FRAUNHOFER IME SCREENINGPORT

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "FRAUNHOFER IME SCREENINGPORT"

Transcription

1 FRAUNHOFER IME SCREENINGPORT Detection technologies used in drug discovery

2 Introduction Detection technologies in drug discovery is unlimited only a biased snapshot can be presented Differences can presented based on high- vs. low-throughput, labeled vs. label-free, cell-based vs. cell-free, target centered vs. high content Classical detection technologies in high throughput screening include TR-FRET, Alpha-Screen, Luminescence, Fluorescence, Imaging Interesting assays are needed for target deconvolution

3 TR-FRET and AlphaScreen Biotinylated D2 conjugated to streptavidin Excitation at 680nm AlphaScreen Nickel donor bead Protein I FRET at 615nm Emission at 665nm 1 O 2 Eu-labeled Protein II Fc-chimera of Protein II AlphaScreen Protein A acceptor bead Excitation at 320nm Emission at 620nm Both assay systems require labeling Will be presented in a case study, too

4 Evolution of Luciferases Luciferases were used as reporters in reportergene assays or in assays wich are connected to ATP concentrations (Kinases, viability)

5 Example of imageing and image analysis Nuclei channel Nuclei Class A Nuclei Class B There are no limits, but dedicated software is needed

6 Methods For Analysis of Protein Protein Interactions Method Quantitative Pulldown Mass spec Real time Live cell Localisation Multiplex HTS No No No Limited No Limited Yes Yes Limited No No Yes No No No Yes Limited Limited SILAC SPR Yes No No No Yes Limited PCA (protein complementation) Calorimetry Fluorescence Correlation Spectroscopy No No No No Yes No Yes Yes Limited No No No FRET Yes Yes Yes No No Limited TR-FRET Yes No No No No Yes BRET Yes Yes Limited No No Yes

7 How does BRET work? BRET is like FRET, but with an internal light source The energy transfer is radiation-free (quantum effect, similar to FRET)

8 NanoBRET from Promega Previous BRET efficiency Only the newly developed BRET system by Promega allows good sensitivity and a high dynamic range

9 Validity of the BRET assay system Sensitivity and dynamic range are good These are mandatory controls which should be checked for every similar assay system

10 Scheme of constructs which have to be cloned It is essential to try all the possible combinations (8 constructs needed) Tagging could easily interfere with the function or the localisation

11 Protein complementation assay It started with complementation of enzyme (e.g. ß-lactamase) similar to yeast-2-hybrid Complementation of fluorescence proteins (GFP) results in crosslinking of the partners Luciferase is much faster and easy to detect

12 Yeast -3-hybrid assay Medicinal chemistry is needed A technology to screen for hundreds of binding partners G.C. Terstappen et al., Nat. Rev. Drug Disc. 2007, 6,

13 3 short case studies 3 short case studies to demonstrate technologies in more detail Focus on biochemical suppression, Pulldown analysis and Proximity ligation technology

14 Identification of a micromolar inhibitor by biochemical suppression Inhibitor with wnt protein (in media) EC50 of 3.9±0.07µM Low micromolar inhibitor of the wnt pathway with a decaline core structure

15 Reducing the number of possible targets Inhibitor with Li (similar results with selective GSK inhibitors) SR56 vs Lithium Luciferase Aktivität Konzentration SR56 in µm EC50 of 2.7±0.04µM Inhibition not upstream of GSK-3ß

16 Reducing the number of possible targets compound β-catenin medium Wnt3a control 2 µm 4 µm 6 µm 8 µm α-tubulin? Western blot in SW480 cell line (colon cancer) Inhibition not upstream of GSK-3ß and not at the level of Axin

17 Principle of biochemical suppression assay G.C. Terstappen et al., Nat. Rev. Drug Disc. 2007, 6,

18 Application of biochemical suppression assay Wnt3a control cytosol fraction nuclear fraction β-catenin α-tubulin Compound was used at EC 50 concentration Activity is retained if incubated with cytosolic fraction Decalin compound is bound by a protein of the nucleus fraction Nuclear envelope was removed during fractionation process

19 rel. amount of ß-catenin (%) rel. amount of ß-catenin (%) Detailed analysis of an oxepane activator via Pulldown compound β-catenin Wnt3a control 4 µm 8 µm 12 µm 16 µm α-tubulin H N O O O H O H N H O H Wnt3a wnt 4 µm 8 µm 12 12µM µm 16 µm Activity could be verified using Hek293 cell line SAR relationship was developed and affinity probe was synthesised

