MicroRNAs and Genome Editing Two Evolving Protagonists in Medicine
|
|
- Jewel Phillips
- 5 years ago
- Views:
Transcription
1 MicroRNAs and Genome Editing Two Evolving Protagonists in Medicine Gerald W Dorn II, MD, FACC Needleman Professor and Associate Chair Department of Internal Medicine Washington University in St Louis
2 The burden of proof lies on the person making the claim; there is no 3 rd party burden to disprove.
3 The simplest explanation is the best. William of Ockham (c ) We consider it a good principle to explain the phenomena by the simplest hypothesis possible Ptolemy (c )
4 Francis Crick: While Ockham's razor is a useful tool in the physical sciences, it can be a very dangerous implement in biology. It is thus very rash to use simplicity and elegance as a guide in biological research
5 Only ~2% of the human genome encodes protein coding genes (versus over 98% of a bacterial genome).
6 the Encyclopedia of DNA Elements (ENCODE), has found that 80% of the human genome serves some (generally regulatory) purpose, biochemically speaking. Science 337: , 2012 PLoS Biol 4:e
7 micrornas fine tune mrna stability and suppress protein translation micrornas transcription translation function AAAA Effect gene mrna protein microrna micrornas help define the initial conditions of critical cell pathways that are sequentially amplified, producing a systemic ripple effect that induces large and unanticipated phenotypes
8 The Butterfly Effect Sensitivity to initial conditions in complex systems: x 4 x (1 x) and y x + y if x + y < 1 (x + y 1 otherwise)
9 Circulation : The heart failure mrna signature is not reversed by left ventricular mechanical support, but the mir signature is. Cardiac mrna levels No LVAD LVAD Post-LVAD
10 microrna expression is disconnected from mrna levels Regulated by disease transcription translation function AAAA Effect gene mrna protein microrna Regulated by disease status
11 microrna effects are complex transcription translation function AAAA Effect gene mrna protein microrna kinase/ phosphatase P P transcription factor phosphoprotein
12 Does the flap of a butterfly's wings in Brazil set off a tornado in Texas? Edward Lorenz s presentation at the 139th Annual Meeting of the AAAS (1979) Lorenz EN. Deterministic Nonperiodic Flow. Journal of the Atmospheric Sciences 1963; 20:130 41
13 David Bartel: The (mir) responsive proteins are not necessarily the endogenous (mir) targets, and the magnitude and kinetics of mrna and protein changes are not expected to match those of endogenous targeting. Baek D, et al. The Impact of micrornas on Protein Output. Nature, 2008
14 Translational applications of micrornas Dysregulated in disease Disease markers actively secreted passively released Disease effectors direct effects indirect effects microrna Target disease processes direct effects indirect effects Unrelated Not regulated in disease
15 Anti-miRs as therapeutics
16 the Encyclopedia of DNA Elements (ENCODE), has found that 80% of the human genome serves some (generally regulatory) purpose, biochemically speaking. Science 337: , 2012 PLoS Biol 4:e
17 Transcription Splicing Environment lncrna Scaffolds Chaperones Decoys for proteinprotein interaction s directing proteins to RNA or DNA sequences binding and sequestering proteins, mirs
18 Making the cut CRISPR genome-editing technology shows its power.
19 Gene editing using CRISPR/Cas9
20 Potential applications for CRISPR: Gene drive bias trans-generational inheritance Malaria control Gene editing specifically altering DNA sequence Mutation correction, xenotransplantation Gene delivery modulate activity of a single gene Therapy and discovery
21 Translational applications of gene editing Models of genetic disease human ips cells mice, rats, pigs, etc Screen for gene-gene effects human ips cells Mutational Ds: loss of function correct gene mutation Mutational Ds: gain of function (poison peptide) silence mutant gene
22
23 Splicing mutant eliminates cardiac isoform resulting in ectopic expression of a cardiotoxic skeletal muscle enzyme. Heart (short) isoform STOP STOP Skeletal (long) isoform Heart (short) isoform
24 CRISPR to correct mutation (Fix it) microrna to suppress skeletal isoform (Suppress it) CRISPR to scramble mutant gene (Kill it) STOP STOP Skeletal (long) isoform Heart (short) isoform
25 Try multiple approaches to achieve the best outcome
The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work
Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via
More informationControl of Eukaryotic Gene Expression (Learning Objectives)
Control of Eukaryotic Gene Expression (Learning Objectives) 1. Compare and contrast chromatin and chromosome: composition, proteins involved and level of packing. Explain the structure and function of
More informationChapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko
Chapter 11 How Genes Are Controlled PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and
More informationDNA & Protein Synthesis. The source and the process!
