Design and Ordering Guide. Custom TaqMan Assays. For New SNP Genotyping and Gene Expression Assays

Transcription

1 Design and Ordering Guide Custom TaqMan Assays For New SNP Genotyping and Gene Expression Assays

2 For Research Use Only. Not for use in diagnostic procedures. Information in this document is subject to change without notice. APPLIED BIOSYSTEMS DISCLAIMS ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT, EXPRESSED OR IMPLIED, INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. TO THE FULLEST EXTENT ALLOWED BY LAW, IN NO EVENT SHALL APPLIED BIOSYSTEMS BE LIABLE, WHETHER IN CONTRACT, TORT, WARRANTY, OR UNDER ANY STATUTE OR ON ANY OTHER BASIS FOR SPECIAL, INCIDENTAL, INDIRECT, PUNITIVE, MULTIPLE OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT, INCLUDING BUT NOT LIMITED TO THE USE THEREOF, WHETHER OR NOT FORESEEABLE AND WHETHER OR NOT APPLIED BIOSYSTEMS IS ADVISED OF THE POSSIBILITY OF SUCH DAMAGES. Notice to Purchaser: Limited License NOTICE TO PURCHASER: LIMITED LICENSE A license to perform the patented 5' Nuclease Process for research is obtained by the purchase of (i) both Licensed Probe and Authorized 5' Nuclease Core Kit, (ii) a Licensed 5 Nuclease Kit, or (iii) license rights from Applied Biosystems. The TaqMan SNP Genotyping Assays and TaqMan Gene Expression Assays contain Licensed Probe. Use of this product is covered by one or more of the following US patents and corresponding patent claims outside the US: 5,538,848, 5,723,591, 5,876,930, 6,030,787, 6,258,569, and 5,804,375 (claims 1-12 only). The purchase of this product includes a limited, non-transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser s own internal research. The right to use this product in the 5 Nuclease Process under the applicable claims of US Patents Nos. 5,210,015 and 5,487,972, and corresponding patent claims outside the United States, can be obtained through purchase of an Authorized 5' Nuclease Core Kit. Except under separate license rights available from Applied Biosystems, no right under any other patent claim, or to perform commercial services of any kind, including without limitation reporting the results of purchaser's activities for a fee or other commercial consideration, or to sublicense, repackage with other products, or resell in any form, is conveyed expressly, by implication, or by estoppel. This product is for research use only. Diagnostic uses under Roche patents require a separate license from Roche. Further information on purchasing licenses may be obtained from the Director of Licensing, Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California 94404, USA. TRADEMARKS: AB (Design), Applied Biosystems, and ABI PRISM are registered trademarks and SNPBrowser is a trademark of Applied Biosystems or its subsidiaries in the U.S. and/or certain other countries. TaqMan is a registered trademark of Roche Molecular Systems, Inc. BLAST is a registered trademark of the National Library of Medicine. Microsoft and Windows are registered trademarks of the Microsoft Corporation. All other trademarks are the sole property of their respective owners. Copyright 2009, Applied Biosystems. All rights reserved. Part Number Rev. D Part Number 2/2009

3 Contents Preface v How to use this guide v How to obtain support v Protocol Custom TaqMan Assays Product information Section 1 Design Custom TaqMan SNP Genotyping Assays Review target sequences Select target sites Section 2 Order Custom TaqMan SNP Genotyping Assays Enter sequences Submit sequences for design Select assays Review and order Section 3 Design Custom TaqMan Gene Expression Assays Review target sequences Select target sites Section 4 Order Custom TaqMan Gene Expression Assays Enter sequences Submit sequences for design Select assays Review and order Section 5 Reorder Custom TaqMan Assays Reorder online Reorder legacy assays Appendix A Order Other TaqMan Assays Section A.1 Order Other TaqMan SNP Genotyping Assays Enter custom primer/probe pairs Search for Pre-designed TaqMan SNP Genotyping Assays Section A.2 Order Other TaqMan Gene Expression Assays Enter custom primer/probe pairs Search for Pre-designed TaqMan Gene Expression Assays iii

4 Contents Appendix B Bioinformatics Tools for Evaluating Target Sequences Verify sequence uniqueness with a BLAST database search Find exon-exon boundaries (gene expression assays only) Find exon information using the Vertebrate Genome Annotation Database Mask sequence repeats Detect and mask nontarget sequence polymorphisms Appendix C Using File Builder Software Overview Create the submission file Validate the format Send the sequence information to Applied Biosystems Appendix D Troubleshooting Assay failed design Assay failed manufacturing iv

5 Preface Preface How to use this guide Text conventions This guide uses the following conventions: Bold text indicates user action. For example: Type 0, then press Enter for each of the remaining fields. Italic text indicates new or important words and is also used for emphasis. For example: Before analyzing, always prepare fresh matrix. A right arrow symbol ( ) separates successive commands you select from a drop-down or shortcut menu. For example: Select File Open Spot Set. Right-click the sample row, then select View Filter View All Runs. User attention words Two user attention words appear in Applied Biosystems user documentation. Each word implies a particular level of observation or action as described below: Note: Provides information that may be of interest or help but is not critical to the use of the product. IMPORTANT! Provides information that is necessary for proper instrument operation, accurate chemistry kit use, or safe use of a chemical. How to obtain support For the latest services and support information for all locations, go to: At the Applied Biosystems web site, you can: Access worldwide telephone and fax numbers to contact Applied Biosystems Technical Support and Sales facilities. Search through frequently asked questions (FAQs). Submit a question directly to Technical Support. Order Applied Biosystems user documents, MSDSs, certificates of analysis, and other related documents. Download PDF documents. Obtain information about customer training. Download software updates and patches. v

6 Preface How to obtain support vi

7 Design and Ordering Guide Custom TaqMan Assays Product information About the service The Custom TaqMan Assays Service designs, synthesizes, and delivers analytically quality-controlled primer and probe sets based on sequence information that you supply. All information that you supply is secure and confidential. Use the Custom TaqMan Assays Service to order: Custom TaqMan SNP Genotyping Assays For performing genotyping studies with single-nucleotide polymorphisms (SNPs), multiple nucleotide polymorphisms (MNPs), or insertions/deletions (in/dels). Custom TaqMan Gene Expression Assays For quantitative gene expression analysis and DNA sequence detection. About the Custom TaqMan Assay Design Tool After you select the sequences to study, access the Custom TaqMan Assay Design Tool on the Applied Biosystems web site to enter target sequences, import sequence information from a file, or search the Applied Biosystems database for sequences. After selecting the target sequences, submit the sequences to Applied Biosystems for custom designs. From the Custom TaqMan Assay Design Tool, you can select assays to order, then submit your order. Applied Biosystems manufactures, packages, and ships the TaqMan Assays to you. With the Custom TaqMan Assay Design Tool, you can also: Enter custom primer/probe pairs Submit the sequences for the forward primer, reverse primer, and probe(s), then Applied Biosystems synthesizes the oligos and formulates a custom assay using your oligonucleotide sequences. Search for Pre-Designed TaqMan Assays Search the Applied Biosystems database for pre-designed Inventoried or Made-to-Order TaqMan Assays. 1

8 Custom TaqMan Assays Product information Part numbers Part numbers for the Custom TaqMan Assays indicate the type of assay and the number of reactions you want to order (see Table 1 and Table 2). For SNP assays, you can order human and nonhuman assays; the next section, Considerations for selecting SNP Genotyping Assays for human sequences explains when you should not choose a human assay even when the sequence is human. Contact your Applied Biosystems representative for pricing. Table 1 Part numbers for Custom TaqMan SNP Genotyping Assays Scale: SNP Genotyping Part number Number of reactions 25-μL reaction 96-well plate 5-μL reaction 384-well plate Assay mix concentration Custom TaqMan SNP Genotyping Assays, Human Small , Medium ,000 5, Large ,400 12, Custom TaqMan SNP Genotyping Assays, Non Human Small , Medium ,000 5, Large ,400 12, Table 2 Part numbers for Custom TaqMan Gene Expression Assays Scale: Gene Expression Part number Number of reactions 25-μL reaction 96-well plate 20-μL reaction 384-well plate Assay mix concentration Small Medium Large ,320 2, Considerations for selecting SNP Genotyping Assays for human sequences Applied Biosystems performs a functional test on all human SNP Genotyping Assays. Genomic DNAs (gdnas) from 20 unrelated individuals (from 4 populations and both sexes) are amplified under universal conditions with the SNP Genotyping Assay to test for amplification and clustering. Human SNP Genotyping Assays that fail this test are not shipped. Consequently, if you expect SNP Genotyping Assays to human targets to fail the functional test, order the nonhuman SNP Genotyping Assays. Failures can occur for the following reasons: For human cdna sequences, the test fails because intronic sequences prevent primer or probe binding or separate assay component binding sites and prevent efficient amplification because of longer amplicon size. For human Y-chromosome-specific sequences, the test fails because >90% of the samples in the test must amplify to pass, and the female samples in the functional test do not amplify. 2

9 Custom TaqMan Assays Product information Custom assay design workflow This workflow is for submitting target sequences for Applied Biosystems to design and manufacture Custom TaqMan Assays. Design Custom TaqMan Assays Select target sequence Select and qualify target sites Order Custom TaqMan Assays Using the Custom TaqMan Assay Design Tool Enter sequences Enter or copy and paste the sequence information Find target sequences Import sequence information from a file (File Builder or FASTA) Submit sequences for design Select assays Review and order 3

10 Custom TaqMan Assays Product information 4

11 Section 1 Section 1 Design Custom TaqMan SNP Genotyping Assays This section covers: Review target sequences Select target sites Review target sequences Overview The success of your Custom TaqMan Assay depends largely on the quality of the sequence data that you submit for the design process. After you select your target sequence, verify that it meets criteria for: Allele frequency Length Accuracy Uniqueness IMPORTANT! The quality assurance that is performed during manufacture of the primers and probes can ensure only that the yield and content of the primers and probes meet specifications. Although Applied Biosystems cannot guarantee the biological performance of the assays, reviewing your sequences as described in this document improves the possibility of success for your assay. Note: Human assays are tested against 20 unique DNA samples to ensure that the assays generate at least one cluster. Biological significance Verify that: The SNP is confirmed by more than one line of experimental evidence, for example, that the SNP is a double hit or a validated SNP. Minor Allele Frequency (MAF) data are available for the SNP. The SNP occurs in the population (ethnic group) that you are examining. These biological qualifiers give confidence that a SNP is well studied and may be useful as a marker in your particular study. 5