20 Affinity based target deconvolution Streptavidin magnetic beads Release by heating Biotinylated inhibitor washing Mixture of proteins

21 Affinity based target deconvolution Comparison variant was used 75 mm MgCl 2 was used for affinity purification, as 100 mm MgCl 2 was to stringent and 50 mm MgCl 2 resulted in too many identified proteins 5 affinity purifications were analysed 9 proteins were identified (3 out of 5) proteins identified probe specific proteins 100 mm MgCl 2 75 mm MgCl 2 50 mm MgCl

22 Pescadillo first identified protein wnt dependent phenotype (noncanonical) Pescadillo links Ribosome biogenesis to cancer and chomosomal stability function: Ribosome assembly non-canonical wnt signalling emryonic development / cell migration cell growth control / DNA replication X. laevis embryo treated with Pescadillo sirna cytoplasm nucleolus nucleus

23 wnt dependent phenotype (noncanonical) Van Gogh like-2 is a receptor of wnt signaling responsible for cell polarity Further textual evidence supports this finding

24 Introduction into Proximity ligation technology Detection and quantification of selective proteins, protein modifications or proteinprotein interactions Detection of proteins or modifications in close proximity (< 40 nm) Procedure: Preparation of cellular samples (fixation, permeabilization, blocking) Target detection using primary antibodies (A.) Addition of secondary antibodies, conjugated with oligonucleotide sequences (B.) Ligation of oligonucleotide sequences by the addition of two oligonucleotide sequences and a Ligase (C.) Amplification of PLA signal by rolling circle amplification (D.)

25 Workflow and miniaturisation Cell culture and compound treatment Fixation / Blocking Fixation: 10 µl/well; 30 min RT Blocking: 50 µl/well; 45 min 37 C Primary antibodies PLA protocol Counter staining 20 µl/well; o/n 4 C PLA probes: 10 µl/well; 1 h 37 C Ligation: 10 µl/well; 30 min 37 C Amp.: 10 µl/well; 100 min 37 C Counter stain for nucleus, cytopl. Every arrow includes a washing step Plate format: 384-well plates Image aquisition: images/well

26 reduction of spot density [%] reduction of spot density [%] PLA technology for relative activity assessment Log 10 [c68] (M) Log 10 [c61] (M) PLA used for activity assessment in a cellular enviroment PLA can also be used in tissue slices and with endogenous levels of proteins

27 PLA technology in tissue PLA performed on primary mouse hippocampal tissue to analyse recetor activation in 4% of cells the molecule is located in the nucleus Tissue PLA established by our academic partner Thomas Theis (AG Biosynthesis of Neural Structures, Center for Molecular Neurobiology Hamburg)

Small-Molecule Drug Target Identification/Deconvolution Technologies

Small-Molecule Drug Target Identification/Deconvolution Technologies Small-Molecule Drug Target Identification/Deconvolution Technologies Case-Studies Shantani Target ID Technology Tool Box Target Deconvolution is not Trivial = A single Tool / Technology May Not necessarily

More information

Comparison of LANCE Ultra TR-FRET to PerkinElmer s Classical LANCE TR-FRET Platform for Kinase Applications

Comparison of LANCE Ultra TR-FRET to PerkinElmer s Classical LANCE TR-FRET Platform for Kinase Applications Comparison of LANCE Ultra TR-FRET to PerkinElmer s Classical LANCE TR-FRET Platform for Kinase Applications LANCE ULTRA TR-FRET TECHNOLOGY A P P L I C A T I O N N O T E Introduction Protein kinases play

More information

Synergy NEO HTS Multi-Mode Microplate Reader and Life Technologies Reagents

Synergy NEO HTS Multi-Mode Microplate Reader and Life Technologies Reagents A p p l i c a t i o n G u i d e Synergy NEO HTS Multi-Mode Microplate Reader and Life Technologies Reagents High Performance Multi-Detection Capabilities that Span the Small Molecule Drug Discovery Process

More information

Monitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology. Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics

Monitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology. Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics Monitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics Proteomics and studying dynamic interactions AP-MS Proteomics

More information

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...