DNA & Protein Synthesis The source and the process! Agenda I. DNA and Genes II. Protein Synthesis III. The Genetic Code I. DNA & Genes: The beauty of DNA Remember: DNA is a macromolecule that stores information
More informationd. reading a DNA strand and making a complementary messenger RNA
Biol/ MBios 301 (General Genetics) Spring 2003 Second Midterm Examination A (100 points possible) Key April 1, 2003 10 Multiple Choice Questions-4 pts. each (Choose the best answer) 1. Transcription involves:
More informationGenome Engineering. Brian Petuch
Genome Engineering Brian Petuch Guiding Principles An understanding of the details of gene engineering is essential for understanding protocols when making recommendations on: Risk assessment Containment
More informationLecture 1. Basic Definitions and Nucleic Acids. Basic Definitions you should already know
Lecture 1. Basic Definitions and Nucleic Acids Basic Definitions you should already know apple DNA: Deoxyribonucleic Acid apple RNA: Ribonucleic Acid apple mrna: messenger RNA: contains the genetic information(coding
More informationNew Plant Breeding Technologies
New Plant Breeding Technologies Ricarda A. Steinbrecher, PhD EcoNexus / ENSSER Berlin, 07 May 2015 r.steinbrecher@econexus.info distributed by EuropaBio What are the NPBTs? *RNAi *Epigenetic alterations
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More informationHow Targets Are Chosen. Chris Wayman 12 th April 2012
How Targets Are Chosen Chris Wayman 12 th April 2012 A few questions How many ideas does it take to make a medicine? 10 20 20-50 50-100 A few questions How long does it take to bring a product from bench
More informationQuick Review of Protein Synthesis
Collin College BIOL. 2401 Quick Review of Protein Synthesis. Proteins and Protein Synthesis Proteins are the molecular units that do most of the work in a cell. They function as molecular catalysts, help
More informationSynthetic Biology. Sustainable Energy. Therapeutics Industrial Enzymes. Agriculture. Accelerating Discoveries, Expanding Possibilities. Design.
Synthetic Biology Accelerating Discoveries, Expanding Possibilities Sustainable Energy Therapeutics Industrial Enzymes Agriculture Design Build Generate Solutions to Advance Synthetic Biology Research
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationBart Williams, PhD Van Andel Research Center
A History of Genome Editing in the Laboratory Implications for Translational Applications Bart Williams, PhD Van Andel Research Center Introduction by Matthew Denenberg, MD DeVos Childrens Hospital Disclosures:
More informationOmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells
OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna clone collections consist of lentiviral, and other mammalian expression vector based small hairpin RNA (shrna)
More informationBiology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationRNA Structure and the Versatility of RNA. Mitesh Shrestha
RNA Structure and the Versatility of RNA Mitesh Shrestha Ribonucleic Acid (RNA) Nitrogenous Bases (Adenine, Uracil, Guanine, Cytosine) Ribose Sugar Ribonucleic Acid (RNA) Phosphate Group RNA world Hypothesis
More informationCourse Agenda. Day One
Course Agenda BioImmersion: Biotech for the Non-Scientist A three-day, in-depth course that provides the background required for understanding today s fast-paced biotech marketplace. Beginning with an
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationRNA genes. Functional non-coding RNAs (ncrna) Jan 31 st 2018.
