DEVELOPING WEB TOOLS FOR DATA MINING AND ANALYSIS OF SAGE
|
|
- Norma Brittany Townsend
- 5 years ago
- Views:
Transcription
1 DEVELOPING WEB TOOLS FOR DATA MINING AND ANALYSIS OF SAGE Kristin Wheeler BBSI, University of Pittsburgh Grambling State University Panayiotis Benos,Ph.d Center for Computational Biology & Bioinformatics University Of Pittsburgh
2 Abstract The novel techniques for studying the gene expression, like microarrays and SAGE, require new databases to store and exploit these data. Also, the need for tools to traverse and analyze the information has increased. UniGene is a collection of all currently known/predicted expressed sequences, including mrna of genes, ESTs and gene predictions. The focus of this project is to develop a web tool that will exploit this information and produce various SAGE tag sets according to user-specified criteria. This tool could be used for searching UniGene collection, or other gene expression datasets, for genes that match specific criteria. The search will return the name of the organism, the length of the sequence, and the position where the tag was found. Genomic information in this context gives a simplistic reference for gene expression patterns. We will test this tool on the human genome.
3 Introduction Gene expression is process that follows the synthesis of a protein from transcription through reverse transcriptase. Knowledge of this process has led to the development of several techniques for determining gene functionality. Most methods rely on either co-regulation or take a phylogenic approach to examine gene expression. An accurate analysis of data produced by these techniques is vital for molecular visualization, targeting binding sites, and defining biological pathways.
4 Serial Analysis of Gene Expression Technique that measures gene expression levels Produced a large quantity of transcripts from small biological samples Does not require prior transcript information. Resulting data represents absolute expression levels Has over 3,000,000 transcript tags in database SAGE data increases credibility when included in research Available via internet
5 Serial Analysis of Gene Expression Microdissection/cell purification Formation of defined position within each transcript by cleaveage with anchoring enzyme(nlaiii) Formation of ditags, followed bypcr amplification and concatermerization to facilitate sequencing Capture of poly-a RNA on oligo-dt beads and double-stranded cdna synthesis Release of SAGE tags after ligation to a linker with a IIS restriction enzyme site and cleavage with the tagging enzyme (usually BsnFl) Sequencing data analysis
6 My Project (SAGED) Delimiter Identifier # Set containing 1 members /gb=af /gi= /len=1113 >gnl UG Cre#S Chlamydomonas reinhardtii WD40-repeat-containing protein (Mut11) mrna, complete cds /cds=(1,1113) /gb=af /gi= /ug=cre.1 /len=1113 ATGGCGCGGGGCCCCGGTGACACGGACATGGACGAGGCCTCAGCCGACGCCGCCATCCCT TCCTCCACCCCCAACCCCACCGTTGCCTTCCGCTGCACGCACGCGCTCTCCGGCCACACC AAAGCGGTGGCCGCCGTCAAGTTCAGCCCCGACGGCTCGCTCCTCGCCTCCGGCTCCGCA GACCGCACCGTGGCCTTGTGGGATGCCGCCACGGGCGCCCGCGTTAACACACTCGCCGGG CACTCCTGCGGCGTGTCTGACGTGGCCTGGAACCCAAACGGTCGCTACCTCGCAACCGCC GCCGACGACCACAGCCTCAAGCTGTGGGATGCGGAGACCGGCGCCTGTCTGCGCACGCTG ACCGGCCACACCAACTACGTCTTCTGCTGCAACTTTGACGGCGCGGCTGGGCACCTGCTG GCCTCCGGCAGCTTCGACGAGACACTGCGGCTGTGGGATGTGCGCAGCGGGCGCTGCCTG CGGGAGGTGCCAGCGCACAGCGACCCAGTGACGTCGGCGGCCTTCAGCTACGACGGCAGC ATGGTCGTCACGAGCAGTCTGGACGGACTCATCCGGCTGTGGGACACTCAGACGGGCCAT TGCCTCAAGACGTTGTTCGACCGCGACTCACCGCCCGTGTCCTTCGCCGCCTTCACGCCC AACGCCAAGTACGTGCTGTGCAACACGCTGGACGGGCGCGCCAAGCTGTGGGACTACGCC GCCGGCCGCACCCGCCGCACCTACGCCGGCGGACACGTCAACACACAGTTCTGCATCAGC AGCGGCTTCCTCGGCGGCAGTAGCAGCGCCAGCTTCGATCTGGGCTGTAGCATGGTGGTG ACGGGCAGTGAGGACGGCAGCCTTGCGGCGTACGACATCTCGACGGGCCACGTGGTGGGT Cgcggggcggcggcggcggcagcggcggagggcggcggcgacgagggcagcgccgccgcc gcggcggcgggaggtgtggccggcgggcacacggcggcggtgctgtctgtgaatgtgcac CCCAGCGCGCCGCTGGTGGCCACGGGCGGGCACCACCCCGACAACAGCGTGCGGGTGTGG GCGGCGTCGCGCACAGAGCCAGCGGCCGCGTGA 10bp 3 most NlaIII
7 SAGED Species Sequence ID Tag position Sequence Length Cre#s
8 Conclusions The development of effective software/web tools to analyze SAGE data will aid in the progression of biological research. Perhaps with more time, a more effective algorithm, and efficient testing SAGED will become a common tool for the analysis of SAGE data.