Contents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution... vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface

More information

Hitting the target in phenotypic drug discovery: Advances in receptor deconvolution

Hitting the target in phenotypic drug discovery: Advances in receptor deconvolution Hitting the target in phenotypic drug discovery: Advances in receptor deconvolution Jim Freeth, Retrogenix, UK Jim.Freeth@retrogenix.com ELRIG Research and Innovation Meeting March 11th 2014 The right

More information

Drug Discovery Research Clinical Screening. Comparison of ELISA and AlphaScreen Assay Technologies for Measurement of Protein Expression Levels

Drug Discovery Research Clinical Screening. Comparison of ELISA and AlphaScreen Assay Technologies for Measurement of Protein Expression Levels Drug Discovery Research Clinical Screening FLAG Expression Measurement Application Note Comparison of ELISA and AlphaScreen Assay Technologies for Measurement of Protein Expression Levels ALPHASCREEN APPLICATION

More information

How to run Alpha assay: How to setup an Alpha assay Make your own assay!

How to run Alpha assay: How to setup an Alpha assay Make your own assay! How to run Alpha assay: How to setup an Alpha assay Make your own assay! 1 2009 PerkinElmer AlphaLISA kits - recommendations before starting the assay Samples: Phenol red and hemoglobin: choose AlphaLISA

More information

!! PLEASE READ BEFORE USE!!

!! PLEASE READ BEFORE USE!! In situ Proximity Ligation Assay protocols!! PLEASE READ BEFORE USE!! The test protocol is a guideline, user need to determine their optimal experimental condition for best performance. The following protocol

More information

DNA damage - AP site- Assay Kit (Cell-Based)

DNA damage - AP site- Assay Kit (Cell-Based) ab133076 DNA damage - AP site- Assay Kit (Cell-Based) Instructions for Use For the detection of aldehyde sites in cells. This product is for research use only and is not intended for diagnostic use. 1

More information

Tracking Cellular Protein Localization and Movement in Cells with a Flexible Fluorescent Labeling Technology. Chad Zimprich January 2015

Tracking Cellular Protein Localization and Movement in Cells with a Flexible Fluorescent Labeling Technology. Chad Zimprich January 2015 Tracking Cellular Protein Localization and Movement in Cells with a Flexible Fluorescent Labeling Technology Chad Zimprich January 2015 Presentation verview HaloTag Fusion Technology Design Functionality

More information

Proteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125

Proteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125 Proteomics Manickam Sugumaran Department of Biology University of Massachusetts Boston, MA 02125 Genomic studies produced more than 75,000 potential gene sequence targets. (The number may be even higher

More information

Award Number: W81XWH TITLE: Direct inhibition of Skp2 for the Treatment of Advanced Prostate Cancer. PRINCIPAL INVESTIGATOR: Hyun-Suk Lim

Award Number: W81XWH TITLE: Direct inhibition of Skp2 for the Treatment of Advanced Prostate Cancer. PRINCIPAL INVESTIGATOR: Hyun-Suk Lim AD Award Number: W81XWH-11-1-0286 TITLE: Direct inhibition of Skp2 for the Treatment of Advanced Prostate Cancer PRINCIPAL INVESTIGATOR: Hyun-Suk Lim CONTRACTING ORGANIZATION: Indiana University Indianapolis,

More information

High Throughput Quantitation of Cytokine Biomarkers using LANCE Ultra TR-FRET Assays

High Throughput Quantitation of Cytokine Biomarkers using LANCE Ultra TR-FRET Assays APPLIATION NOTE LANE TR-FRET Authors: Jen arlstrom Stephen Hurt Roger osse PerkinElmer, Inc. Hopkinton, MA High Throughput Quantitation of ytokine iomarkers using LANE Ultra TR-FRET Assays Introduction

More information

Biochemical Binding ADCC Assays Utilizing AlphaLISA Toolbox Reagents for the Characterization of higgs and FcγR1A

Biochemical Binding ADCC Assays Utilizing AlphaLISA Toolbox Reagents for the Characterization of higgs and FcγR1A APPLICATION NOTE AlphaLISA Technology Authors: Daniel Cardillo Stephen Hurt PerkinElmer, Inc. Hopkinton, MA Biochemical Binding ADCC Assays Utilizing AlphaLISA Toolbox Reagents for the Characterization

More information

MicroRNA Analysis Paired with Novel Cell Health Assays: A Complete Workflow

MicroRNA Analysis Paired with Novel Cell Health Assays: A Complete Workflow MicroRNA Analysis Paired with Novel Cell Health Assays: A Complete Workflow Brad Hook, Ph.D Manager, NA Scientific Applications 2016 Presentation Outline From cells to RNA a seemingly easy, yet complex

More information

Molecular Cloning. Joseph Sambrook. David W. Russell A LABORATORY MANUAL COLD SPRING HARBOR LABORATORY PRESS VOLUME.