RNA genes Functional non-coding RNAs (ncrna) Jan 31 st 2018. After human genome sequencing it became obvious that human genome consists of many non-protein coding genes, genes that code for different RNAs
More informationBiochemistry. Central dogma. Structure and Function of Biomolecules II
. Paper : 03 Module : 07 Principal Investigator: Dr. Sunil Kumar Khare, Professor Dept. of Chemistry, I.I.T. Delhi Paper Coordinator: Content Writer: Dr. Sunil Kumar Khare and Prof. M. N. Gupta Dr. Sunil
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationEnzyme that uses RNA as a template to synthesize a complementary DNA
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have
More informationRNA Interference and the World of Small RNAs
RNA Interference and the World of Small RNAs O, I die, Horatio; The potent poison quite o'er-crows my spirit: I cannot live to hear the news from England; But I do prophesy the election lights On Fortinbras:
More informationGENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
More informationStalking the Genetic Basis of a Trait
INTRODUCTION The short film Popped Secret: The Mysterious Origin of Corn describes how the evolution of corn was mostly a mystery until George Beadle proposed a bold new hypothesis in 1939: corn evolved
More informationMicroRNAs Sequencing, analysis and then what? Click to edit Master subtitle. Pamela Mukhopadhyay Winter School 5 th July 2016
MicroRNAs Sequencing, analysis and then what? Click to edit Master subtitle Pamela Mukhopadhyay Winter School 5 th July 2016 Presentation overview Introduction sequencing analysis Identifying targets biogenesis
More informationApplicazioni biotecnologiche
Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence
More informationmicrorna Shifra Ben-Dor March 2010
microrna Shifra Ben-Dor March 2010 Outline Biology of mirna Prediction of mirna mirna Databases Prediction of mirna Targets micrornas (mirna) Naturally expressed small RNAs Involved in regulation of target
More informationBiology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.
Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationThe Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationTranscriptomics. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona
Transcriptomics Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Central dogma of molecular biology Central dogma of molecular biology Genome Complete DNA content of
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationUnit 8: Genomics Guided Reading Questions (150 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 18 The Genetics of Viruses and Bacteria Unit 8: Genomics Guided
More informationBIOL 205. Fall Term (2017)
1 BIOL 205 Fall Term (2017) CALENDAR DESCRIPTION An introduction to Mendelian and Molecular Genetics covering the basic mechanisms of genetic transmission, gene structure and function, as well as the application
More informationFrom Gene to Protein. Lesson 3
From Gene to Protein Lesson 3 Gregor Mendel Mendel hypothesized that certain factors were responsible for the traits that were inherited by pea plants Today, these factors are known as genes A sequence
More informationValue Correct Answer Feedback. Student Response. A. Dicer enzyme. complex. C. the Dicer-RISC complex D. none of the above
1 RNA mediated interference is a post-transcriptional gene silencing mechanism Which component of the RNAi pathway have been implicated in cleavage of the target mrna? A Dicer enzyme B the RISC-siRNA complex
More informationChapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
More informationIntroduction to Algorithms in Computational Biology Lecture 1
Introduction to Algorithms in Computational Biology Lecture 1 Background Readings: The first three chapters (pages 1-31) in Genetics in Medicine, Nussbaum et al., 2001. This class has been edited from
More informationBIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide
More informationImage adapted from: National Human Genome Research Institute
Jargon buster Image 1: The structure of DNA A double helix with base pairing 1 Image adapted from: National Human Genome Research Institute Allele An allele is one of two or more versions of a gene. An
More informationGene Regulation 10/19/05
10/19/05 Gene Regulation (formerly Gene Prediction - 2) Gene Prediction & Regulation Mon - Overview & Gene structure review: Eukaryotes vs prokaryotes Wed - Regulatory regions: Promoters & enhancers -
More informationIntroduction to Genomic Medicine Exeter Expert Series: Cardiology
Introduction to Genomic Medicine Exeter Expert Series: Cardiology 2-3 November, 2017 Session I. Introductory concepts of genomics: gene, genome and variants Presented by Júlia Baptista PhD Clinical Scientist
More informationData Mining for Biological Data Analysis
Data Mining for Biological Data Analysis Data Mining and Text Mining (UIC 583 @ Politecnico di Milano) References Data Mining Course by Gregory-Platesky Shapiro available at www.kdnuggets.com Jiawei Han
More informationIntroduction to Genome Biology
Introduction to Genome Biology Sandrine Dudoit, Wolfgang Huber, Robert Gentleman Bioconductor Short Course 2006 Copyright 2006, all rights reserved Outline Cells, chromosomes, and cell division DNA structure
More informationThyroid hormone transcriptome and cerebellum development.