9 References Velculescu VE, Vogelstein B, Kinzler KW. (2000) Analysing uncharted transcriptomes with SAGE. Trends Genet.vol.16,no. 10.p Flanagan, David. Java in a Nutshell. O Reilly & Associates, Inc. Cambridge, Qs,_Help,_and_Tutorials/Tutorials/
10 Acknowledgements Dr. Takis Benos Dr. Rajan Munshi BBSI NIH NSF Damione Moore Grambling State University
Chapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationSerial Analysis of Gene Expression
Serial Analysis of Gene Expression Cloning of Tissue-Specific Genes Using SAGE and a Novel Computational Substraction Approach. Genomic (2001) Hung-Jui Shih Outline of Presentation SAGE EST Article TPE
More informationDNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationGene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
More informationReverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
More informationMicroarrays: since we use probes we obviously must know the sequences we are looking at!
These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression
More informationDifferential gene expression. General Introduction. Overview (1) Biology Fundamentals - Genes
Differential gene expression General Introduction Overview (1) Reminder of biology Major steps in microarray analysis Microarray preparation design, clone/probe selection RNA extraction, hybridization
More informationBasics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationRecitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
More informationIn vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features
In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features Yiliang Ding, Yin Tang, Chun Kit Kwok, Yu Zhang, Philip C. Bevilacqua & Sarah M. Assmann (2014) Seminar RNA Bioinformatics
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationBENG 183 Trey Ideker The next generation
BENG 183 Trey Ideker The next generation Sequencing topics to be covered in today s lecture (1) Devils in the details: DNA preparation prior to sequencing Amplification: vectors or cycle sequencing PAGE
More informationThen, we went on to discuss genome expression and described: Microarrays
In the previous lecture, we have discussed: - classical sequencing methods - newer authomatic sequencing methods - solid-phase parallel sequencing - Next Generation mass-sequencing methods Then, we went
More informationAdvanced RNA-Seq course. Introduction. Peter-Bram t Hoen
Advanced RNA-Seq course Introduction Peter-Bram t Hoen Expression profiling DNA mrna protein Comprehensive RNA profiling possible: determine the abundance of all mrna molecules in a cell / tissue Expression
More informationGeneration of longer cdna fragments from serial analysis of gene expression tags for gene identification
Generation of longer cdna fragments from serial analysis of gene expression tags for gene identification Jian-Jun Chen, Janet D. Rowley, and San Ming Wang* Section of Hematology Oncology, University of
More informationRNA-Seq data analysis course September 7-9, 2015
RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationChapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
More information3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
More informationHigh-throughput Transcriptome analysis
High-throughput Transcriptome analysis CAGE and beyond Dr. Rimantas Kodzius, Singapore, A*STAR, IMCB rkodzius@imcb.a-star.edu.sg for KAUST 2008 Agenda 1. Current research - PhD work on discovery of new
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationMicroarrays & Gene Expression Analysis
Microarrays & Gene Expression Analysis Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE SBH Sequencing By Hybridization DNA Microarrays 1. Developed
More informationGenome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
More informationPolymerase chain reaction
Core course BMS361N Genetic Engineering Polymerase chain reaction Prof. Narkunaraja Shanmugam Dept. Of Biomedical Science School of Basic Medical Sciences Bharathidasan University The polymerase chain
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
More informationBi 8 Lecture 5. Ellen Rothenberg 19 January 2016
Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA
More informationSubtractive hybridization is a powerful technique particularly well-suited for the identification of target cdnas that correspond to rare
Subtractive hybridization is a powerful technique particularly well-suited for the identification of target cdnas that correspond to rare transcripts, that are expressed in one population but not in the
More informationRegulation of eukaryotic transcription:
Promoter definition by mass genome annotation data: in silico primer extension EMBNET course Bioinformatics of transcriptional regulation Jan 28 2008 Christoph Schmid Regulation of eukaryotic transcription:
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 February 15, 2013 Multiple choice questions (numbers in brackets indicate the number of correct answers) 1. Which of the following statements are not true Transcriptomes consist of mrnas Proteomes consist
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID myeloperoxidase MPO Human Myeloperoxidase (MPO) is a heme protein synthesized during
More information3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
More informationApplicazioni biotecnologiche
Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence
More informationBi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
More informationPartial list of differentially expressed genes from cdna microarray, comparing MUC18-
Supplemental Figure legends Table-1 Partial list of differentially expressed genes from cdna microarray, comparing MUC18- silenced and NT-transduced A375SM cells. Supplemental Figure 1 Effect of MUC-18
More informationIntro to RNA-seq. July 13, 2015
Intro to RNA-seq July 13, 2015 Goal of the course To be able to effectively design, and interpret genomic studies of gene expression. We will focus on RNA-seq, but the class will provide a foothold into
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID Glyceraldehyde-3-phosphate dehydrogenase Gapdh Rat This gene encodes a member of
More informationPrimePCR Assay Validation Report
Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the
More informationSideStep Lysis and Stabilization Buffer
SideStep Lysis and Stabilization Buffer INSTRUCTION MANUAL Catalog #400900 Revision B.0 For Research Use Only. Not for use in diagnostic procedures. 400900-12 LIMITED PRODUCT WARRANTY This warranty limits
More informationBootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
More informationApplied Bioinformatics - Lecture 16: Transcriptomics
Applied Bioinformatics - Lecture 16: Transcriptomics David Hendrix Oregon State University Feb 15th 2016 Transcriptomics High-throughput Sequencing (deep sequencing) High-throughput sequencing (also
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationPrimePCR Assay Validation Report
Gene Information Gene Name heat shock 10kDa protein 1 (chaperonin 10) Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HSPE1 Human This gene encodes a major
More informationhttps://de.wikipedia.org/wiki/operon Procaryotic Operon
2 Basics of Cloning https://de.wikipedia.org/wiki/operon Procaryotic Operon Promotor Operator ATG..TAA CDS Expression plasmid Required factors for protein expression Promoters Constitutive promoters Always
More informationA comparison of gene expression profiles produced by SAGE, long SAGE, and oligonucleotide chips
Genomics 84 (2004) 631 636 www.elsevier.com/locate/ygeno A comparison of gene expression profiles produced by SAGE, long SAGE, and oligonucleotide chips Jun Lu a, Anita Lal b, Barry Merriman c, Stan Nelson
More informationPrimePCR Assay Validation Report
Gene Information Gene Name integrin, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID ITGA1 Human This gene encodes the alpha 1 subunit of integrin
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationGene Finding Genome Annotation
Gene Finding Genome Annotation Gene finding is a cornerstone of genomic analysis Genome content and organization Differential expression analysis Epigenomics Population biology & evolution Medical genomics
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)
More informationPrimePCR Assay Validation Report
Gene Information Gene Name 3-hydroxybutyrate dehydrogenase, type 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID BDH1 Human This gene encodes a member of
More informationNCode mirna profiling. Sensitive, reproducible mirna profiling
Sensitive, reproducible mirna profiling Complete solutions for profiling mirna expression patterns Complete, optimized platform for mirna profiling Quick and efficient mirna expression analysis Superior
More informationApplied Biosystems SOLiD 3 Plus System. RNA Application Guide
Applied Biosystems SOLiD 3 Plus System RNA Application Guide For Research Use Use Only. Not intended for any animal or human therapeutic or diagnostic use. TRADEMARKS: Trademarks of Life Technologies Corporation
More informationConcerns About Unreliable Data from Spotted cdna Microarrays Due to Cross-Hybridization and Sequence Errors
Carnegie Mellon University Research Showcase @ CMU Department of Philosophy Dietrich College of Humanities and Social Sciences 10-2004 Concerns About Unreliable Data from Spotted cdna Microarrays Due to
More informationPrimePCR Assay Validation Report
Gene Information Gene Name keratin 78 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT78 Human This gene is a member of the type II keratin gene family
More informationPreparing normalized cdna libraries for transcriptome sequencing (Illumina HiSeq)
Preparing normalized cdna libraries for transcriptome sequencing (Illumina HiSeq) Last updated: Oct 28, 2016 Overview First-strand cdna is synthesized using oligo-dt containing primers and an RNA oligo
More informationQuiz Submissions Quiz 4
Quiz Submissions Quiz 4 Attempt 1 Written: Nov 1, 2015 17:35 Nov 1, 2015 22:19 Submission View Released: Nov 4, 2015 20:24 Question 1 0 / 1 point Three RNA polymerases synthesize most of the RNA present
More informationQuant Reverse Transcriptase
1. Quant Reverse Transcriptase For first-strand cdna synthesis and two-step RT-PCR www.tiangen.com RT080530 Kit Contents Quant Reverse Transcriptase Contents Cat. no. ER103 ER103-02 25 rxns ER103-03 50
More informationBiology 252 Nucleic Acid Methods
Fall 2015 Biology 252 Nucleic Acid Methods COURSE OUTLINE Prerequisites: One semester of college biology (BIO 101 or BIO 173) and one semester of college English (ENG 111); completion of CHM 111is recommended.