12 Custom TaqMan Assays Review target sequences Allele frequency criteria The minor allele frequency (MAF) indicates the frequency of the less-frequentlyseen allele in a population (Traditionally, only the minor allele frequency is reported. The major allele frequency is implied, and it is calculated as 1 MAF.). From the MAF, you can estimate the size of the sample population that you need to detect a specified minor allele and to provide statistically significant results. If your sample is considerably smaller than the calculated value, consider using an assay for another SNP (one with a larger MAF) or increasing the sample size. For a known SNP, try to find the allele frequency from resources such as the NCBI dbsnp, HapMap, or other project databases. Use the Hardy-Weinberg Equilibrium equation to determine the likelihood that a SNP with a known MAF in a specified population is detectable in a sample of a particular size in the same population. The Hardy-Weinberg Equilibrium equation is: p 2 + 2pq + q 2 = 1 where p and q represent the allele frequencies. The values for p 2, 2pq, and q 2 correspond to the fraction of a known population that would be homozygous for the p allele (p:p), heterozygous (p:q), and homozygous for the q allele (q:q). MAF example calculation For a SNP with a MAF of 5% (0.05), the predicted spread of genotypes is q:q, p:q, and p:p. In a test of 20 genomic DNA samples from this population, you might expect to see: Approximately 0 homozygotes for q, the minor allele 2 heterozygotes 18 homozygotes for p, the major allele To detect a homozygote for the minor allele, the sample size would need to be approximately 400 individuals. Sequence length criteria A sequence length of approximately 600 bases is optimal, but the sequence length can vary from 100 to 5000 bases. Increasing the sequence length increases the assay design possibilities, although usually SNP assays produce amplicons of <200 base pairs. Provide a longer input sequence if your target sequence has low complexity or contains N-masked nucleotides. Select the sequence so that the target site is near the center of the submitted sequence. About masking sequences The TaqMan Assays Service does not design a primer or probe that spans an ambiguous base (an N). The presence of one or more Ns at a site forces the service to design the assay at another site in the sequence. 6

13 Section 1 Design Custom TaqMan SNP Genotyping Assays Review target sequences You can use Ns, therefore, to hide (mask) sites where you do not want the assay to be designed, such as sites that contain ambiguous bases, known repeats, and/or polymorphisms. Keep in mind, however, that the more Ns you use to mask undesired sites, the more you restrict the assay design possibilities. The next topic describes specific situations where you should consider masking your target sequence. Evaluate sequence accuracy and uniqueness criteria For more information about the tools that are used to evaluate target sequences, see Appendix B on page 47 or refer to Bioinformatic Evaluation of a Sequence for Custom TaqMan SNP Genotyping Assays (PN ). 1. If you performed the sequencing yourself, perform multiple sequencing reactions to eliminate any ambiguities. 2. Except for the SNP(s) that you want to study, mask each ambiguous base in your sequence with an N. For example, the bases in bold text in the sequence below are ambiguous: ACGTGACGTGACGTGACGTGACGTGGATYGTGRSRSTCCT If you mask each ambiguous base with an N, the resulting sequence is: ACGTGACGTGACGTGACGTGACGTGGATNGTGNNNNTCCT Too many Ns can restrict the possibilities for assay design. It may be better to resequence your gene to eliminate ambiguities than to mask the ambiguities with Ns. 3. Using other resources such as public databases, determine if your target sequence is unique within the organism of study or if similar sequences exist in the database. For example, you may find similar sequences in databases of curated gene sequences such as Entrez Gene, at: If other similar sequences exist, determine the degree of similarity. Multiple target sites in the genome interfere with the function of the assays. 4. Using your target sequence as the query, perform a Basic Local Alignment Search Tool (BLAST ) database search to find regions of your sequence that are similar to sequences in the database. See Verify sequence uniqueness with a BLAST database search on page 48 for instructions. 5. If you find regions of your sequence that are similar to sequences in the database, mask those regions of your sequence with Ns. 7

14 Custom TaqMan Assays Select target sites Select target sites Guidelines for selecting potential target sites For SNP assays, each target site identifies a SNP, an MNP, or an insertion/deletion (indel). For the remainder of this section, SNP is used to refer to any of these three types of target site. Select: At least one target site. Note: No more than one assay is synthesized for each sequence, regardless of the number of target sites you enter. Entering more sites increases the assay design possibilities. Target sites that are more than 40 bases away from the 5 and 3 ends. Target sites that are more than two bases away from any Ns. If this is your target site, AGTGAACGCGATA[G/A]GCANCTCCTGCCC verify that no Ns are within two bases. Target sites that are more than two bases away from any other SNPs. At least one specific SNP for assay design (and mask all the remaining nontarget SNPs with Ns). Review sequences for repeats and polymorphisms Assays that are designed in regions of a sequence that contain repeats and/or polymorphisms are likely to produce nonspecific amplification and probe binding. To reduce the likelihood of nonspecific amplification and probe binding, mask repeats and polymorphisms. 1. Run the sequence through a program such as RepeatMasker to detect common repetitive elements. See Mask sequence repeats on page In the masked sequence that is generated by the program, determine if any of your target SNPs are: In a masked repeat Within 2 bases of a masked repeat If either condition exists, select another SNP because a primer or a probe cannot be designed within 2 bases of an N. 3. Run a BLAST database search using the masked sequence from step 2 against the dbsnp, a database of SNPs from various species. See Detect and mask nontarget sequence polymorphisms on page If you find nontarget SNPs, mask the nontarget SNPs with Ns. Select another SNP if any of your target SNPs is within 2 bases of a masked SNP. 8

15 Section 2 Section 2 Order Custom TaqMan SNP Genotyping Assays This section covers: Enter sequences Submit sequences for design Select assays Review and order Enter sequences Access the Custom TaqMan Assay Design Tool 1. Go to then navigate to the Custom TaqMan Assay Design Tool: a. Place the cursor over Products, then under Assay Searches, click TaqMan SNP Genotyping Assays. b. Click the Related Products tab, then in the Assay row, click Custom TaqMan SNP Genotyping Assays. c. In the Start Here box, click Custom TaqMan Assay Design Tool. OR Go directly to the Custom TaqMan Assay Design Tool web site: www5.appliedbiosystems.com/tools/cadt 2. To enter, find, or import the target sequence and SNPs for Applied Biosystems to design and manufacture Custom TaqMan SNP Genotyping Assays, click Order Custom SNP Genotyping Assays. Note: You can also use the Custom TaqMan Assay Design Tool to order custom primer/probe pairs or to order Pre-designed TaqMan Assays. See Appendix A, Order Other TaqMan Assays. Enter Sequences tasks In the Enter Sequences tab, you can enter sequence information three different ways: Enter or copy and paste the sequence information (page 11) Find, then select sequences in the Applied Biosystems database (page 11) Import a File Builder or a FASTA-formatted file that contains the sequence information (page 12) 9

16 Custom TaqMan Assays Enter sequences Click Open/Import File to import a File Builder or FASTA-formatted file Click Find Sequences to search the Applied Biosystems database for sequences Enter or copy and paste the name and sequence into the fields Click to add more rows Click Remove All to remove all sequences Click Remove to remove individual sequences Select the species and scale for the assays Click Check Format to check the format of the name, sequence, and SNP Format requirements Field Requirement Name Has no more than 10 characters Uses only alphanumeric, underscore, hyphen, and period characters Has no spaces or tabs Does not begin with a hyphen Sequence Enter the sequence in the 5 to 3 direction. Enter from 100 to 5000 bases. Use only A, C, G, T, and N, except where SNP or indel target sites are marked. Convert the IUPAC codes R, Y, M, K, S, W, H, B, V, and D to N, except for marked SNP target sites where you translate the ambiguity code to the appropriate bases. Enclose each target site with square brackets [ ]. Within the brackets that enclose: SNP targets: Enter the base for the first allele followed by a forward slash (/), and then the base for the second allele. For example, convert R to [A/G]. MNP targets: Enter from one to six bases for the first allele followed by a forward slash (/), and then one to six bases for the second allele. Insertion/deletion (indel) targets: Enter from one to six bases for the insertion followed by a forward slash(/), then an asterisk (*) for the deletion. Mask with Ns any SNPs, MNPs, or indels that are not of interest. Note: The probe for the first allele is labeled with a VIC dye; the probe for the second allele is labeled with a 6-FAM dye. 10

17 Section 2 Order Custom TaqMan SNP Genotyping Assays Enter sequences Field Requirement SNP target Each SNP target site of interest: Is marked with square brackets Has the bases for 2 alleles of the SNP, separated by a forward slash Each MNP target site of interest: Is marked with square brackets Has 1 to 6 bases to the left of the forward slash and 1 to 6 bases to the right of the forward slash (The number of bases on each side of the slash does not have to be the same.) Each Indel target site of interest: Is marked with square brackets Has 1 to 6 bases to the left of a forward slash and an asterisk to the right of the forward slash Enter or copy and paste the sequence information You can enter or copy and paste the sequence information directly in the Enter Sequences tab. 1. In the Name field, enter the name for the sequence. 2. In the Sequence field, enter the entire sequence of interest in the 5 to 3 direction. Remove any spaces, tabs, and line breaks. 3. Click Check Format to validate the format of the sequence. Note: For each IUPAC code that represents an ambiguous base, you are asked to provide your conversion option. 4. Enter a SNP Name for each SNP in the entered sequence. Note: The combination of target name and sequence name must be unique. 5. (Optional) To enter another sequence: a. Click + Enter More Sequences. b. Repeat step 1 through step 4 in an empty row. 6. Select the species and the scale. See Part numbers on page 2 for the number of reactions for each scale. Note: See Considerations for selecting SNP Genotyping Assays for human sequences on page 2 to determine whether to select human or nonhuman assays. Find target sequences You can search the Applied Biosystems database for target sequences to submit for custom assay designs. 11