Thyroid hormone transcriptome and cerebellum development. 1) Developmental biology: General concepts 2) Genomic data: mouse and human genomes global view 3) A biological problem: mouse cerebellum and thyroid
More informationA primer on the structure and function of genes
A primer on the structure and function of genes What is the definition of a gene? GENE: the genetic element which is transmitted from parent to offspring during the process of reproduction that influences
More informationWake Acceleration Academy - Biology Note Guide Unit 5: Molecular Genetics
Wake Acceleration Academy - Biology Note Guide Unit 5: Molecular Genetics Extra Resources Website: http://waa-science.weebly.com Module 1: Overview of DNA Vocabulary Term Definition (You may use an Internet
More informationGenomics and Proteomics *
OpenStax-CNX module: m44558 1 Genomics and Proteomics * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will
More informationChapter 13 - Regulation of Gene Expression
Chapter 13 - Regulation of Gene Expression 1. Describe the typical components of an operon in an E. coli (prokaryotic) cell. (p. 238-239) a. regulator gene - b. promoter - c. operator - d. structural gene
More informationF 11/23 Happy Thanksgiving! 8 M 11/26 Gene identification in the genomic era Bamshad et al. Nature Reviews Genetics 12: , 2011
3 rd Edition 4 th Edition Lecture Day Date Topic Reading Problems Reading Problems 1 M 11/5 Complementation testing reveals that genes are distinct entities Ch. 7 224-232 2 W 11/7 One gene makes one protein
More informationCRISPR/Cas9 From Yoghurt to Designer Babies. Source: nextbigfuture.com
CRISPR/Cas9 From Yoghurt to Designer Babies Source: nextbigfuture.com OBJECTIVES 1. Relate the functioning of bacterial CRISPR/Cas systems to acquired immunity 2. Describe how CRISPR/Cas9 cuts DNA 3. Explain
More informationUnit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms
Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Duncanrig Secondary JHM&MHC 2015 Page 1 of 18 On completion of this
More informationCBA #4 Practice Exam Genetics. 1) (TEKS 5A) Which of the diagrams below shows the process of transcription:
CBA #4 Practice Exam Genetics 1) (TEKS 5A) Which of the diagrams below shows the process of transcription: 2) (TEKS 5C) All of the following are true statements about cell differentiation EXCEPT A. Cell
More information7.06 Cell Biology QUIZ #3
Recitation Section: 7.06 Cell Biology QUIZ #3 This is an open book exam, and you are allowed access to books and notes, but not computers or any other types of electronic devices. Please write your answers
More informationNCEA Level 2 Biology (91159) 2017 page 1 of 6. Achievement Achievement with Merit Achievement with Excellence
NCEA Level 2 Biology (91159) 2017 page 1 of 6 Assessment Schedule 2017 Biology: Demonstrate understanding of gene expression (91159) Assessment Criteria with Merit with Excellence Demonstrate understanding
More informationCollege- and Career Readiness Standards for Science Genetics
College- and Career Readiness Genetics Mississippi 2018 GEN.1 Structure and Function of DNA GEN.1A Students will demonstrate that all cells contain genetic material in the form of DNA. GEN.1A.1 Model the
More informationPotent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. A. Fire et al. (1998) Nature Vol 391:
Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans A. Fire et al. (1998) Nature Vol 391: 806-810 1 Outline 1. Introduction 2. Objective 3. Results 4. Mechanism 5.