Molecular Cloning. Joseph Sambrook. David W. Russell A LABORATORY MANUAL COLD SPRING HARBOR LABORATORY PRESS VOLUME. VOLUME Molecular Cloning A LABORATORY MANUAL THIRD EDITION www.molecularcloning.com Joseph Sambrook PETER MACCALLUM CANCER INSTITUTE AND THE UNIVERSITY OF MELBOURNE, AUSTRALIA David W. Russell UNIVERSITY

More information

Technical Manual. Transcreener KINASE TR-FRET Assay

Technical Manual. Transcreener KINASE TR-FRET Assay Technical Manual Transcreener KINASE TR-FRET Assay Transcreener KINASE TR-FRET Assay Kit Instructions for Part Numbers 3005-1K and 3005-10K 1.0 Introduction p.2 2.0 Assay Principle p.3 3.0 Assay Components

More information

Masayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies

Masayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies Molecular Cell, Volume 35 Supplemental Data Single-Molecule Analysis Reveals Differential Effect of ssdna-binding Proteins on DNA Translocation by XPD Helicase Masayoshi Honda, Jeehae Park, Robert A. Pugh,

More information

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit

RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit RayBio Human NF-κB p65 Transcription Factor Activity Assay Kit Catalog #: TFEH-p65 User Manual Mar 13, 2017 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,

More information

Supporting information. Single-cell and subcellular pharmacokinetic imaging allows insight into drug action in vivo

Supporting information. Single-cell and subcellular pharmacokinetic imaging allows insight into drug action in vivo Supporting information Single-cell and subcellular pharmacokinetic imaging allows insight into drug action in vivo Greg Thurber 1, Katy Yang 1, Thomas Reiner 1, Rainer Kohler 1, Peter Sorger 2, Tim Mitchison

More information

Universal Kinase Assay Kit (Fluorometric) For monitoring ADP formation, which is directly proportional to enzyme phosphotransferase activity

Universal Kinase Assay Kit (Fluorometric) For monitoring ADP formation, which is directly proportional to enzyme phosphotransferase activity ab138879 Universal Kinase Assay Kit (Fluorometric) Instructions for Use For monitoring ADP formation, which is directly proportional to enzyme phosphotransferase activity This product is for research use

More information

Overview of Solulink Products. June 2011

Overview of Solulink Products. June 2011 Overview of Solulink Products June 2011 1 Who we are Established in 2003, Solulink develops, patents, manufactures, and sells consumables to over 1,000 customers in life science, diagnostic, and pharmaceutical

More information

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)

Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make

More information

Use of Phase Contrast Imaging to Track Morphological Cellular Changes due to Apoptotic Activity

Use of Phase Contrast Imaging to Track Morphological Cellular Changes due to Apoptotic Activity A p p l i c a t i o n N o t e Use of Phase Contrast Imaging to Track Morphological Cellular Changes due to Apoptotic Activity Brad Larson and Peter Banks, Applications Department, BioTek Instruments, Inc.,

More information

MitoBiogenesis In-Cell ELISA Kit (Colorimetric)

MitoBiogenesis In-Cell ELISA Kit (Colorimetric) PROTOCOL MitoBiogenesis In-Cell ELISA Kit (Colorimetric) DESCRIPTION 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MS643 Rev.2 For identifying inhibitors and activators of mitochondrial biogenesis

More information

Introduction to Assay Development

Introduction to Assay Development Introduction to Assay Development A poorly designed assay can derail a drug discovery program before it gets off the ground. While traditional bench-top assays are suitable for basic research and target

More information

Confocal Microscopy Analyzes Cells

Confocal Microscopy Analyzes Cells Choosing Filters for Fluorescence A Laurin Publication Photonic Solutions for Biotechnology and Medicine November 2002 Confocal Microscopy Analyzes Cells Reprinted from the November 2002 issue of Biophotonics

More information

LanthaScreen Terbium-Labeled TR-FRET Anti-Epitope Tag Reagents - User Guide

LanthaScreen Terbium-Labeled TR-FRET Anti-Epitope Tag Reagents - User Guide LanthaScreen Terbium-Labeled TR-FRET Anti-Epitope Tag Reagents - User Guide Cat. nos. PV3568, PV3569, PV4216, PV4217 Shipping Condition: Frozen Storage: -20 C Lit. no. PV421X.pps Rev. Date: 30 Aug 2005

More information

Tyrosine Kinase Assay Kit, Red*

Tyrosine Kinase Assay Kit, Red* Rh Tyrosine Kinase Assay Kit, Red* 1.0 INTRODUCTION Part # P2882, P2883 Lit. # L0531 Rev. 11/02 Page 1 of 6 The phosphorylation of proteins by protein tyrosine kinases (PTKs) is critical to the normal

