TaqMan SNP Genotyping

Size: px

Start display at page:

Download "TaqMan SNP Genotyping"

Bethany Hamilton
6 years ago
Views:

1 TaqMan SNP Genotyping

2 What is Sickle-cell Anemia? Healthy Cells Hemoglobin Heme + 2 α & 2 β- globin molecules Heme binds O 2 2 Sickle-shaped cells Mutation causes hemoglobin to cluster together when O 2 is released RBC die early (stressed) anemia Sickle-shaped cells stick to side of walls of blood vessels, causing blockage and tissue death

3 Training Agenda What are SNPs? How can SNP genotyping be used in research? Sample-to-SNP Kit and other Chemistries How to search for assays and additional info How to design and order custom assays TaqMan OpenArray Genotyping System 3

4 What are SNPs? Mom Dad Diploid organisms 2 sets of chromosomes Each person has 2 copies or 2 alleles of each gene 1 allele on each chromosome. Each person receives 1 allele from each parent. If both alleles are the same, the person is homozygous for that gene. If the alleles differ, then the person is heterozygous for that gene. 4

5 Single Nucleotide Polymorphism A variant in the nucleotide sequence at a single base site. ATGCATGCATGCATGC TACGTACGTACGTACG ATGCATCCATGCATGC TACGTAGGTACGTACG Diploid Cell 5 A G/C SNP (heterozygous individual)

6 Three possible genotypes for a G/C SNP ATGCATGCATGCATGC TACGTACGTACGTACG ATGCATGCATGCATGC TACGTACGTACGTACG ATGCATCCATGCATGC TACGTAGGTACGTACG ATGCATGCATGCATGC TACGTACGTACGTACG ATGCATCCATGCATGC TACGTAGGTACGTACG ATGCATCCATGCATGC TACGTAGGTACGTACG 6

7 All about SNPs On average, SNPs occur in the human population more than 1 percent of the time (to be considered a SNP) About 3-5% of a person's DNA sequence codes for the production of proteins; most SNPs are found outside of "coding sequences SNPs found within a coding sequence are of particular interest to researchers because they are more likely to alter the biological function of a protein 7

8 All about SNPs What are the different types of SNPs? Synonymous (silent mutation) > Important in regulation (e.g., transcription factors) and gene splicing, but does not change the protein (polypeptide sequence remains the same) Non-synonymous > Will change the polypeptide sequence Coding > Most likely alter the biological function of a gene Non-coding Missense: encodes an amino acid change Nonsense: encodes an amino acid change to a stop codon > Does not alter the biological function of a gene, but may have a predictive value > Can change the amount of protein produced, if located in regulatory region Insertions / Deletions > May alter the ORF (open reading frame) 8

9 All about SNPs What are the different types of SNPs? 3 UTR > Have been shown to be targets of mirnas regulating gene expression Some in-silico analysis indicates a 3 UTR SNP may disrupt a mirna target site > Binding sites for proteins, that may affect the mrna's stability or location in the cell 5 UTR > Binding sites for proteins, that may affect the mrna's stability or translation > Sequences that promote the initiation of translation 9

10 All about SNPs What are the different types of SNPs? Transition substitution One purine (A or G) is substituted by the other Purine-pyrimidine axis is maintained Transversion substitution A purine is substituted by a pyrimidine and vice versa Pseudoautosomal XY SNP Region common to both X and Y chromosome that acts like an autosome, not like a sex chromosome Acceptor and donor splice site 10 Donor = 5' end splice site Acceptor = 3' end of splice site

11 How are SNPs discovered? Generally, by sequencing the same region of DNA from multiple individuals and uncovering sequence differences Indiv. #1: GTGCATTACAGGAAAACATGACCAGACATTACAGAC Indiv. #2: GTGCATTACAGGAAAACATGACCAGACATTACAGAC Indiv. #3: GTGCATTACAGGAAAACATGACCAGACATTACAGAC Indiv. #4: GTGCATTACAGGAAAACATGACCAGACATTACAGAC Indiv. #5: GTGCATTACAGGAAAATATGACCAGACATTACAGAC 11