18 Custom TaqMan Assays Enter sequences 1. In the Enter Sequences tab, click Find Sequences. 2. Enter the chromosome location or search the database for the gene of interest: To enter the chromosome location, select the Species, Chromosome (number), Chrom Start (chromosome start), and Chrom Stop (chromosome stop), then click Submit. or To search the database for the gene, select the Type (Keyword, Gene Name, Gene Symbol, Accession Number, Entrez Gene ID, or Assay ID), Species, Criteria (Contains, Matches, Begins With, or Ends With), and the Term, then click Submit. The genes that are found are displayed in the Search Results, sorted according to the gene symbol. 3. In the Search Results, scroll through the results, then click Select for the gene of interest. 4. Select the sequence: a. View the genome map to find the SNP(s) of interest. To zoom in: Place the pointer on the genome map in the area you want to enlarge. Click-drag to create a box, then release when the box contains the desired viewing range. To zoom out: Click the until the desired view is restored. b. To redefine the range for the genome map, enter the chromosome number and the chromosome start and stop locations, then click Update Map Range. c. Click an SNP to add the sequence to the Possible Targets list. 5. Add the sequence(s) to the Target List: Click Add All to add all the possible sequences. Click Add for each sequence that you want a custom assay design for. 6. In the Target List, click Add to Design. The sequence information for the selected sites is added to the Edit Sequences tab. 7. Click Check Format to validate the format of the sequence. 8. Enter a SNP Name for each SNP in the entered sequence. Note: The combination of SNP name and sequence name must be unique. Import sequence information from a file You can import files that you created or validated using File Builder software or that contain sequences in FASTA format. 12

19 Section 2 Order Custom TaqMan SNP Genotyping Assays Enter sequences 1. In the Enter/Edit Sequence Information page, click Open/Import File. 2. For the File Type, select: File Builder if your file was created or validated using File Builder software. FASTA if your file is in FASTA format. 3. Click Browse to find the file to import. 4. Select the text file (*.txt) that contains your sequences in File Builder or FASTA format, then click Open. 5. Click Import File. The sequence information from the file is added to the Enter/Edit Sequence Information page. Note: For FASTA-formatted files, the Custom TaqMan Assay Design Tool imports only the first 10 characters of the assay name into the Assay Name field. If your file contains multiple assays with assay names that are similar in the first 10 characters, edit the Assay Name field to distinguish between the assays. 13

20 Custom TaqMan Assays Submit sequences for design Submit sequences for design Check the format and submit sequences 1. In the Enter Sequences tab, click Check Format to validate the format of the sequence information. 2. If an error message is displayed, correct the format of the sequence information, then click Check Format again. Repeat until the format is validated. 3. Click Submit For Assay Design. Note: The button is inactive until the format of the sequence information is free of errors. After you submit your sequences After you submit your sequences for assay design, Applied Biosystems sends you an to confirm that your sequences were submitted. The confirmation has a link to the Custom TaqMan Assay Design Tool. After assay design is complete, Applied Biosystems sends you another that has a link to the design report in the Custom TaqMan Assay Design Tool. If you submitted your sequences without review, you are notified by whether or not your sequences passed assay design. Note: You are charged only for the assays that are delivered to you. 14

21 Section 2 Order Custom TaqMan SNP Genotyping Assays Select assays Select assays About the Select Assays tab The Select Assays tab displays information about your sequence submissions to Applied Biosystems. Design Details Batch Name Indicates the type of assays in the submission. Batch ID The ID assigned to the submission by Applied Biosystems. Submitted The date you submitted the sequence information. Status The status of the design: Completed or In Process Details The number of assays in the batches that passed, failed, or were not designed. Design Results ID/Name A unique 7-character identifier assigned to the custom assay by Applied Biosystems. You need to use the Assay ID to reorder a Custom TaqMan Assay. Also contains the name you entered when you submitted the assay. Type The type of assay: Custom TaqMan SNP Genotyping Assay or Custom TaqMan Gene Expression Assay. Design Status The status of the design: Passed, Failed, or Not Designed Size The size or scale of the assay to order. For available sizes/scales, see page 2. Quantity The number of assays to order. Select assays to order 1. After the assay design is complete, follow the link in your notification to the Custom TaqMan Assay Design Tool. 2. In the Design Details section of the Select Assays tab, select the row that corresponds to the submission. 3. Review the Design Results in the Select Assays tab. 4. For each assay that you want to order: a. In the Size column, select the assay size or scale in the dropdown list. b. In the Quantity column, eter the quantity to order. 5. Click Add All to add all assays to the order, or click Add next to each assay that you want to order. Selected assays are added to the Shopping List. 15

22 Custom TaqMan Assays Review and order Review and order 1. In the Shopping List, click Order Now. 2. In the Review & Order tab, confirm the assays to order: To delete assays, click Remove next to the assay to delete, or click Remove All to remove a group of assays from the Shopping List. To change the size, select a different part number and size from the Size dropdown list. To change the quantity, enter a different number in the Quantity field. To add more items to your Shopping List, click the Home, Search, Select Assays, or Controls & Other Products tab in the Custom TaqMan Assay Design Tool. 3. Click Add to Basket to add the items from your Shopping List to the basket in the Applied Biosystems Store. Note: To use the other ordering options, follow the links to or print your Shopping List. 4. In the Store Log In page, enter your User Name and Password. 5. Select the shopping basket, then click Add to Basket. 6. Review the shopping basket in the Applied Biosystems Store, then click Continue. 7. In the Shipping & Billing page, enter the Shipping Address, Billing Address, Contact Information, Payment Information, Shipping Method, Special Instructions, and Options. When you finish, click Continue. 8. Review the summary, then click Place Order. 16

23 Section 3 Section 3 Design Custom TaqMan Gene Expression Assays This section covers: Review target sequences Select target sites Review target sequences Overview The success of your Custom TaqMan Assay depends largely on the quality of the sequence data that you submit for the design process. After you select your target sequence, verify that it meets criteria for: Length Accuracy Uniqueness IMPORTANT! The quality assurance that is performed during manufacture of the primers and probe can ensure only that the yield and content of the primers and probe meet specifications. Although Applied Biosystems cannot guarantee the biological performance of the assays, reviewing your sequences as described in this document improves the possibility of success for your assay. Biological significance If you know that your gene of interest has more than one transcript (splice variants) make sure that you submit a sequence that detects one or all the variants that you want to detect. Conversely, if you want to detect only one out of five splice variants for a particular transcript, make sure that you select your targets appropriately. Then, mask any unwanted regions of the transcript to ensure that the assay you receive is specific only for your transcript of interest. Sequence length criteria A sequence length of approximately 600 bases is optimal, but the sequence length can vary from 61 to 5000 bases. A short sequence (fewer than 300 bases) restricts the potential number of assays that can be designed. Select the sequence so that the target site is near the center of the submitted sequence. 17

24 Custom TaqMan Assays Review target sequences About masking sequences The TaqMan Assays Service does not design a primer or probe that spans an ambiguous base (an N). The presence of one or more Ns at a site forces the service to design the assay at another site in the sequence. You can use Ns, therefore, to hide (mask) sites where you do not want the assay to be designed, such as sites that contain ambiguous bases, known repeats, and/or polymorphisms. Keep in mind, however, that the more Ns you use to mask undesired sites, the more you restrict the assay design possibilities. The next topic describes specific situations where you should consider masking your target sequence. Evaluate sequence accuracy and uniqueness criteria For more information about the tools used to evaluate target sequences, see Appendix B on page 47 or refer to Bioinformatic Evaluation of a Sequence for Custom TaqMan Gene Expression Assays (PN ). 1. If you performed the sequencing yourself, perform multiple sequencing reactions to verify the sequence. 2. Mask each ambiguous base in your sequence with an N. For example, the bases in bold text in the sequence below are ambiguous: ACGTGACGTGACGTGACGTGACGTGGATYGTGRSRSTCCT If you mask each ambiguous base with an N, the resulting sequence is: ACGTGACGTGACGTGACGTGACGTGGATNGTGNNNNTCCT Too many Ns can restrict the possibilities for assay design. It may be better to resequence your gene to eliminate ambiguities than to mask the ambiguities with Ns. 3. Using other resources such as public databases, determine if your target sequence is unique within the organism of study or if similar sequences exist in the database. For example, you may find similar sequences in databases of curated gene sequences such as Entrez Gene, at: If other similar sequences exist, determine the degree of similarity. Multiple target sites in the genome interfere with the function of the assays. 4. Using your target sequence as the query, perform a Basic Local Alignment Search Tool (BLAST ) database search to find regions of your sequence that are similar to sequences in the database. See Verify sequence uniqueness with a BLAST database search on page 48 for instructions. 5. If you find regions of your sequence that are similar to sequences in the database, mask those regions of your sequence with Ns. 18

25 Section 3 Design Custom TaqMan Gene Expression Assays Select target sites Select target sites After you determine the accuracy and uniqueness of the sequence, select one or more target sites for the sequence. The target site specifies an approximate location for a TaqMan MGB probe. Entering more target sites increases the assay design possibilities. Exon-exon boundaries as target sites Note: Identifying exon-exon boundaries as target sites is important only if you are performing a gene expression study. If possible, identify the exon-exon boundaries that are unique for the sequence of interest and use them as the target sites in the submission file. Assays using the exon boundaries as target sites are designed to exclude detection of genomic DNA. You can find exon information in a variety of databases, including: Entrez Gene database at: Vertebrate Genome Annotation database (Vega) at: See Find exon-exon boundaries (gene expression assays only) on page 53. After you find the exon-exon boundaries, follow the steps in Review sequences for repeats and polymorphisms on page 20. Other sites as targets If the exon-exon boundaries are not known for your sequence or if you are not performing a gene expression experiment, select: At least one target site. If you want an assay for a specific site, enter only that target site for the sequence. If you do not have a specific target site of interest, you can: Use the Automatic option for target assignment. This option directs the Custom TaqMan Assays Service to design the assay anywhere within the sequence. IMPORTANT! The Automatic option does not consider any biological significance. If you select this option, the assay design you receive may not span an exon-exon boundary. Select multiple sites across the sequence to ensure optimal design. Entering multiple sites increases the assay design possibilities. Note: No more than one assay is synthesized for each sequence, regardless of the number of target sites you enter. Target sites that are more than 30 bases away from the 5 and 3 ends. Target sites that are more than five bases away from any Ns. For example, 19

26 Custom TaqMan Assays Select target sites If this is your target site, AGTGAACGAGATAGGCAGCTCCTGCCCCATCCAAGTTACGGCC verify that no Ns are within five bases. Target sites that are not in regions of similarity with other sequences in a gene family, as identified by the BLAST database search. Review sequences for repeats and polymorphisms Assays that are designed in regions of a sequence that contain repeats and/or polymorphisms are likely to produce nonspecific amplification and probe binding. To reduce the likelihood of nonspecific amplification and probe binding, mask repeats and polymorphisms. 1. Run the sequence through a program such as RepeatMasker to detect common repetitive elements. See Mask sequence repeats on page In the masked sequence that is generated by the program, determine if any of your target sites are: In a masked repeat Within 5 bases of a masked repeat If either condition exists, select another target because a primer or a probe cannot be designed within 5 bases of an N. 3. Run a BLAST database search using the masked sequence from step 2 against the dbsnp, a database of SNPs from various species. See Detect and mask nontarget sequence polymorphisms on page If you find SNPs, mask the SNPs with Ns. Select another site if your target site is within 5 bases of an SNP. 20