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

HTRF KinEASE STK discovery kit

HTRF KinEASE STK discovery kit HTRF KinEASE STK discovery kit P R O T O C O L Part # 62ST0PEB Test size: 1,000 tests Revision: 06 (Dec. 2017) Assay volume: 20 µl Store at: 2-8 C This product is intended for research purposes only. The

More information

PD-1 Pathway Recombinant Protein Collection

PD-1 Pathway Recombinant Protein Collection Pathway Recombinant Protein Collection www.acrobiosystems.com Content I. Introduction II. Biotinylated Pathway Proteins IIa. ELISA IIb. FAC Sorting IIc. Biopanning III. HPLC-verified Proteins IV. Full-length

More information

SureSilencing sirna Array Technology Overview

SureSilencing sirna Array Technology Overview SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference

More information

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- #1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals

More information

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFPHigh cells. Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

More information

EdU Flow Cytometry Kit. User Manual

EdU Flow Cytometry Kit. User Manual User Manual Ordering information: (for detailed kit content see Table 2) EdU Flow Cytometry Kits for 50 assays: Product number EdU Used fluorescent dye BCK-FC488-50 10 mg 6-FAM Azide BCK-FC555-50 10 mg

More information

TAKING PROTEIN PHOSPHORYLATION MEASUREMENT ONE STEP FURTHER. Alpha SureFire Technology. AlphaLISA SureFire Ultra

TAKING PROTEIN PHOSPHORYLATION MEASUREMENT ONE STEP FURTHER. Alpha SureFire Technology. AlphaLISA SureFire Ultra TAKING PROTEIN PHOSPHORYLATION MEASUREMENT ONE STEP FURTHER Alpha SureFire Technology AlphaLISA SureFire Ultra IT S THE ASSAY THAT DEFINES NEXT GENERATION If you're developing biotherapeutics whether you're

More information

CRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611

CRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611 Data Sheet CRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611 Background The main role of the camp response element, or CRE, is mediating the effects of Protein Kinase A (PKA)

More information

Applications of HTRF and Tag-lite Assays for HTP Antibody Screening

Applications of HTRF and Tag-lite Assays for HTP Antibody Screening Applications of HTRF and Tag-lite Assays for HTP Antibody Screening Brigitte Devaux, PhD Bristol Myers Squibb, Redwood City CA HTRF Symposium April 25, 2013 1 Introduction Generate human therapeutic antibodies

More information

Simplifying Kinase Profiling Using ADP Detection with the Transcreener Kinase Assay Introduction Figure 1. Transcreener Kinase Assay Principle

Simplifying Kinase Profiling Using ADP Detection with the Transcreener Kinase Assay Introduction Figure 1. Transcreener Kinase Assay Principle Simplifying Kinase Profiling Using ADP Detection with the Transcreener Kinase Assay Karen M. Kleman-Leyer, Tony A. Klink, Thane A. Westermeyer and Robert G. Lowery Introduction A variety of HTS kinase

More information

Nucleic Acid Transfection. Genomics. TransIT Transfection Tools. Technical tip D.103

Nucleic Acid Transfection. Genomics. TransIT Transfection Tools. Technical tip D.103 The nucleic acids delivery specialists design our transfection reagents. Our formulations provide superior transfection efficiency and cell viability. This complete range includes TransIT reagents, based

More information

Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme

Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the

More information

Part. no. PV4319.pps Rev. date 29 June 2006

Part. no. PV4319.pps Rev. date 29 June 2006 Z -LYTE KINASE ASSAY KIT SER/THR 18 PEPTIDE Cat. No. PV4319 Shipping Condition: Dry Ice Initial Storage: 80 C Part. no. PV4319.pps Rev. date 29 June 2006 Table of Contents 1 Introduction... 2 2 Assay Theory...

More information

Advanced phospho-erk1/2 (Thr202/Tyr204) 500 tests

Advanced phospho-erk1/2 (Thr202/Tyr204) 500 tests Headquarters & Europe Office Cisbio Bioassays Phone: +33 (0)4 66 79 67 05 Fax: +33 (0)4 66 79 19 20 bioassays@cisbio.com cisbio_dd_pi_64aerpeg USA Office Cisbio US, Inc. Phone: +1 888 963 4567 Fax: +1

More information

MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study

MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study MagSi Beads Magnetic Silica Beads for Life Science and Biotechnology study MagnaMedics Diagnostics B.V. / Rev. 9.2 / 2012 Wide range of products for numerous applications MagnaMedics separation solutions

More information

LI-COR, Odyssey, Aerius, IRDye and In-Cell Western are registered trademarks or trademarks of LI-COR Biosciences Inc.

