of the Union and some research goals for the near future. Ecological genomics and molecular adaptation: state of the Union and some research goals for the near future. Louis Bernatchez Genomics and Conservation of Aquatic Resources Université LAVAL! Molecular

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy Proteogenomic Testing for Patients with Cancer (GPS Cancer Test) File Name: Origination: Last CAP Review: Next CAP Review: Last Review: proteogenomic_testing_for_patients_with_cancer_gps_cancer_test

More information

Personalized Human Genome Sequencing

Personalized Human Genome Sequencing Personalized Human Genome Sequencing Dr. Stefan Platz DABT, Global Head Drug Safety & Metabolism Biomedical research: strengths & limitations of non-animal alternatives 06 December 2016 The Human Genome

More information

9. What proteins will be affected by mutations in the trans-acting elements? Cis-acting elements?

9. What proteins will be affected by mutations in the trans-acting elements? Cis-acting elements? 6. What regulates the expression of a gene? 7. What are the cis- and trans-acting elements? 8. Can a deficiency in a trans-acting element be overcome by the addition of another copy of the gene to a cell?

More information

Bi 8 Lecture 18. Ellen Rothenberg 3 March Read: Alberts et al.: Chapter 6, pp , ,

Bi 8 Lecture 18. Ellen Rothenberg 3 March Read: Alberts et al.: Chapter 6, pp , , Bi 8 Lecture 18 Other RNAs as regulators and RNAs as enzymes Ellen Rothenberg 3 March 2016 Read: Alberts et al.: Chapter 6, pp. 317-324, 346-347, 362-366 RNA is more than a protein coding molecule RNA

More information

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication

More information

Lesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1

Lesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1 Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments

More information

A. I think it is DNA or RNA (circle your answer) because: B. I think it is DNA or RNA (circle your answer) because:

A. I think it is DNA or RNA (circle your answer) because: B. I think it is DNA or RNA (circle your answer) because: Name: Test Date: Block: Biology I: Unit 7 Molecular Genetics and Biotechnology Review for Unit Test Directions: You should use this as a guide to help you study for your test. You should also read through

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy Proteogenomic Testing for Patients with Cancer (GPS Cancer Test) File Name: Origination: Last CAP Review: Next CAP Review: Last Review: proteogenomic_testing_for_patients_with_cancer_gps_cancer_test

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy Proteogenomic Testing for Patients with Cancer (GPS Cancer Test) File Name: Origination: Last CAP Review: Next CAP Review: Last Review: proteogenomic_testing_for_patients_with_cancer_gps_cancer_test

More information

The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis

The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis For example, protein synthesis in human mitochondria relies on a genetic code that Leder and Nirenberg were able

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/

More information

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA. Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally

More information

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why? Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

April transmart v1.2 Case Study for PredicTox

April transmart v1.2 Case Study for PredicTox April 2015 transmart v1.2 Case Study for PredicTox Agenda Agenda! What is PredicTox?! Brief transmart overview! Answering scientific questions with transmart s help: A case study maximizing data value!

More information

Yesterday s Picture UNIT 3E

Yesterday s Picture UNIT 3E Warm-Up The data above represent the results of three different crosses involving the inheritance of a gene that determines whether a certain organism is blue or white. Which of the following best explains

More information

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize

More information

17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites

17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites 17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites 1 Section 17.5 Transcription regulatory proteins, transcription factors, target cis-acting sites

More information

M11/4/BIOLO/SPM/ENG/TZ2/XX BIOLOGY STANDARD LEVEL PAPER 1. Wednesday 18 May 2011 (afternoon) 45 minutes INSTRUCTIONS TO CANDIDATES

M11/4/BIOLO/SPM/ENG/TZ2/XX BIOLOGY STANDARD LEVEL PAPER 1. Wednesday 18 May 2011 (afternoon) 45 minutes INSTRUCTIONS TO CANDIDATES M11/4/BIOLO/SPM/ENG/TZ2/XX 22116016 BIOLOGY STANDARD LEVEL PAPER 1 Wednesday 18 May 2011 (afternoon) 45 minutes INSTRUCTIONS TO CANDIDATES Do not open this examination paper until instructed to do so.

More information

BIO 101 : The genetic code and the central dogma

BIO 101 : The genetic code and the central dogma BIO 101 : The genetic code and the central dogma NAME Objectives The purpose of this exploration is to... 1. design experiments to decipher the genetic code; 2. visualize the process of protein synthesis;

More information

Not all mutations result in a change to the amino acid sequence of the encoded polypeptide

Not all mutations result in a change to the amino acid sequence of the encoded polypeptide Q1.(a) (i) A mutation of a tumour suppressor gene can result in the formation of a tumour. Explain how. (2) (ii) Not all mutations result in a change to the amino acid sequence of the encoded polypeptide.

More information