27 Section 4 Section 4 Order Custom TaqMan Gene Expression Assays This section covers: Enter sequences Submit sequences for design Select assays Review and order Enter sequences Access the Custom TaqMan Assay Design Tool 1. Go to then navigate to the Custom TaqMan Assay Design Tool: a. Place the cursor over Products, then under Assay Searches, click TaqMan Gene Expression Assays. b. Click the Related Products tab, then in the Assay row, click Custom TaqMan Gene Expression Assays. c. In the Start Here box, click Custom TaqMan Assay Design Tool. OR Go directly to the Custom TaqMan Assay Design Tool web site: www5.appliedbiosystems.com/tools/cadt 2. To enter, find, or import the target sequence for Applied Biosystems to design and manufacture Custom TaqMan Gene Expression Assays, click Order Custom Gene Expression Assays. Note: You can also use the Custom TaqMan Assay Design Tool to order custom primer/probe pairs or to order Pre-designed TaqMan Assays. See Appendix A, Order Other TaqMan Assays. Enter Sequences tasks In the Enter Sequences tab, you can enter sequence information three different ways: Enter or copy and paste the sequence information (page 22) Find, then select sequences in the Applied Biosystems database (page 23) Import a File Builder or a FASTA-formatted file that contains the sequence information (page 24) 21

28 Custom TaqMan Assays Enter sequences Click Open/Import File to import a File Builder or FASTA-formatted file Click Find Sequences to search the Applied Biosystems database for sequences Enter or copy and paste the name and sequence into the fields Click to add more rows Click Remove All to remove all sequences Click Remove to remove individual sequences Select the scale for the assays Click Check Format to check the format of the name, sequence, and target position Format requirements Field Requirement Name Has no more than 10 characters Uses only alphanumeric, underscore, hyphen, and period characters Has no spaces or tabs Does not begin with a hyphen Sequence Enter the sequence in the 5 to 3 direction. Enter from 61 to 5000 bases. Use only A, C, G, T, and N. Convert the IUPAC codes R, Y, M, K, S, W, H, B, V, and D to N. Convert U to T. Remove any spaces, tabs, or line breaks. Target site The target position indicates the base position of the target site from the 5 end. The target position indicates where to design the TaqMan probe. The target site name contains no more than four alphanumeric characters. Enter or copy and paste the sequence information You can enter or copy and paste the sequence information directly in the Enter Sequences tab. 1. In the Name field, enter the name for the sequence. 2. In the Sequence field, enter the entire sequence of interest in the 5 to 3 direction. Remove any spaces, tabs, and line breaks. 22

29 Section 4 Order Custom TaqMan Gene Expression Assays Enter sequences 3. Click Check Format to validate the format of the sequence. Note: The only characters that are allowed in a sequence for gene expression assays are: A, C, G, T, and N. The Custom TaqMan Assay Design Tool converts all other characters to Ns. 4. In the Target Site Position & Name column, select: Manual to enter the target position and target name. In the Pos field, enter the number of bases between the target site and the 5 end, then in the Name field, enter the target name. Click + Enter More Targets to enter more target sites. Automatic to have the TaqMan Assays Service select a target from multiple unspecified sites. 5. (Optional) To enter another sequence: a. Click + Enter More Sequences. b. Repeat step 1 through step 4 in an empty row. 6. Select the species and the scale. See Part numbers on page 2 for the number of reactions for each scale. Find target sequences You can search the Applied Biosystems database for target sequences to submit for custom assay designs. 1. In the Enter Sequences tab, click Find Sequences. 2. Search the database for the gene of interest: a. Select the Type: Keyword, Gene Name, Gene Symbol, Accession Number, Entrez Gene ID, or Assay ID b. Select the Species from the dropdown list. c. Select the Criteria: Contains, Matches, Begins With, or Ends With d. Enter the Term to search. e. Click Submit. The genes that are found are displayed in the Search Results, sorted according to the gene symbol. 3. In the Search Results, scroll through the results, then click Select for the gene of interest. 4. Select the sequence: a. If available, view the genome map to find the transcript(s) of interest. The genome map is available only for human, mouse, and rat. 23

30 Custom TaqMan Assays Enter sequences To zoom in: Place the pointer on the genome map in the area you want to enlarge. Click-drag to create a box, then release when the box contains the desired viewing range. To zoom out: Click the until the desired view is restored. b. Select two exons, then click the bracket that joins the exons to add the sequence to the Possible Sequences list. If the transcript contains only one exon, select the exon, then click the bracket that appears above the exon to add the sequence to the Possible Sequences list. Add the sequence(s) to the Target List: Click Add All to add all the possible sequences. Click Add for each sequence that you want a custom assay design for. 5. In the Target List, click Add to Design. The sequence information for the selected sites is added to the Edit Sequences tab. 6. Click Check Format to validate the format of the sequence. 7. In the Target Site Position & Name column, select: Manual to enter the target position and target name. In the Pos field, enter the number of bases between the target site and the 5 end, then in the Name field, enter the target name. Click + Enter More Targets to enter more target sites. Automatic to have the TaqMan Assays Service select a target from multiple unspecified sites. Import sequence information from a file You can import files that you created or validated using File Builder software or that contain sequences in FASTA format. 1. In the Enter/Edit Sequence Information page, click Open/Import File. 2. For the File Type, select: File Builder if your file was created or validated using File Builder software. FASTA if your file is in FASTA format. 3. Click Browse to find the file to import. 4. Select the text file (*.txt) that contains your sequences in File Builder or FASTA format, then click Open. 24

31 Section 4 Order Custom TaqMan Gene Expression Assays Enter sequences 5. Click Import File. The sequence information from the file is added to the Enter/Edit Sequence Information page. Note: For FASTA-formatted files, the Custom TaqMan Assay Design Tool imports only the first 10 characters of the assay name into the Assay Name field. If your file contains multiple assays with assay names that are similar in the first 10 characters, edit the Assay Name field to distinguish between the assays. 25

32 Custom TaqMan Assays Submit sequences for design Submit sequences for design Check the format and submit sequences 1. In the Enter Sequences tab, click Check Format to validate the format of the sequence information. 2. If an error message is displayed, correct the format of the sequence information, then click Check Format again. Repeat until the format is validated. 3. Click Submit For Assay Design. Note: The button is inactive until the format of the sequence information is free of errors. After you submit your sequences After you submit your sequences for assay design, Applied Biosystems sends you an to confirm that your sequences were submitted. The confirmation has a link to the Custom TaqMan Assay Design Tool. After assay design is complete, Applied Biosystems sends you another that has a link to the design report in the Custom TaqMan Assay Design Tool. If you submitted your sequences without review, you are notified by whether or not your sequences passed assay design. Note: You are charged only for the assays that are delivered to you. 26

33 Section 4 Order Custom TaqMan Gene Expression Assays Select assays Select assays About the Select Assays tab The Select Assays tab displays information about your sequence submissions to Applied Biosystems. Design Details Batch Name Indicates the type of assays in the submission. Batch ID The ID assigned to the submission by Applied Biosystems. Submitted The date you submitted the sequence information. Status The status of the design: Completed or In Process Details The number of assays in the batches that passed, failed, or were not designed. Design Results ID/Name A unique 7-character identifier assigned to the custom assay by Applied Biosystems. You need to use the Assay ID to reorder a Custom TaqMan Assay. Also contains the name you entered when you submitted the assay. Type The type of assay: Custom TaqMan SNP Genotyping Assay or Custom TaqMan Gene Expression Assay. Design Status The status of the design: Passed, Failed, or Not Designed Size The size or scale of the assay to order. For available sizes/scales, see page 2. Quantity The number of assays to order. Select assays to order 1. After the assay design is complete, follow the link in your notification to the Custom TaqMan Assay Design Tool. 2. In the Design Details section of the Select Assays tab, select the row that corresponds to the submission. 3. Review the Design Results in the Select Assays tab. 4. For each assay that you want to order: a. In the Size column, select the assay size or scale in the dropdown list. b. In the Quantity column, eter the quantity to order. 5. Click Add All to add all assays to the order, or click Add next to each assay that you want to order. Selected assays are added to the Shopping List. 27

34 Custom TaqMan Assays Review and order Review and order 1. In the Shopping List, click Order Now. 2. In the Review & Order tab, confirm the assays to order: To delete assays, click Remove next to the assay to delete, or click Remove All to remove a group of assays from the Shopping List. To change the size, select a different part number and size from the Size dropdown list. To change the quantity, enter a different number in the Quantity field. To add more items to your Shopping List, click the Home, Search, Select Assays, or Controls & Other Products tab in the Custom TaqMan Assay Design Tool. 3. Click Add to Basket to add the items from your Shopping List to the basket in the Applied Biosystems Store. Note: To use the other ordering options, follow the links to or print your Shopping List. 4. In the Store Log In page, enter your User Name and Password. 5. Select the shopping basket, then click Add to Basket. 6. Review the shopping basket in the Applied Biosystems Store, then click Continue. 7. In the Shipping & Billing page, enter the Shipping Address, Billing Address, Contact Information, Payment Information, Shipping Method, Special Instructions, and Options. When you finish, click Continue. 8. Review the summary, then click Place Order. 28

35 Section 5 Section 5 Reorder Custom TaqMan Assays This section covers: Reorder online Reorder legacy assays

36 Custom TaqMan Assays Reorder online Reorder online 1. Go to then navigate to the Custom TaqMan Assay Design Tool: a. Place the cursor over Products, then under Assay Searches, click: TaqMan SNP Genotyping Assays or TaqMan Gene Expression Assays b. Click the Related Products tab, then in the Assay row, click: Custom TaqMan SNP Genotyping Assays or Custom TaqMan Gene Expression Assays c. In the Start Here box, click Custom TaqMan Assay Design Tool. OR Go directly to the Custom TaqMan Assay Design Tool web site: www5.appliedbiosystems.com/tools/cadt 2. Click Reorder Existing Custom Assays. 3. In the Search tab, search for existing custom assays: a. Select the Type in the dropdown list: Assay ID, Legacy Assay ID, Assay Name, Date Range, Sales Order # Note: Legacy assays are Custom TaqMan Assays that were designed before the release of the Custom TaqMan Assay Design Tool. LegacyAssay IDs were generated differently from Assay IDs. b. Select the Criteria: Matches or Contains c. Enter the Term to search. d. (Optional) Enter the Sales Order #. e. Click Search. 4. For each assay that you want to order: a. Select the assay size in the dropdown list in the Size column. b. Enter the number of tubes to order in the Quantity column. 5. Click Add All to add all assays to the order, or click Add next to each assay to order. Selected assays are added to the Shopping List. 30

37 Section 5 Reorder Custom TaqMan Assays Reorder legacy assays Reorder legacy assays Legacy assays are Custom TaqMan Assays that were designed before the release of the Custom TaqMan Assay Design Tool. LegacyAssay IDs were generated differently from Assay IDs. Use the procedures in this section to reorder legacy assays by or by regular or express mail. For more details on reordering legacy Custom TaqMan Assays, refer to the Custom TaqMan Assays Reordering Guide (PN ). IMPORTANT! To reorder legacy Custom TaqMan Assays, you need information from the Assay Information File (AIF) that was shipped to you with the previous assay. Reorder online To reorder legacy assays online, see Reorder online on page 30. Reorder by 1. Address the message: For orders to North America: genomics@appliedbiosystems.com For orders to Europe: assays.europe@appliedbiosystems.com For other regions, contact your local Applied Biosystems office or visit 2. In the subject line, enter Reorder for Custom TaqMan Assay. 3. In the message body enter the: Sales order number The number in the Assay Information File (AIF) that was shipped to you with your previous Custom TaqMan Assays order Assay ID The ID from the AIF Part number The number that indicates the type of assay and the scale that you want to order Quantity The number of tubes to order Purchase order number or Credit card information The name as it appears on the card, the card number, and the expiration date Contact information The name, address, telephone number, and address of the person to contact if problems occur Shipping information The name, address (including room number, building, department, and the ATTN line information), and telephone number of the person to receive shipment 31

38 Custom TaqMan Assays Reorder legacy assays Invoice information The name, address, physical address, and telephone number of the purchasing agent or person to receive invoice details 4. Send the message. Reorder by regular or express mail 1. Prepare an order document containing the: Sales order number The number in the Assay Information File (AIF) that was shipped to you with your previous Custom TaqMan Assays order Assay ID The ID from the AIF Part number The number that indicates the type of assay and the scale that you want to order Quantity The number of tubes to order. Purchase order number or Credit card information The name as it appears on the card, the card number, and the expiration date Contact information The name, address, telephone number, and address of the person to contact if problems occur Shipping information The name, address (including room number, building, and department), and telephone number of the person to receive shipment Invoice information The name, address, physical address, and telephone number of purchasing agent or person to receive invoice details IMPORTANT! To prevent delays, include all information in the order document. 2. Print a copy of the order document. 3. Send the printed copy of your order document to the appropriate address (see page 73). 32

39 Appendix A Order Other TaqMan Assays This appendix covers: Section A.1 Order Other TaqMan SNP Genotyping Assays Enter custom primer/probe pairs Search for Pre-designed TaqMan SNP Genotyping Assays Section A.2 Order Other TaqMan Gene Expression Assays Enter custom primer/probe pairs Search for Pre-designed TaqMan Gene Expression Assays

40 Appendix A Order Other TaqMan Assays 34

41 Section A.1 Section A.1 Order Other TaqMan SNP Genotyping Assays Enter custom primer/probe pairs Submit the sequences for the forward primer, reverse primer, and TaqMan MGB probes, then Applied Biosystems synthesizes the oligos and formulates a custom assay using your oligonucleotide sequences. Format requirements Field Requirement Assay Name Forward Primer Reverse Primer Enter 4 to 10 characters Enter the sequence in the 5 to 3 direction. Enter 9 to 45 nucleotides. Use only A, C, G, and T. Remove any spaces, tabs, or line breaks. Enter the sequence in the 5 to 3 direction. Enter 9 to 45 nucleotides. Use only A, C, G, and T. Remove any spaces, tabs, or line breaks. Probe 1 Enter the sequence in the 5 to 3 direction. Enter 9 to 45 nucleotides. Use only A, C, G, and T. Remove any spaces, tabs, or line breaks. Note: The probe for the first allele is labeled with VIC dye. Probe 2 Enter the sequence in the 5 to 3 orientation. Enter between 9 and 45 nucleotides. Use only A, C, G, and T. Remove any spaces, tabs, or line breaks. Note: The probe for the second allele is labeled with 6-FAM dye. Access the Custom TaqMan Assay Design Tool 1. Go to then navigate to the Custom TaqMan Assay Design Tool: a. Place the cursor over Products, then under Assay Searches, click TaqMan SNP Genotyping Assays. b. Click the Related Products tab, then in the Assay row, click Custom TaqMan SNP Genotyping Assays. c. In the Start Here box, click Custom TaqMan Assay Design Tool. OR Go directly to the Custom TaqMan Assay Design Tool web site: www5.appliedbiosystems.com/tools/cadt 35

42 Appendix A Order Other TaqMan Assays Enter custom primer/probe pairs 2. In the Custom TaqMan SNP Genotyping Assays section, click Enter Custom Primer/Probe Pairs. You will enter the sequences for the forward primer, reverse primer, and TaqMan MGB probes, then Applied Biosystems will synthesize the oligos and formulate a custom assay mix using your custom primer and probe sequences. Enter the sequences 1. Enter 4 to 10 characters for the Assay Name. 2. Enter 9 to 45 nucleotides (A, C, G, or T) for the Forward Primer sequence. 3. Enter 9 to 45 nucleotides (A, C, G, or T) for the Reverse Primer sequence. 4. Enter 9 to 45 nucleotides (A, C, G, or T) for the Probe 1 sequence. 5. Enter 9 to 45 nucleotides (A, C, G, or T) for the Probe 2 sequence. 6. (Optional) To enter more than one custom primer/probe pair, click + Add New Sequence, then repeat step 1 through step 5. Import sequence information from a file 1. Click Open/Import File. 2. (Optional) For information on how to format the file, click Custom TaqMan Genomic Assays Reordering Guidelines. 3. Click Browse to find the file. 4. Select the file, then click Open. 5. Click Import File. Check the format and submit your sequences After you finish entering custom primer/probe pairs, check the format of the sequences. 1. Click Check Format, then correct the sequence information as needed. 2. Click Submit. A confirmation message is displayed with an AB Workspace Batch ID. 3. Click Continue to proceed to the Select Assays page. (Optional) Save the sequence information in a file After you check the format, you can save the sequence information in a *.txt file. 1. Click Save File. 2. In the Save File dialog box, select a location for the file, enter a file name, then click Save. 36

43 Section A.1 Order Other TaqMan SNP Genotyping Assays Search for Pre-designed TaqMan SNP Genotyping Assays Search for Pre-designed TaqMan SNP Genotyping Assays Search the Applied Biosystems database for pre-designed Inventoried or Made-to- Order TaqMan Assays. To perform an Assay Search with complete search capabilities, place the cursor over Products, then under Assay Searches, click TaqMan SNP Genotyping Assays. Access the Custom TaqMan Assay Design Tool 1. Go to then navigate to the Custom TaqMan Assay Design Tool: a. Place the cursor over Products, then under Assay Searches, click TaqMan SNP Genotyping Assays. b. Click the Related Products tab, then in the Assay row, click Custom TaqMan SNP Genotyping Assays. c. In the Start Here box, click Custom TaqMan Assay Design Tool. OR Go directly to the Custom TaqMan Assay Design Tool web site: www5.appliedbiosystems.com/tools/cadt 2. To search the database for pre-designed Applied Biosystems Inventoried or Made-to-Order TaqMan SNP Genotyping Assays, click Search for Predesigned TaqMan SNP Genotyping Assays. Search for pre-designed assays 1. Enter the gene map location: a. Select the Species: Homo sapiens or Mus musculus b. Select the Chromosome. c. Enter the chromosome start (Chrom Start) and stop (Chrom Stop) locations. d. Click Submit. Go to step 3. OR Search the database for the gene: a. Select the Type: Keyword, Gene Name, Gene Symbol, Accession Number, Entrez Gene ID, Assay ID, rs Number, or Cytoband b. Select the Species from the dropdown list. c. Select the Criteria: Contains, Matches, Begins With, or Ends With d. Enter the Term to search. e. Click Submit. 2. Review the Search Results: 37

44 Appendix A Order Other TaqMan Assays Search for Pre-designed TaqMan SNP Genotyping Assays a. (Optional) Click the gene symbol to open the entry in Entrez Gene. b. Click Select for the gene of interest. 3. In the Select Assays tab, review the available pre-designed assays: In the Assays List: Click the Assay ID to view assay information in the Applied Biosystems Store. Click Save Results to save the assays list to a text file. In the Gene Map: Place the cursor over a TaqMan Assay to view a tooltip with the Assay ID and rs Number. Place the pointer over a SNP to view the tooltip that displays the rs Number. To zoom in, place the pointer on the gene map in the area you want to enlarge. Click-drag to create a box, then release when the box contains the desired viewing range. To zoom out, click the until the desired view is restored. 4. Select the assays to add to your Shopping List: In the Assays List: Select the Size from the Size dropdown list, enter the number of assays to order in the Qty field, then click Add to add individual assays to the Shopping List or click Add All to add all the assays in the assays list to the Shopping List. In the Gene Map: Click the TaqMan Assay in the Gene Map to add the assay to the Shopping List. Note: To remove the assay from the Shopping List: Click the selected assay in the Gene Map. Click next to the assay in the Shopping List. 5. (Optional) To search for controls and other products, click Next. 6. (Optional) To search for more assays, click Search Again, then repeat step 1 through step 5. Search Results In the Search tab, the Search Results table displays information about each gene that contains your search term(s). 38

45 Section A.1 Order Other TaqMan SNP Genotyping Assays Search for Pre-designed TaqMan SNP Genotyping Assays Click Save Results to save search results to a *.txt file Click the Gene Symbol to open the entry in Entrez Gene Click Select to view the Assays List and Gene Map Select Assays tab The Select Assays tab displays an Assays List and a Gene Map. Assays List The Assays List displays information about each available Pre-Designed TaqMan SNP Genotyping Assay, including the Assay ID, chromosome location, dbsnp ID, and availability (Made-to-Order or Inventoried). Click Save Results to save the search results in a text file Click the Assay ID to view assay information in the Applied Biosystems Store Click Add All to add all sequences to the Shopping List Click Add to add individual sequences to the Shopping List For the assays that you want to order, select the Size to order from the dropdown list Gene Map The Gene Map displays the available Pre-Designed TaqMan Genotyping Assays and the alignment of the TaqMan Assays with the identified SNPs. For predesigned TaqMan Assays, the graphic indicator represents the location of the TaqMan MGB probes. 39

46 Appendix A Order Other TaqMan Assays Search for Pre-designed TaqMan SNP Genotyping Assays View the chromosome location Place the pointer over an assay to view the Assay ID and rs Number Place the pointer over an SNP to view its rs Number Click to zoom out Click an assay to add it to the Shopping List 40

47 Section A.2 Section A.2 Order Other TaqMan Gene Expression Assays Enter custom primer/probe pairs Submit the sequences for the forward primer, reverse primer, and TaqMan MGB probe, then Applied Biosystems synthesizes the oligos and formulates a custom assay using your oligonucleotide sequences. Format requirements Field Requirement Assay Name Forward Primer Reverse Primer Enter 4 to 10 characters Enter the sequence in the 5 to 3 direction. Enter 9 to 45 nucleotides. Use only A, C, G, and T. Convert U to T. Remove any spaces, tabs, or line breaks. Enter the sequence in the 5 to 3 direction. Enter 9 to 45 nucleotides. Use only A, C, G, and T. Convert U to T. Remove any spaces, tabs, or line breaks. Probe 1 Enter the sequence in the 5 to 3 direction. Enter 9 to 45 nucleotides. Use only A, C, G, and T. Convert U to T. Remove any spaces, tabs, or line breaks. Note: The probe sequence must be for a TaqMan MGB probe. Access the Custom TaqMan Assay Design Tool 1. Go to then navigate to the Custom TaqMan Assay Design Tool: a. Place the cursor over Products, then under Assay Searches, click TaqMan Gene Expression Assays. b. Click the Related Products tab, then in the Assay row, click Custom TaqMan Gene Expression Assays. c. In the Start Here box, click Custom TaqMan Assay Design Tool. OR Go directly to the Custom TaqMan Assay Design Tool web site: www5.appliedbiosystems.com/tools/cadt 41

48 Appendix A Order Other TaqMan Assays Enter custom primer/probe pairs 2. In the Custom TaqMan Gene Expression Assays section, click Enter Custom Primer/Probe Pairs. You will enter the sequences for the forward primer, reverse primer, and TaqMan MGB probe labeled with FAM dye, then Applied Biosystems will synthesize the oligos and formulate a custom assay mix using your custom primer and probe sequences. Enter the sequences 1. Enter 4 to 10 characters for the Assay Name. 2. Enter 9 to 45 nucleotides (A, C, G, or T) for the Forward Primer sequence. 3. Enter 9 to 45 nucleotides (A, C, G, or T) for the Reverse Primer sequence. 4. Select and enter the information for the TaqMan MGB probe: a. Select the Dye (6-FAM). b. Enter 9 to 45 nucleotides (A, C, G, or T) for the Probe sequence. 5. (Optional) To enter more than one custom primer/probe pair, click + Add New Sequence, then repeat step 1 through step 4. Import sequence information from a file 1. Click Open/Import File. 2. (Optional) For information on how to format the file, click Custom TaqMan Genomic Assays Reordering Guidelines. 3. Click Browse to find the file. 4. Select the file, then click Open. 5. Click Import File. Check the format and submit your sequences After you finish entering custom primer/probe pairs, check the format of the sequences. 1. Click Check Format, then correct the sequence information as needed. 2. Click Submit. A confirmation message is displayed with an AB Workspace Batch ID. 3. Click Continue to proceed to the Select Assays page. (Optional) Save the sequence information in a file After you check the format, you can save the sequence information in a *.txt file. 1. Click Save File. 2. In the Save File dialog box, select a location for the file, enter a file name, then click Save. 42

49 Section A.2 Order Other TaqMan Gene Expression Assays Search for Pre-designed TaqMan Gene Expression Assays Search for Pre-designed TaqMan Gene Expression Assays Search the Applied Biosystems database for pre-designed Inventoried or Made-to- Order TaqMan Assays. To perform an Assay Search with complete search capabilities, place the cursor over Products, then under Assay Searches, click TaqMan Gene Expression Assays. Access the Custom TaqMan Assay Design Tool 1. Go to then navigate to the Custom TaqMan Assay Design Tool: a. Place the cursor over Products, then under Assay Searches, click TaqMan Gene Expression Assays. b. Click the Related Products tab, then in the Assay row, click Custom TaqMan Gene Expression Assays. c. In the Start Here box, click Custom TaqMan Assay Design Tool. OR Go directly to the Custom TaqMan Assay Design Tool web site: www5.appliedbiosystems.com/tools/cadt 2. To search the database for pre-designed Applied Biosystems Inventoried or Made-to-Order TaqMan Gene Expression Assays, click Search for Predesigned TaqMan Gene Expression Assays. Search for pre-designed assays Search the database for the gene: a. Select the Type: Keyword, Gene Name, Gene Symbol, Accession Number, Entrez Gene ID, or Assay ID b. Select the Species from the dropdown list. c. Select the Criteria: Contains, Matches, Begins With, or Ends With d. Enter the Term to search. e. Click Submit. Select the Type of search Select the Select the Species search Criteria Enter the Term to search Click Submit 1. Review the Search Results: a. (Optional) Click the gene symbol to open the entry in Entrez Gene. 43

50 Appendix A Order Other TaqMan Assays Search for Pre-designed TaqMan Gene Expression Assays b. Click Select for the gene of interest. 2. In the Select Assays tab, review the available pre-designed assays: In the Assays List: Click the Assay ID to view assay information in the Applied Biosystems Store. Click Save Results to save the assays list to a text file. In the Gene Map: Place the pointer over a transcript to highlight the corresponding TaqMan Assay Place the pointer over a TaqMan Assay to highlight the corresponding transcript and view the tooltip that displays the Assay ID For the Show GenBank mrnas checkbox, select the checkbox to show GenBank mrnas and the RefSeq mrnas. Deselect the checkbox to show only RefSeq mrnas To zoom in, place the pointer on the gene map in the area you want to enlarge. Click-drag to create a box, then release when the box contains the desired viewing range. To zoom out, click the until the desired view is restored. 3. Select the assays to add to your Shopping List: In the Assays List: Enter the number of assays to order in the Qty field, then click Add to add individual assays to the Shopping List or click Add All to add all the assays in the assays list to the Shopping List. In the Gene Map: Click the TaqMan Assay in the Gene Map to add the assay to the Shopping List. Note: To remove the assay from the Shopping List: Click the selected assay in the Gene Map. 44

51 Section A.2 Order Other TaqMan Gene Expression Assays Search for Pre-designed TaqMan Gene Expression Assays Click next to the assay in the Shopping List. 4. (Optional) To search for controls and other products, click Next. 5. (Optional) To search for more assays, click Search Again, then repeat step 1 through step 4. Search Results In the Search tab, the Search Results table displays information about each gene that contains your search term(s). Click Save Results to save search results to a *.txt file Click the Gene Symbol to open the entry in Entrez Gene Click Select to view the Assays List and Gene Map Select Assays tab The Select Assays tab displays an Assays List and a Gene Map. Assays List The Assays List displays information about each available Pre-Designed TaqMan Gene Expression Assay, including the Assay ID, Gene Symbol, Gene Name, species, availability (Made-to-Order or Inventoried), and Size. Click Save Results to save the search results in a text file Click the Assay ID to view assay information in the Applied Biosystems Store Click Add All to add all sequences to the Shopping List Click Add to add individual sequences to the Shopping List 45

52 Appendix A Order Other TaqMan Assays Search for Pre-designed TaqMan Gene Expression Assays Gene Map The Gene Map displays the location of the predesigned assays on the chromosome and the alignment of the Pre-Designed TaqMan Gene Expression Assays with the RefSeq mrnas and GenBank mrnas. For pre-designed TaqMan Assays, the graphic indicator represents the location of the TaqMan MGB probe. Click the assay to add it to the Shopping List View the chromosome location Click to zoom out Place the pointer over the transcript to highlight the corresponding TaqMan Assay Select to show GenBank mrnas and RefSeq mrnas Deselect to show only RefSeq mrnas 46

53 Appendix B Bioinformatics Tools for Evaluating Target Sequences This appendix gives detailed instructions for bioinformatics tools available for evaluating target sequences, as described earlier in this protocol. The following steps are covered: Verifying sequence uniqueness with a BLAST database search Finding exon information using the Entrez Gene database Finding exon information using the manually curated Vertebrate Genome Annotation database Masking sequence repeats Detecting and Masking nontarget sequence polymorphisms found in dbsnp 47

54 Appendix B Bioinformatics Tools for Evaluating Target Sequences Verify sequence uniqueness with a BLAST database search Verify sequence uniqueness with a BLAST database search Objectives for a BLAST database search Whether you have sequenced your target or obtained the sequence from a sequence database, you need to determine: If unique primers and probes can be generated for the sequence. Homologs in gene families can present a problem, as can orthologous sequences when you work in a transgenic system. If there are polymorphisms in the sequence of interest. To verify uniqueness, you search for regions of sequence similarity between the target sequences and databases of known sequences. To make your assay as specific as possible, you can mask regions of similarity before submitting your sequence for design, so they are not considered in the assay design. You can use BLAST, a sequence comparison algorithm and database searching program to search the NCBI nucleic acid and protein public databases. Run a BLAST database search 1. Go to and follow the instructions on the BLAST home page. Instructions on how to use the software are posted on the website. 2. Select nucleotide BLAST (blastn) to access the BLAST database search page. 3. In the Enter Query Sequence field on the BLAST database search page, enter the sequence in any of three formats: FASTA format >, followed by one description line, with the sequence on the following line Text-only sequence No numbers or nonsequence text Sequence identifiers Accession number, accession.version number, gi numbers or others For more information about these formats, go to: 4. Choose the appropriate database to search. For Gene Expression assays, if you search with a cdna sequence, search the default Human genomic + transcript database for human assays.for other species, click Others and specify the appropriate database. For SNP assays, search the default Human genomic + transcript database for human assays.for other species, click Others and specify the appropriate database. 5. In the Algorithm parameters section, you can: Filter species-specific repeats from a dropdown menu. Filter and mask low-complexity regions. 48

55 Appendix B Bioinformatics Tools for Evaluating Target Sequences Verify sequence uniqueness with a BLAST database search Enter the query sequence Select a database Filter low complexity regions and species-specific repeats Select masking 6. Click to submit your search. 7. Click Formatting Options. Wait for the results to be displayed. Evaluating BLAST database results There are three parts to BLAST database search results: Graphical overview List of matching sequences Sequence alignments 49

56 Appendix B Bioinformatics Tools for Evaluating Target Sequences Verify sequence uniqueness with a BLAST database search Graphical overview The graphical overview is a graphical representation of the database sequences that align to your query sequence, with the query sequence represented by the thick red numbered line at the top of the graph. Figure 1 Graphical representation of BLAST database search results List of matching sequences Matching sequences are listed from best to worst score. The top match is the best hit (which may be the sequence with which you queried the database). The link to the left of the sequence name opens the GenBank record for the sequence. This record contains the complete sequence, species information, journal references, feature descriptions, and other information. The Score indicates the degree of similarity between your sequence and the sequence to which it is being aligned. The higher the score is, the more similar the sequences are. 50

57 Appendix B Bioinformatics Tools for Evaluating Target Sequences Verify sequence uniqueness with a BLAST database search Figure 2 List of matching sequences in the results of a BLAST database search (shortened for display purposes) Each sequence alignment also has an E (Expect) value. The E value represents the number of hits you can expect to find by chance when searching a database of a particular size. The lower the E value, the more significant the match. Look for matches with E values of less than ~0.1; matches with larger E values can be ignored. You can go to the sequence alignment by clicking the Score link. Sequence alignments This section shows the alignments between your query sequence (Query) and each sequence (Sbjct) in the list of hits. You can use these alignments to help assess the degree of similarity. The Score and Expect values are displayed underneath the sequence identifiers. The number of bases aligned, percent identity, and the strand that was aligned to your query sequence and the database hit are shown. 51

58 Appendix B Bioinformatics Tools for Evaluating Target Sequences Verify sequence uniqueness with a BLAST database search Figure 3 Individual sequence alignment from the results of a BLAST database search 52

59 Appendix B Bioinformatics Tools for Evaluating Target Sequences Find exon-exon boundaries (gene expression assays only) Find exon-exon boundaries (gene expression assays only) For gene expression assays, you may use the exon-exon boundaries as the target position(s) in your submission file. Using the exon-exon boundaries as the target position excludes the detection of genomic DNA by the assay. For instructions on searching for exon-exon boundaries in the: Entrez Gene database, see the next section, Find exon information using the Entrez Gene database Genome Annotation database, see Find exon information using the Vertebrate Genome Annotation Database on page 56. Find exon information using the Entrez Gene database Entrez Gene is a searchable database of genes, from RefSeq genomes, defined by sequence and/or located in the NCBI Map Viewer. 1. Go to 2. In the list of available databases, click Gene. 3. In the Entrez Gene page, enter a gene name, symbol, or keyword, then click Go. 53

60 Appendix B Bioinformatics Tools for Evaluating Target Sequences Find exon-exon boundaries (gene expression assays only) 4. In the results list, click the gene name. 5. In the display list, select Gene Table. 6. Scroll to view the exon information, which includes the exon start and stop bases for the gene sequence. 54

61 Appendix B Bioinformatics Tools for Evaluating Target Sequences Find exon-exon boundaries (gene expression assays only) 7. From the exon-exon boundaries, select target positions. After you select one or more target positions, identify and mask any repeats ( Mask sequence repeats on page 59) and polymorphisms ( Detect and mask nontarget sequence polymorphisms on page 63). 55

62 Appendix B Bioinformatics Tools for Evaluating Target Sequences Find exon information using the Vertebrate Genome Annotation Database Find exon information using the Vertebrate Genome Annotation Database Search the Vertebrate Genome Annotation Database The Vertebrate Genome Annotation (Vega) is part of the Ensembl project. The Vega database is a collection of manually curated genome sequences. It includes information about exon locations. 1. Go to vega.sanger.ac.uk. 2. Select human, mouse, dog, or zebra fish as the species of interest. 3. At the top-right corner of the web page, in the field next to the Find dropdown list, enter a gene identifier, such as gene name, gene ID, or accession number, then click. 4. When the results are returned, click the link for the gene of interest. Information about the gene is displayed in a table in the Curated Locus Report. 5. In the Curated Locus Report, click Transcript info for the sequence of interest. 56

63 Appendix B Bioinformatics Tools for Evaluating Target Sequences Find exon information using the Vertebrate Genome Annotation Database In the Vega Transcript Report, the cdna sequence is displayed with the exons shown in alternating blue and black text. 57

64 Appendix B Bioinformatics Tools for Evaluating Target Sequences Find exon information using the Vertebrate Genome Annotation Database 6. From Show the following features, select one or more target positions (for gene expression assays), then click. 7. After you select targets, identify and mask any repeats and polymorphisms in your sequence (see the next section Mask sequence repeats ) and Detect and mask nontarget sequence polymorphisms on page 63). 58

65 Appendix B Bioinformatics Tools for Evaluating Target Sequences Mask sequence repeats Mask sequence repeats RepeatMasker is a program that screens DNA sequences for interspersed repeats and low complexity. The output is a detailed annotation of the repeats in the query sequence as well as a modified version of the query sequence in which all the annotated repeats have been masked. Sequence format requirements You can enter one sequence at a time or multiple sequences (in a batch). The format for the sequence should be: Note: FASTA format >, followed by one description line, with the sequence on the following line Note: RepeatMasker does not allow SNPs marked with brackets. If your sequence has SNPs, you must remove the brackets and convert the bases to the corresponding IUPAC ambiguity code before submitting the sequence to search. Procedure 1. Go to then under Services, click RepeatMasking. 2. In the web page that appears, enter your sequence into the form on the web page by: Copying and pasting your sequence or Uploading it from a file 59

66 Appendix B Bioinformatics Tools for Evaluating Target Sequences Mask sequence repeats 3. Select the appropriate source of your DNA from the DNA source list. Note: The default genome library is Human. Because interspersed repeats are species-specific, be sure to select the appropriate repeat library to search. 4. To display the results of the search in your web browser, select html for Return Format and Return Method. 5. Click Submit Sequence. Evaluate RepeatMasker results The RepeatMasker results are displayed as: A summary of the types of repeats found A table annotating the masked sequences The masked sequence Note: The results shown below are from the Web service RepeatMasker. 60

67 Appendix B Bioinformatics Tools for Evaluating Target Sequences Mask sequence repeats Examples of summary of the types of repeats found Example of a table annotating the masked sequences The masked sequence The search returns the submitted sequence with all low-complexity sequences replaced with Ns, so that the returned sequence is the same length as the original. 61

68 Appendix B Bioinformatics Tools for Evaluating Target Sequences Mask sequence repeats Figure 4 Masked sequence from the RepeatMasker Masked File You can copy the masked sequence directly from the results and use it for other searches or paste the masked sequence into the Custom TaqMan Assay Design Tool or into File Builder software. 62

69 Appendix B Bioinformatics Tools for Evaluating Target Sequences Detect and mask nontarget sequence polymorphisms Detect and mask nontarget sequence polymorphisms The dbsnp database is one of many repositories for both single-base nucleotide substitutions and short-deletion and insertion polymorphisms in human DNA. You can detect nontarget SNPs in your sequence by running a Blast search against the dbsnp database. To search for sequence polymorphisms in dbsnp: 1. Go to: 2. In the Program dropdown list, select blastn. 3. For Use Megablast, select Yes. 4. Choose the appropriate species. 5. In the query field, enter the masked sequence from RepeatMasker, in FASTA format. 6. Click Submit Query. 7. In the page that opens, specify the options for formatting your results. 8. Click View Report, then wait for the results to appear. Evaluating dbsnp BLAST database results The output is similar to BLAST database results described in Evaluating BLAST database results on page 49: a graphical display of matches to the query sequence, a list of sequences producing significant alignments to your query, and the actual sequence alignments. 63

70 Appendix B Bioinformatics Tools for Evaluating Target Sequences Detect and mask nontarget sequence polymorphisms The alignments from dbsnp are slightly different from those in the previous BLAST database search. In the dbsnp results, the matching bases in the sequence from the database are not shown. Only the mismatching bases or gaps are shown, in red text. Sequence alignment output from a BLAST database search of the dbsnp database Look for mismatches in the alignments to identify documented SNPs. Mask these SNPs in your target sequence by changing the bases to N so that no primer or probe is designed using the SNPs. If the mismatching bases in the sequence from the database ( Sbjct ) are A, C, G, T or N, the mismatch is simply a sequence mismatch, not a documented SNP. 64

71 Appendix C Using File Builder Software Overview About File Builder Software After qualifying your sequence of interest, you can format the sequence information in a submission file. When the submission file is formatted correctly, the Custom TaqMan Assays Service can use the file to design the applicable primers and probes. File Builder software is a wizard that guides you through the process of creating a submission file, minimizing your effort and ensuring that the file is correctly formatted. Workflow Using File Builder Software in the design and ordering process involves these procedures: 1. Create the submission file (page 66) 2. Validate the format (page 66) 3. Send the file to Applied Biosystems: Import the file into the Custom Assay Design Tool (page 70) Send the file using File Builder software (page 70) the file (page 71) or Send a copy of the file by regular or express mail (page 73) 65

72 Appendix C Using File Builder Software Create the submission file Create the submission file Obtain File Builder software Applied Biosystems supplies free software that helps you prepare and format your submission file and submit your order. To obtain File Builder software for Macintosh or Windows operating systems: 1. Go to 2. In the Software column, click the icon for the type of computer you are using, either PC or MAC. 3. After you save the software to your computer, double-click the File Builder icon and follow the instructions to install the program. Create the submission file 1. Start the File Builder software. 2. In the File Builder main menu, click Build New File using the Wizard, then follow the Wizard to create and save your submission file. Validate the format Validate the format Before you send the submission file, verify that your submission file is correctly formatted. 1. Start the File Builder software. 2. In the File Builder main menu, select Open/Validate an Existing File. Submission file contents Each submission file that you create must have: A header line One or more sequence record lines Submission file examples In the examples below, the header line and sequence records are labeled and the sequences are shortened for display purposes. 66

73 Appendix C Using File Builder Software Validate the format Example for SNP genotyping submission files Sequence records >John Smith part number smith@yoursnp.com seq_00001 AGT...GAA[A/G]CGGATAAGTGCACTC[G/T]CTG...ACC 1=s33g,2=s33t seq_00001 AGT...GAACGAGATAGGAAGCAAC[TC/CT]GAAT...CCC 1=sn1f seq_00002 GAG...TGGAGCAACA[TAGC/*]GCTTTCCGCAATT...TAC 1=34d Sequence name Header line Indel site Sequence SNP target site MNP site Target Example for gene expression submission files Sequence records Header line >John Smith part number smith@yourgx.com seq_ AGT...GAACGAGATAGGCAGCTCCTGCCCCATCC...AAG 13=m13,20=txyz seq_ TTA...CGGCCCTGAGGGGGACGAATCGAGTATCATTT...TCT 15=tryk seq_ TTA...CGGCCCTGAGGGGGACGAATCGAGTATCATTT...TCT ANY=ANY Sequence name Sequence Target Submission file format requirements The table below shows the format requirements for each element of a submission file. IMPORTANT! If the submission file is not formatted properly, the Custom TaqMan Assays Service cannot process your order. Table 1 Submission file format requirements Element Format requirements File Contains: A header line A sequence record for each assay Sequences for only one part number (only SNP assays or gene expression assays and only one scale) Header line Is the first line of the file Starts with a greater-than symbol (>) Has a name, a telephone number, one part number, and an address Has no more than 255 characters Has no letters with diacritics, such as umlauts or accents Ends with a carriage return 67

74 Appendix C Using File Builder Software Validate the format Table 1 Submission file format requirements (continued) Element Each sequence record Each sequence name Each sequence Each sequence (SNP genotyping assays) Each target (gene expression assays) Format requirements Exists as a single line Has a sequence name, a sequence, and at least one target Has only two spaces: one after the sequence name and one after the sequence Has no spaces within the record name, sequence, or target Ends with a carriage return Has no more than 10 characters Uses only alphanumeric, underscore, hyphen, and period characters Has no spaces or tabs Does not begin with a hyphen Is presented in the 5 to 3 orientation Has 61 to 5000 characters for gene expression sequences and 100 to 5000 characters for SNP assay sequences (at least 40 bases on either side of the SNP) Has no line numbering, spaces, tabs, or line breaks Consists of only the characters A, C, G, T, or N, except where SNP or indel target sites are marked SNP target site of interest: Is marked with square brackets Has the bases for two alleles of the SNP, separated by a forward slash MNP target site of interest: Is marked with square brackets Has 1 to 6 bases to the left of the forward slash and 1 to 6 bases to the right of the forward slash (The number of bases on each side of the slash does not have to be the same.) Indel target site of interest: Is marked with square brackets Has 1 to 6 bases to the left of a forward slash and an asterisk to the right of the forward slash Targets listed in 5' to 3' order if multiple targets are present Has: A target position, equals sign, and target site name A target position that indicates the base position of the target site from the 5 end A target site name with no more than four alphanumeric characters Commas to separate multiple targets No spaces or tabs No Ns within five bases of the target position Targets listed in 5' to 3' order if multiple targets are present IMPORTANT! At least one target is included in each sequence record. For sequences without specific target sites, you can use any for the target position and target name and the Custom TaqMan Assays Service will design the assay. 68

75 Appendix C Using File Builder Software Validate the format Table 1 Submission file format requirements (continued) Element Each SNP (SNP genotyping assays) Submission file Format requirements Has: A SNP number, equals sign, and name A target position that indicates the order of the SNP target site from the 5 end A SNP name with no more than four alphanumeric characters Commas to separate multiple sites Its sequence presented in 5 to 3 order No spaces or tabs No Ns within two bases of the SNP No other SNPs within two bases Is saved as a text-only document Has the extension.txt Has a file name with no more than 12 alphanumeric characters 69

76 Appendix C Using File Builder Software Send the sequence information to Applied Biosystems Send the sequence information to Applied Biosystems Ways to submit the file After you create your submission file and verify that it is formatted properly, send the submission file to Applied Biosystems: Import the file into the Custom TaqMan Assay Design Tool Send the file using File Builder software the file to Applied Biosystems or Send a copy of the file via regular or express mail Note: For volume discounts and predefined purchasing agreements, speak with your Applied Biosystems sales representative before submitting your order. Import the file into the Custom Assay Design Tool You can import the sequence information from the submission file into the Custom TaqMan Assay Design Tool. Using the tool, you can submit the imported sequence information for custom designs. To use the Custom TaqMan Assay Design Tool: See page 9 for Custom TaqMan SNP Genotyping Assays See page 21 for Custom TaqMan Gene Expression Assays Send the file using File Builder software You can use File Builder software to submit the file and place an order over the internet. You must have an account at the Applied Biosystems Store to place an order. For your convenience, the File Builder Software contains a link to the Applied Biosystems web site where you can create an account. 1. After you save your file in File Builder software, click Add Current File to Shopping Basket. 2. In the Applied Biosystems Store dialog box, enter your User ID and Password, then click OK to start the file upload and place the order in your shopping basket: 70

77 Appendix C Using File Builder Software Send the sequence information to Applied Biosystems Note: If you do not have an account, click the click here link in the dialog box. Your web browser opens the Applied Biosystems web site where you can create an account. Enter the required information, click Continue, then return to the Applied Biosystems Store dialog box in File Builder software. When the upload is complete, a message is displayed. 3. Click the link in the message to go to the Applied Biosystems Store. 4. In the Applied Biosystems Store, log in, navigate to the shopping basket, enter any required billing and contact information, then place the order. the file 1. Address the message: For orders to North America: genomics@appliedbiosystems.com For orders to Europe: assays.europe@appliedbiosystems.com For other regions, contact your local Applied Biosystems office or visit: 2. In the subject line, type Custom TaqMan Assay Order. 3. In the message body type the: Order information The submission file name and the part number listed in the header line of the submission file Note: If you are attaching more than one submission file, provide the submission file name and the corresponding part number for each file. Purchase order number or Credit card information Name as it appears on the card, the card number, and the expiration date Contact information Name, address, telephone number, and address of the person to contact if problems occur Shipping information Name, address (including room number, building, department, and the ATTN line), and telephone number of the person to receive shipment Invoice information Name, address, physical address, and telephone number of the purchasing agent or person to receive invoice details Note: To prevent delays, include all information in the message. 71

78 Appendix C Using File Builder Software Send the sequence information to Applied Biosystems 4. Add the submission file as an attachment to the order message. Note: Do not drag and drop submission files into the message. 5. Send the message. 72

79 Appendix C Using File Builder Software Send the sequence information to Applied Biosystems Send a copy of the file by regular or express mail 1. Prepare an order document containing: Order information The submission file name and the part number listed in the header line of the submission file Note: If you are sending more than one submission file, provide the submission file name and the corresponding part number for each file. Purchase order number or Credit card information Name as it appears on the card, the card number, and the expiration date Contact information Name, address, telephone number, and address of the person to contact if problems occur Shipping information Name, address (including room number, building, department, and the ATTN line), and telephone number of the person to receive shipment Invoice information Name, address, physical address, and telephone number of the purchasing agent or person to receive invoice details Note: To prevent delays, include all information in the message. 2. Print a copy of the order document. 3. Send the hard copy of your order document to the appropriate address: Location North America Europe Japan Address Applied Biosystems Attn: Genomic Assays (Order Administration) 850 Lincoln Centre Drive Foster City, CA Applera-UK Attn: Genomic Assays (Order Administration) Lingley House 120 Birchwood Boulevard Warrington, Cheshire WA3 7QH United Kingdom Applied Biosystems-Japan Attn: Genomic Assays (Order Administration) Hacchobori Chuo-ku, Tokyo Japan, Telephone Number Within UK: Outside UK: Other regions Contact your local Applied Biosystems office or visit 73

80 Appendix C Using File Builder Software Send the sequence information to Applied Biosystems 74

81 Appendix D Troubleshooting This appendix gives detailed instructions for determining the reason that an assay failed design or manufacturing. Assay failed design Gene Expression and SNP Genotyping Assays can fail design for two reasons: An input sequence is too short An input sequence is overmasked Short sequence The input sequence is too short for the software to place primers and probes for a good assay design. Low complexity sequences are short input sequences (example: CCTCCACTCCTCTCCACCTCTCC). Solution Extend the length of your input sequence to 150 bp both upstream and downstream of the target site if possible. The total sequence length should be approximately 300 bp. Overmasking The input sequence is overmasked and does not provide sufficient unmasked sequence for the software to place primers and probes for a good assay design. Solution If your input sequence has too many Ns because of masking with the RepeatMasker, extend the length of your input sequence or unmask those regions with less homology. 75

82 Appendix D Troubleshooting Assay failed manufacturing Assay failed manufacturing SNP genotyping assays If an SNP Genotyping Assay failed manufacturing, choose another nearby SNP. Search the dbsnp database To choose alternate SNPs for assays, select an SNP close in proximity to your original SNP. You can search the National Center for Biotechnology Information (NCBI) dbsnp database by chromosome and position to retrieve SNPs upstream and downstream from your original SNP. 1. Go to: 2. Click the Limits tab on the dbsnp search page. 3. Select the species and desired chromosome. 4. Enter the range of desired base positions in the search field. 76

83 Appendix D Troubleshooting Assay failed manufacturing Use SNPbrowser software Before you submit your sequence to Applied Biosystems for a custom design, use the alternate SNP IDs for your human or mouse targets to search the Applied Biosystems website for available predesigned TaqMan SNP Genotyping Assays. Use SNPbrowser Software for human assays Select human assays with the free SNPbrowser software: marketing.appliedbiosystems.com/mk/get/snpb_landing?isource=fr_e_rd_ www_allsnps_com_snpbrowser Search by chromosome and base range Visualize existing SNP assays in the target region Search by SNP or gene ID Figure 5 Search for SNPs by chromosome and base position in SNPbrowser For an introduction to the SNPbrowser software, refer to the Applied Biosystems product bulletin SNPbrowser Software v3.5: A Free Software Tool for the Knowledge-Driven Selection of SNP Genotyping Assays (Stock #127PB10-03). Use Mouse SNPbrowser Software for mouse assays Select mouse assays with the free Mouse SNPbrowser software: marketing.appliedbiosystems.com/mk/get/mousesnpbrowser_landi NG?isource=fr_E_www.allsnps.com/mousesnpbrowser_