12 How can SNPs be used in research? Population genetics Disease association > Association Study AgBio (trait selection in plant and livestock) Pathogen detection 12

13 How can SNPs be used in research? To create a genetic test that will screen for a disease in which the disease-causing gene has already been identified: Collect blood samples from a group of individuals affected by the disease and analyze their DNA for SNP patterns Compare these patterns to patterns obtained by analyzing the DNA from a group of individuals unaffected by the disease > This type of comparison, called an "association study", can detect differences between the SNP patterns of the two groups, thereby indicating which pattern is most likely associated with the disease-causing gene 13

robust populations of wild Pacific salmon Knowledge of when and where salmon are caught helps

14 SNPs A Great Catch for Salmon Genotyping Alaska Dept of Fish & Game (ADF&G) Track and forecast stock composition Assess environmental impacts Migration studies > Aims: to help fishery managers maintain robust populations of wild Pacific salmon Knowledge of when and where salmon are caught helps management Understand population locations > Manage fishing (open or close) > Adjust workflow at various hatcheries 14

5mil to > 40mil in the past 100 years SNP Genotyping Easy to standardize (simplify data comparison across labs)

15 SNPs A Great Catch for Salmon Genotyping Assess environmental impact Over-fishing, global climate change, disease in hatchery production Effects from mining, logging, damming and paving > Sockeye salmon have fluctuated from 0.5mil to > 40mil in the past 100 years SNP Genotyping Easy to standardize (simplify data comparison across labs) Finer-scale distinction between subpopulations Increased throughput (currently able to obtain 20K genotypes/day AR13-01

16 How to obtain good quality gdna A260/A280 Ratio of 1.7 to 1.9 Smaller ratios indicate organic contamination A260/A230 Ratio of 1.7 to 1.9 Lower ratios indicate the possibility of salts, solvents and alcohols Agarose Gel Single band Low salt elution buffers Concentrate samples in water, not in buffer 16

17 High quality genotyping data 17

18 Complete failure 18

19 How do I quantitate my gdna? NanoDrop Microplate reader RNase P relative quantitation (human) Using the TaqMan RNase P relative quantitation protocol 19

20 Trailing effect Poor DNA quality Pipetting error into the sample plate Uneven DNA quantitation across the sample plate Expired reagents PCR inhibitors 20

21 How does a TaqMan SNP Genotyping Assay work? Each assay is comprised of the following: Primers > (1) forward primer > (1) reverse primer Allele specific probes > (1) VIC labeled > (1) 6-FAM labeled 21

22 A note about hydrolysis probes and equilibrium Do both probes anneal to the template and get cleaved, even if it is not a perfect match? Yes, even though both probes anneal, there is an equilibrium that forms during the cycling where the perfectly matched probe binds with greater efficiency As a result, one may see signal from both probes on an amplification plot; however, the perfectly matched probe has a much greater signal 22

23 23 What chemistries and assays are available?

24 TaqMan Sample-to-SNP Kit Real-Time PCR DNA-ready samples in 5 minutes Data in under 1 hour using GTXpress Master Mix 24

25 TaqMan Sample-to-SNP Kit 25

26 How to use Real-Time PCR Combine TaqMan Master Mix*, TaqMan Genotyping Assay, DNA and Water 26 then add sample! It s that simple!!

27 Genotyping Master Mixes TaqMan GTXpress Master Mix Enables fast genotyping PCR in less than 50 minutes Delivers accurate genotyping results with robust performance Validated with all types of TaqMan Genotyping Assays available from Applied Biosystems Extended PCR cycling possible for poorly amplified or samplelimited reactions Contains a colored dye for easy tracking 27

28 Genotyping Master Mixes TaqMan Genotyping Master Mix Distinct clusters and high call rates for unambiguous allelic discrimination Validated with TaqMan SNP Genotyping Assays Excellent pre- and post-pcr stability for high throughput setup and analysis AmpliTaq Gold DNA Polymerase, UP (Ultra Pure) Automatic hot start enzyme designed to be active during thermal cycling and inactive at room temperature for easy reaction setup. Optimized mix components provide excellent specificity for discrimination between alleles Single thermal cycling condition for consistent results with TaqMan Assays 28