More informationChapter 17 From Gene to Protein
Chapter 17 From Gene to Protein Question? How does DNA control a cell? By controlling Protein Synthesis. Proteins are the link between genotype and phenotype. For tests: Name(s) of experimenters Outline
More informationBACTERIAL GENETICS. How does the DNA in the bacterial cell replicate
BACTERIAL GENETICS Bacterial genetics is the study of gene structure and function in bacteria. Genetics itself is concerned with determining the number, location, and character of the genes of an organism.
More informationRegulation of enzyme synthesis
Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example
More informationI. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics
Ch 12 Lecture Notes - DNA I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics 1 II. Griffith and Transformation
More informationSection 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?
Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist
More informationChapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
More informationUnit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology
Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated
More informationGenetics Faculty of Agriculture and Veterinary Medicine. Instructor: Dr. Jihad Abdallah Topic 16: Biotechnology
Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 16: Biotechnology 1 Biotechnology is defined as the technology that involves the use of living organisms
More informationDNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base
DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells
More informationTherapeutic & Prevention Application of Nucleic Acids
Therapeutic & Prevention Application of Nucleic Acids Seyed Amir Hossein Jalali Institute of Biotechnology and Bioengineering, Isfahan University Of Technology (IUT). 30.7.2015 * Plasmids * DNA Aptamers
More informationDNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA
21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule
More informationPrions Other molecules besides organelle DNA are inherited in non-mendelian patterns.
Prions Other molecules besides organelle DNA are inherited in non-mendelian patterns. Examples of non-mendelian patterns of inheritance extend beyond the inheritance of organelle DNA. Certain DNA and RNA
More informationksierzputowska.com Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster
Research Title: Using novel TALEN technology to engineer precise mutations in the genome of D. melanogaster Research plan: Specific aims: 1. To successfully engineer transgenic Drosophila expressing TALENs
More informationName AP Biology Mrs. Laux Take home test #11 on Chapters 14, 15, and 17 DUE: MONDAY, DECEMBER 21, 2009
MULTIPLE CHOICE QUESTIONS 1. Inducible genes are usually actively transcribed when: A. the molecule degraded by the enzyme(s) is present in the cell. B. repressor molecules bind to the promoter. C. lactose
More informationCourse Information. Introduction to Algorithms in Computational Biology Lecture 1. Relations to Some Other Courses
Course Information Introduction to Algorithms in Computational Biology Lecture 1 Meetings: Lecture, by Dan Geiger: Mondays 16:30 18:30, Taub 4. Tutorial, by Ydo Wexler: Tuesdays 10:30 11:30, Taub 2. Grade:
More informationTest Bank for Molecular Cell Biology 7th Edition by Lodish
Test Bank for Molecular Cell Biology 7th Edition by Lodish Link download full: http://testbankair.com/download/test-bank-formolecular-cell-biology-7th-edition-by-lodish/ Chapter 5 Molecular Genetic Techniques
More informationBiomedical Sciences Graduate Program
1 of 6 Graduate School 250 University Hall 230 North Oval Mall Columbus, OH 43210-1366 January 11, 2013 Phone (614) 292-6031 Fax (614) 292-3656 Jeff Parvin, Joanna Groden Co-Graduate Studies Chairs Biomedical
More informationEcological genomics and molecular adaptation: state of the Union and some research goals for the near future.
Ecological genomics and molecular adaptation: state of the Union and some research goals for the near future. Louis Bernatchez Genomics and Conservation of Aquatic Resources Université LAVAL! Molecular
More informationCorporate Medical Policy
Corporate Medical Policy Proteogenomic Testing for Patients with Cancer (GPS Cancer Test) File Name: Origination: Last CAP Review: Next CAP Review: Last Review: proteogenomic_testing_for_patients_with_cancer_gps_cancer_test
More informationPersonalized Human Genome Sequencing
Personalized Human Genome Sequencing Dr. Stefan Platz DABT, Global Head Drug Safety & Metabolism Biomedical research: strengths & limitations of non-animal alternatives 06 December 2016 The Human Genome
More information9. What proteins will be affected by mutations in the trans-acting elements? Cis-acting elements?
6. What regulates the expression of a gene? 7. What are the cis- and trans-acting elements? 8. Can a deficiency in a trans-acting element be overcome by the addition of another copy of the gene to a cell?
More informationBi 8 Lecture 18. Ellen Rothenberg 3 March Read: Alberts et al.: Chapter 6, pp , ,
Bi 8 Lecture 18 Other RNAs as regulators and RNAs as enzymes Ellen Rothenberg 3 March 2016 Read: Alberts et al.: Chapter 6, pp. 317-324, 346-347, 362-366 RNA is more than a protein coding molecule RNA
More informationM I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More informationLesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1
Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments
More informationA. I think it is DNA or RNA (circle your answer) because: B. I think it is DNA or RNA (circle your answer) because:
Name: Test Date: Block: Biology I: Unit 7 Molecular Genetics and Biotechnology Review for Unit Test Directions: You should use this as a guide to help you study for your test. You should also read through
More informationCorporate Medical Policy
Corporate Medical Policy Proteogenomic Testing for Patients with Cancer (GPS Cancer Test) File Name: Origination: Last CAP Review: Next CAP Review: Last Review: proteogenomic_testing_for_patients_with_cancer_gps_cancer_test
More informationCorporate Medical Policy
Corporate Medical Policy Proteogenomic Testing for Patients with Cancer (GPS Cancer Test) File Name: Origination: Last CAP Review: Next CAP Review: Last Review: proteogenomic_testing_for_patients_with_cancer_gps_cancer_test
More informationThe Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis
The Major Function Of Rna Is To Carry Out The Genetic Instructions For Protein Synthesis For example, protein synthesis in human mitochondria relies on a genetic code that Leder and Nirenberg were able
More informationIntroduction to BIOINFORMATICS
COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationChapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?
Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationApril transmart v1.2 Case Study for PredicTox
April 2015 transmart v1.2 Case Study for PredicTox Agenda Agenda! What is PredicTox?! Brief transmart overview! Answering scientific questions with transmart s help: A case study maximizing data value!
More informationYesterday s Picture UNIT 3E
Warm-Up The data above represent the results of three different crosses involving the inheritance of a gene that determines whether a certain organism is blue or white. Which of the following best explains
More informationUnit IX Problem 3 Genetics: Basic Concepts in Molecular Biology
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize
More information17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites
17.5 Eukaryotic Transcription Initiation Is Regulated by Transcription Factors That Bind to Cis-Acting Sites 1 Section 17.5 Transcription regulatory proteins, transcription factors, target cis-acting sites
More informationM11/4/BIOLO/SPM/ENG/TZ2/XX BIOLOGY STANDARD LEVEL PAPER 1. Wednesday 18 May 2011 (afternoon) 45 minutes INSTRUCTIONS TO CANDIDATES
M11/4/BIOLO/SPM/ENG/TZ2/XX 22116016 BIOLOGY STANDARD LEVEL PAPER 1 Wednesday 18 May 2011 (afternoon) 45 minutes INSTRUCTIONS TO CANDIDATES Do not open this examination paper until instructed to do so.
More informationBIO 101 : The genetic code and the central dogma
BIO 101 : The genetic code and the central dogma NAME Objectives The purpose of this exploration is to... 1. design experiments to decipher the genetic code; 2. visualize the process of protein synthesis;
More informationNot all mutations result in a change to the amino acid sequence of the encoded polypeptide
Q1.(a) (i) A mutation of a tumour suppressor gene can result in the formation of a tumour. Explain how. (2) (ii) Not all mutations result in a change to the amino acid sequence of the encoded polypeptide.
More information