LI-COR, Odyssey, Aerius, IRDye and In-Cell Western are registered trademarks or trademarks of LI-COR Biosciences Inc. PROTOCOL PARP-1 (cleaved) In-Cell ELISA Kit (IR) 185 Millrace Drive, Suite 3A Eugene, Oregon 9743 MSA43 Rev. DESCRIPTION An In-Cell ELISA kit for measuring cleaved PARP-1 (89kDa fragment) in human adherent

More information

Lecture 25 (11/15/17)

Lecture 25 (11/15/17) Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);

More information

7.06 Problem Set #3, Spring 2005

7.06 Problem Set #3, Spring 2005 7.06 Problem Set #3, Spring 2005 1. The Drosophila compound eye is composed of about 800 units called ommatidia. Each ommatidium contains eight photoreceptor neurons (R1 through R8), which develop in a

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid

More information

Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis

Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis CORRECTION Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis Tokameh Mahmoudi, Sylvia F. Boj, Pantelis Hatzis, Vivian S. W. Li,

More information

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of

More information

BIO 315 Lab Exam I. Section #: Name:

BIO 315 Lab Exam I. Section #: Name: Section #: Name: Also provide this information on the computer grid sheet given to you. (Section # in special code box) BIO 315 Lab Exam I 1. In labeling the parts of a standard compound light microscope

More information

Hossain_Supplemental Figure 1

Hossain_Supplemental Figure 1 Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT

More information

Z -LYTE KINASE ASSAY KIT SER/THR 9 PEPTIDE PROTOCOL

Z -LYTE KINASE ASSAY KIT SER/THR 9 PEPTIDE PROTOCOL Z -LYTE KINASE ASSAY KIT SER/THR 9 PEPTIDE PROTOCOL Part # PV3324 Lit. # 762-038412 020304 TABLE OF CONTENTS 1.0 INTRODUCTION... 2 2.0 ASSAY THEORY... 2 3.0 Z -LYTE KINASE ASSAY KIT SER/THR 9 PEPTIDE MATERIALS

More information

phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation

phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis 1 Outline 1. phab Dyes 2. Protocols for conjugating phab Dyes to antibodies 3. Applications:

More information

Real-time 96-well antibody internalization assays using IncuCyte FabFluor Red Antibody Labeling Reagent

Real-time 96-well antibody internalization assays using IncuCyte FabFluor Red Antibody Labeling Reagent Nicola Bevan, Tim Dale, Del Trezise Essen BioScience Welwyn Garden City, Hertfordshire, UK Introduction Monoclonal antibodies are now widely used as anti-cancer, antiinflammatory and anti-viral therapeutic

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

HTRF KinEASE-STK S3 kit

HTRF KinEASE-STK S3 kit HTRF KinEASE-STK S3 kit P R O T O C O L Part # 62ST3PEB, 62ST3PEC & 62ST3PEJ Test size: 1,000 tests (62ST3PEB), 20,000 tests (62ST3PEC), 100,000 tests (62ST3PEJ) Revision: 01 (Dec. 2017) Assay volume:

More information

ab Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit

ab Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit ab128967 - Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit Instructions for Use For the detection of a specific antibody bound to an antigen in tissue sections. This product is for research use only

More information

Fluorescence Microscopy. Terms and concepts to know: 10/11/2011. Visible spectrum (of light) and energy

Fluorescence Microscopy. Terms and concepts to know: 10/11/2011. Visible spectrum (of light) and energy Fluorescence Microscopy Louisiana Tech University Ruston, Louisiana Microscopy Workshop Dr. Mark DeCoster Associate Professor Biomedical Engineering 1 Terms and concepts to know: Signal to Noise Excitation

More information

The Two-Hybrid System

The Two-Hybrid System Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe

More information

Program overview. SciLifeLab - a short introduction. Advanced Light Microscopy. Affinity Proteomics. Bioinformatics.

Program overview. SciLifeLab - a short introduction. Advanced Light Microscopy. Affinity Proteomics. Bioinformatics. Open House Program SciLifeLab Open House in Stockholm November 4, 2015 09:00-16:00 Contact: events@scilifelab.se Program overview 09:00-09:30-10:00-10:30-11:00-11:30-12:00-12:30-13:00-13:30-14:00-14:30-15:00-15:30-09:30

More information

SANTA CRUZ BIOTECHNOLOGY, INC.

SANTA CRUZ BIOTECHNOLOGY, INC. TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same

More information

ab Ubiquitylation Assay Kit (HeLa lysate-based)

ab Ubiquitylation Assay Kit (HeLa lysate-based) ab139471 Ubiquitylation Assay Kit (HeLa lysate-based) Instructions for Use For the generation of ubiquitin-conjugated lysate proteins This product is for research use only and is not intended for diagnostic

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

Roche Molecular Biochemicals Technical Note No. LC 10/2000

Roche Molecular Biochemicals Technical Note No. LC 10/2000 Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce

More information

Alpha SureFire Ultra HV Multiplex

Alpha SureFire Ultra HV Multiplex Alpha SureFire Ultra HV Multiplex p-akt 1/2/3 (Ser473) 615 (Eu) + Total Akt 1 545 (Tb) Assay Kit Manual Assay Points Catalog # 100 (96 well format) MPSU-PTAKT-K-HV For Research Use Only. Not for use in

More information

Design of a FRET-based High-Throughput Screening kit for SUMO1-Ubc9 protein-protein interactions

Design of a FRET-based High-Throughput Screening kit for SUMO1-Ubc9 protein-protein interactions Design of a FRET-based High-Throughput Screening kit for SUMO1-Ubc9 protein-protein interactions David Bui Richard Lauhead Randall Mello Michelle Tran Team E Advisor: Jiayu Liao June 7 th, 21 1 of 53 Table

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A

Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Discovery and Humanization of Novel High Affinity Neutralizing Monoclonal Antibodies to Human IL-17A Contacts: Marty Simonetti martysimonetti@gmail.com Kirby Alton kirby.alton@abeomecorp.com Rick Shimkets

More information

Assessment of HDAC1 Inhibition Using an Automated, Bioluminescent Histone Deacetylase I/II Assay

Assessment of HDAC1 Inhibition Using an Automated, Bioluminescent Histone Deacetylase I/II Assay A p p l i c a t i o n N o t e Assessment of HDAC1 Inhibition Using an Automated, Bioluminescent Histone Deacetylase I/II Assay Brad Larson, BioTek Instruments, Inc., Winooski, VT Tracy Worzella, Promega

More information

RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)

RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information

More information

Xfect Protein Transfection Reagent

Xfect Protein Transfection Reagent Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection

More information

A Comparison of AlphaLISA and TR-FRET Homogeneous Immunoassays in Serum-Containing Samples

A Comparison of AlphaLISA and TR-FRET Homogeneous Immunoassays in Serum-Containing Samples application Note A Comparison of and Homogeneous Immunoassays in Serum-Containing Samples Authors Anuradha Prasad, PhD, Catherine Lautenschlager, PhD, Stephen Hurt, PhD, David Titus, PhD and Stéphane Parent,

More information

TOOLS FOR DRUG DISCOVERY

TOOLS FOR DRUG DISCOVERY TOOLS FOR DRUG DISCOVERY targeting epigenetics and transcription Epigenetics Gene Regulation mirna www.activemotif.com DRUG DISCOVERY TOOLBOX assays, reagents and services to accelerate your research Target

More information

Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance

Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression

More information

USER MANUAL. Fluorescence

USER MANUAL. Fluorescence USER MANUAL Fluorescence The protocols in this manual are compatible with all Duolink II PLA probes, Duolink II Detection Reagents Green (art no 92014), Orange (art no. 92007), Red (art no. 92008) and

More information

TheraLin. Universal Tissue Fixative Enabling Molecular Pathology

TheraLin. Universal Tissue Fixative Enabling Molecular Pathology TheraLin Universal Tissue Fixative Enabling Molecular Pathology TheraLin Universal Tissue Fixative Enabling Molecular Pathology Contents Page # TheraLin Universal Tissue Fixative 3 Introduction 5 Easy

More information

Tag-lite Angiotensin AT2 labeled Cells, ready-to-use (transformed & labeled), 200 tests* (Part# C1TT1AT2)

Tag-lite Angiotensin AT2 labeled Cells, ready-to-use (transformed & labeled), 200 tests* (Part# C1TT1AT2) TAG - L I T E Tag-lite Angiotensin AT2 Receptor Ligand Binding Assay protocol Angiotensin AT2 labeled cells for: 200 tests Part#: C1TT1AT2 Lot#: 07-2 November 2013 (See expiration date on package label)

More information

DNA Microarray Technology

DNA Microarray Technology CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic

More information

SO MUCH SCIENCE SO LITTLE BENCH SPACE. VICTOR Nivo Multimode Plate Reader. For research purposes only. Not for use in diagnostic procedures.

SO MUCH SCIENCE SO LITTLE BENCH SPACE. VICTOR Nivo Multimode Plate Reader. For research purposes only. Not for use in diagnostic procedures. SO MUCH SCIENCE SO LITTLE BENCH SPACE VICTOR Nivo Multimode Plate Reader For research purposes only. Not for use in diagnostic procedures. CLEAR A LITTLE ROOM FOR THE NEXT BIG THING IN PLATE READERS COMPACT

More information

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?

More information

This Document Contains:

This Document Contains: This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular

More information

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction

More information

Automated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis

Automated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis A p p l i c a t i o n N o t e Automated Imaging and Dual-Mask Analysis of γh2ax Foci to Determine DNA Damage on an Individual Cell Basis Brad Larson, BioTek Instruments, Inc., Winooski, VT USA Asha Sinha

More information

Getting the Most from Your DNA Analysis from Purification to Downstream Analysis. Eric B. Vincent, Ph.D. February 2013

Getting the Most from Your DNA Analysis from Purification to Downstream Analysis. Eric B. Vincent, Ph.D. February 2013 Getting the Most from Your DNA Analysis from Purification to Downstream Analysis Eric B. Vincent, Ph.D. February 2013 1 Presentation Outline Genomic Analysis Purification Quantitation Qualification Analysis

More information

ProQuantum high-sensitivity immunoassays

ProQuantum high-sensitivity immunoassays ProQuantum high-sensitivity immunoassays The next generation in protein quantitation Measure protein analytes with high specificity and sensitivity Invitrogen ProQuantum high-sensitivity immunoassays are

More information

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying

More information

42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)

42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2) SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca

More information

Developing a Time-Resolved Fluorescence Resonance Energy Transfer (TR-FRET) Assay

Developing a Time-Resolved Fluorescence Resonance Energy Transfer (TR-FRET) Assay AppNote Developing a Time-Resolved Fluorescence Resonance Energy Transfer (TR-FRET) Assay Table of Contents Introduction Page Introduction.................................................... 1 Guidelines

More information

BoTest A/E Botulinum Neurotoxin Detection Kit- Detailed Description

BoTest A/E Botulinum Neurotoxin Detection Kit- Detailed Description Figure 1. BoTest A/E Reporter. (A) BioSentinel s BoTest A/E Reporter. CFP and YFP are connected by SNAP-25 (amino acids 141-206). The cleavage sites for each BoNT sero-type are indicated. (B) A FRET assay

More information

PARP-1 (cleaved) Human In-Cell ELISA Kit (IR)

PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) ab110215 PARP-1 (cleaved) Human In-Cell ELISA Kit (IR) Instructions for Use For the quantitative measurement of Human PARP-1 (cleaved) concentrations in cultured adherent and suspension cells. This product

More information

DNA Workflow. Marine Biological Laboratory. Mark Bratz Applications Scientist, Promega Corporation. August 2016

DNA Workflow. Marine Biological Laboratory. Mark Bratz Applications Scientist, Promega Corporation. August 2016 DNA Workflow Marine Biological Laboratory Mark Bratz Applications Scientist, August 2016 Scientific Applications Support Mission Realize customer driven applications of Promega technologies to enhance

More information

Challenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor

Challenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor Calcium Signals in Biological Systems Lecture 3 (2/9/0) Measuring intracellular Ca 2+ signals II: Genetically encoded Ca 2+ sensors Henry M. Colecraft, Ph.D. Challenges to measuring intracellular Ca 2+

More information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class

More information

Biomarker Discovery using Surface Plasmon Resonance Imaging

Biomarker Discovery using Surface Plasmon Resonance Imaging F e a t u r e A r t i c l e Feature Article Biomarker Discovery using Surface Plasmon Resonance Imaging Elodie LY-MORIN, Sophie BELLON, Géraldine MÉLIZZI, Chiraz FRYDMAN Surface Plasmon Resonance (SPR)

More information

Fusion Gene Analysis. ncounter Elements. Molecules That Count WHITE PAPER. v1.0 OCTOBER 2014 NanoString Technologies, Inc.

Fusion Gene Analysis. ncounter Elements. Molecules That Count WHITE PAPER. v1.0 OCTOBER 2014 NanoString Technologies, Inc. Fusion Gene Analysis NanoString Technologies, Inc. Fusion Gene Analysis ncounter Elements v1.0 OCTOBER 2014 NanoString Technologies, Inc., Seattle WA 98109 FOR RESEARCH USE ONLY. Not for use in diagnostic

More information