Genotyping Master Mixes TaqMan Universal PCR Master Mix, No AmpErase UNG Used with rapid assay development guidelines to minimize optimization time Enhanced performance to accommodate difficult

29 Genotyping Master Mixes TaqMan Universal PCR Master Mix, No AmpErase UNG Used with rapid assay development guidelines to minimize optimization time Enhanced performance to accommodate difficult G/C-rich sequences Contains AmpliTaq Gold DNA polymerase to provide a better yield and a more robust 5' nuclease assay than AmpliTaq DNA polymerase Optimized buffer components are proprietary buffer enhancements that add to the performance and reliability of the 5' nuclease assay 29

30 Current TaqMan SNP Genotyping Assays 4.5 million pre-designed assays for high-density, genome wide coverage pre-mixed at a 40x and 80x concentration - 160,000 validated assays with 20 million associated genotypes (Mapping SNPs) million HapMap SNPs providing 70% HapMap coverage - 70,000 coding SNP assays for the detection of SNPs within coding regions, including many putative functional SNPs - >2,600 Drug Metabolism assays for 220 drug metabolism and transporter genes 30

31 How do we test our assays? Validated Assays Validated assays are tested against four ethnic populations, consisting of 45 individuals for each population Minor allele frequencies are determined and published for each individual population tested. Validated assays have at least a minor allele frequency of 5% in one population Functionally Tested Assays for human studies are functionally tested. The function test consists of either 10 or 20 unique DNA samples comprised of a mixed ethnic population and both male and female representation. The functional test data are used to ensure that shipped assays meet minimum functionality criteria only. > Minor allele frequency is not calculated due to the small and mixed sample set used in the test. The functional test is similar to the test performed for the Custom TaqMan SNP Genotyping Assay Service. TaqMan Drug Metabolism Assay DME assays are tested against four ethnic populations, consisting of 45 individuals in each population. Validation data for Caucasian and African American populations have been performed in replicates. 31

32 TaqMan Mouse SNP Genotyping Assays > 10,000 SNP assays on 44 common pure strains (>470,000 genotypes) Ideal for numerous applications: Genetic mapping Genetic monitoring (e.g., QC) Speed congenics (transferring a genetic region of interest from one genetic background into a pure-strain background via successive backcrosses) 32

33 TaqMan Genotyping Assay Search 33

34 Enter Pre-Designed Oligos from Primer Express 34

35 How do we label the probes? AIF File Context Sequence CCCCGACTTCCGCAAGGCCTTCCAG[C/G]GACTGCTCTGCTGCGCGCGCAGGGC CAGCGCCTTCTTGCTGGCACCCAAT[A/G]GAAGCCATGCGCCGGACCACGACGT GTCATGGTCTGGAGTCTCGGAGTCC[A/G]GGCGATGGCCACGATGACCAGCAGG Design Strand Forward Forward Reverse = FAM = VIC AG[C/G]GA AT[A/G]GA CC[A/G]GG Regardless of the Design Strand, the context sequence shown in the AIF is always 3 to 5 35

36 What if AB doesn t have the assay I need? You can submit context sequence(s) to the Custom TaqMan Assay Design Tool 36

37 Pre-Designed Assays Custom Assays Repeat Masking SNP Masking Repeat Masking SNP Masking The customer prepares the sequence Assay Design Pipeline Genome QC Genome QC Assay Design Pipeline The customer submits the sequence 37

38 Obtain SNP Sequence from NCBI/dbSNP For sequence, search the dbsnp database by gene name, gene symbol, an individual rs number, or a particular section of a chromosome. Example: Search by gene symbol 38

39 Individual sequence record Information on molecule type and build Make sure the sequence was derived from genomic DNA, not cdna 39

40 Ideal Input Sequence Forward primer Probes Reverse Primer 100 bp 100 bp Good quality sequence For low-complexity sequence (see next slide), more sequence may be needed 40

41 Sequence determines primer and probe size GC-rich sequence: shorter primers and probes Forward primer Probes Reverse Primer 100 bp 100 bp Forward primer Probes Reverse Primer AT-rich sequence: longer primers and probes 41