More informationTranscriptomics analysis with RNA seq: an overview Frederik Coppens
Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationRandom matrix analysis for gene co-expression experiments in cancer cells
Random matrix analysis for gene co-expression experiments in cancer cells OIST-iTHES-CTSR 2016 July 9 th, 2016 Ayumi KIKKAWA (MTPU, OIST) Introduction : What is co-expression of genes? There are 20~30k
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID caspase 9, apoptosis-related cysteine peptidase CASP9 Human This gene encodes a
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase
More informationPrimePCR Assay Validation Report
Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the
More informationPrimePCR Assay Validation Report
Gene Information Gene Name major histocompatibility complex, class II, DR beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HLA-DRB1 Human HLA-DRB1 belongs
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationSolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze
SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David
More informationEvaluation of the chicken transcriptome by SAGE of B cells and the DT40 cell line
Evaluation of the chicken transcriptome by SAGE of B cells and the DT40 cell line Matthias B. Wahl 1, 4#, Randy Caldwell 1#, Andrzej M. Kierzek 2, HiroshiArakawa 1, Nina Hubner 1, Christian Jung 1, Manuel
More informationSingle-Cell Whole Transcriptome Profiling With the SOLiD. System
APPLICATION NOTE Single-Cell Whole Transcriptome Profiling Single-Cell Whole Transcriptome Profiling With the SOLiD System Introduction The ability to study the expression patterns of an individual cell
More informationDirect RNA vs cdna sequencing of C. elegans transcriptome
Direct RNA vs cdna sequencing of C. elegans transcriptome Rachael Workman Timp Lab Johns Hopkins University Why compare direct RNA vs cdna sequencing? Many advantages to direct RNA: Poly-A profiling Modification
More informationThe Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica
The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database
More informationPLNT2530 (2018) Unit 6b Sequence Libraries
PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the
More informationFunctional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene
More informationPrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
More informationDNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.
DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this
More informationStudent Learning Outcomes (SLOS)
Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein kinase N1 PKN1 Human The protein encoded by this gene belongs to the protein
More informationMarker types. Potato Association of America Frederiction August 9, Allen Van Deynze
Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,
More informationPrimePCR Assay Validation Report
Gene Information Gene Name cytochrome P450, family 2, subfamily C, polypeptide 9 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID CYP2C9 Human This gene encodes
More informationTECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA
TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA Stranded, Illumina ready library construction in
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationPrimePCR Assay Validation Report
Gene Information Gene Name minichromosome maintenance complex component 8 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID MCM8 Human The protein encoded by
More informationIntroduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
More informationPrimePCR Assay Validation Report
Gene Information Gene Name keratin associated protein 9-2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRTAP9-2 Human This protein is a member of the keratin-associated
More informationmicrorna Shifra Ben-Dor March 2010
microrna Shifra Ben-Dor March 2010 Outline Biology of mirna Prediction of mirna mirna Databases Prediction of mirna Targets micrornas (mirna) Naturally expressed small RNAs Involved in regulation of target
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein phosphatase, Mg2+/Mn2+ dependent, 1A PPM1A Human The protein encoded by
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID mcf.2 transforming sequence-like Mcf2l Mouse Description Not Available C130040G20Rik,
More informationChapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi
Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated
More informationQIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
More informationPrimePCR Assay Validation Report
Gene Information Gene Name keratin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT3 Human The protein encoded by this gene is a member of the keratin
More informationGene expression analysis. Gene expression analysis. Total RNA. Rare and abundant transcripts. Expression levels. Transcriptional output of the genome
Gene expression analysis Gene expression analysis Biology of the transcriptome Observing the transcriptome Computational biology of gene expression sven.nelander@wlab.gu.se Recent examples Transcriptonal
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID PARK2 co-regulated PACRG Human This gene encodes a protein that is conserved across
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationExperimental Design. Dr. Matthew L. Settles. Genome Center University of California, Davis
Experimental Design Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu What is Differential Expression Differential expression analysis means taking normalized sequencing
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationAn introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy
An introduction to RNA-seq Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy The central dogma Genome = all DNA in an organism (genotype) Transcriptome = all RNA (molecular
More information