42 Low-complexity Sequence Repetitive Sequence AATAATAT[A/T]ATATTTAAT AATAATAATAATTTATAATAAT AATATTTATATTAATAATAATA ATAAT Strings of a single nucleotide AAAAAA[A/T]AATCG eliminate with RepeatMasker (Caution: may overmask sequence) 42

43 SNP Masking Blast against dbsnp N-mask non-target SNP SNP Masking Go to the NCBI homepage ( and select BLAST form the menu bar. 43

detect additional SNPs Genome QC N-mask or delete homology N-mask

44 Bioinformatic assessment of input sequence 100 bp 100 bp BLAST / BLAT Search to detect homology in the genome BLAST Search to detect additional SNPs Genome QC N-mask or delete homology N-mask additional SNPs Format Sequence in File Builder or submit to CADT tool 44

45 Custom Assay Design Tool Assay Design Pipeline The new tool will accept File Builder formatted sequence and FASTA format. You will see immediately after the run if the sequence has passed design. 45

46 46 SNP genotyping tools to make life easier

Human SNPbrowser software Free software from ABI at www.allsnps.

47 Human SNPbrowser software Free software from ABI at Allows the visualization of SNP linkage disequilibrium and haplotype blocks in various populations, as well as of physical maps Chooses the optimal set of SNPs for association studies, based on user-set parameters 47

48 Mouse SNPbrowser software Free software from ABI at Facilitates the selection of SNP sets that will easily and accurately discriminate between strains of interest Ex.: user selects two strains and a genetic region of interest; Mouse SNPbrowser provides a list of common, informative SNPs Greatly reduces researcher s costs by helping to select the optimal set of SNPs for a given task 48

49 49

50 50 TaqMan OpenArray Genotyping System

51 How is this different from my Real-Time System? 98,304 reactions 64 assays X 1536 samples 32 OpenArray Plates Equivalent to 256, 384-well or 1034, 96-well plates 1 technician 1 day versus > 1 month 51

52 What comes with the OpenArray System? 52

53 What is an OpenArray TaqMan OpenArray Genotyping Plate 4 x 12 subarrays comprised of 8 x 8 through-holes Treated steel reaction plate > Surface = hydrophobic > Through-holes = hydrophilic ABC12 53

54 OpenArray Formats TaqMan SNP Genotyping Assays Number of Samples Minimum Ordering 16 X ** 32 X X X X X These are based on a 960 sample minimum (**based on a 1440 minimum) 54

55 OpenArray Workflow Customer orders TaqMan SNP Genotyping Assays Assays are spotted on the TaqMan OpenArrays ABI sends a kit with OpenArray loading materials and the spotted OpenArrays to your lab At Your Lab Load your samples with the TaqMan OpenArray Master Mix onto the OpenArrays 55 Cycle and image up to 32 OpenArrays in a single day Results!

56 What do I add to each well of a sample plate? TaqMan OpenArray Master Mix (2x) High Quality DNA Recommended 250 haploid copies of gdna per through-hole Reaction Components TaqMan OpenArray Master Mix (2x) Genomic DNA Total Volume per Well Volume 2.5µL 2.5µL 5.0µL 56

57 Once your samples are loaded, time to encase! 57

58 Time to thermal cycle and Image 58

59 Now we can look at the data in two views (point) View the results Modify clustering parameters Modify project files Publish data (optional) Perform downstream analysis Export data for analysis in AutoCaller 59

60 Now we can look at the data in two views (draw) View the results Modify clustering parameters Modify project files Publish data (optional) Perform downstream analysis Export data for analysis in AutoCaller 60

61 61 Questions??

62 Legal Statement Applied Biosystems, AB (Design) and VIC are registered trademarks and AutoCaller, FAM and SNPbrowser are trademarks of Applied Biosystems, a part of Life Technologies, or its subsidiaries in the US and/or certain other countries. MagMax, MELT, RecoverAll and Tri Reagent are trademarks of Ambion, Inc. or its subsidiaries in the US and/or certain other countries. TaqMan is a registered trademark of Roche Molecular Systems, Inc. All other trademarks are the sole property of their respective owners. Copyright Life Technologies. All rights reserved. 62

Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines

Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping