DEVELOPING WEB TOOLS FOR DATA MINING AND ANALYSIS OF SAGE

Size: px
Start display at page:

Download "DEVELOPING WEB TOOLS FOR DATA MINING AND ANALYSIS OF SAGE"

Transcription

1 DEVELOPING WEB TOOLS FOR DATA MINING AND ANALYSIS OF SAGE Kristin Wheeler BBSI, University of Pittsburgh Grambling State University Panayiotis Benos,Ph.d Center for Computational Biology & Bioinformatics University Of Pittsburgh

2 Abstract The novel techniques for studying the gene expression, like microarrays and SAGE, require new databases to store and exploit these data. Also, the need for tools to traverse and analyze the information has increased. UniGene is a collection of all currently known/predicted expressed sequences, including mrna of genes, ESTs and gene predictions. The focus of this project is to develop a web tool that will exploit this information and produce various SAGE tag sets according to user-specified criteria. This tool could be used for searching UniGene collection, or other gene expression datasets, for genes that match specific criteria. The search will return the name of the organism, the length of the sequence, and the position where the tag was found. Genomic information in this context gives a simplistic reference for gene expression patterns. We will test this tool on the human genome.

3 Introduction Gene expression is process that follows the synthesis of a protein from transcription through reverse transcriptase. Knowledge of this process has led to the development of several techniques for determining gene functionality. Most methods rely on either co-regulation or take a phylogenic approach to examine gene expression. An accurate analysis of data produced by these techniques is vital for molecular visualization, targeting binding sites, and defining biological pathways.

4 Serial Analysis of Gene Expression Technique that measures gene expression levels Produced a large quantity of transcripts from small biological samples Does not require prior transcript information. Resulting data represents absolute expression levels Has over 3,000,000 transcript tags in database SAGE data increases credibility when included in research Available via internet

5 Serial Analysis of Gene Expression Microdissection/cell purification Formation of defined position within each transcript by cleaveage with anchoring enzyme(nlaiii) Formation of ditags, followed bypcr amplification and concatermerization to facilitate sequencing Capture of poly-a RNA on oligo-dt beads and double-stranded cdna synthesis Release of SAGE tags after ligation to a linker with a IIS restriction enzyme site and cleavage with the tagging enzyme (usually BsnFl) Sequencing data analysis

6 My Project (SAGED) Delimiter Identifier # Set containing 1 members /gb=af /gi= /len=1113 >gnl UG Cre#S Chlamydomonas reinhardtii WD40-repeat-containing protein (Mut11) mrna, complete cds /cds=(1,1113) /gb=af /gi= /ug=cre.1 /len=1113 ATGGCGCGGGGCCCCGGTGACACGGACATGGACGAGGCCTCAGCCGACGCCGCCATCCCT TCCTCCACCCCCAACCCCACCGTTGCCTTCCGCTGCACGCACGCGCTCTCCGGCCACACC AAAGCGGTGGCCGCCGTCAAGTTCAGCCCCGACGGCTCGCTCCTCGCCTCCGGCTCCGCA GACCGCACCGTGGCCTTGTGGGATGCCGCCACGGGCGCCCGCGTTAACACACTCGCCGGG CACTCCTGCGGCGTGTCTGACGTGGCCTGGAACCCAAACGGTCGCTACCTCGCAACCGCC GCCGACGACCACAGCCTCAAGCTGTGGGATGCGGAGACCGGCGCCTGTCTGCGCACGCTG ACCGGCCACACCAACTACGTCTTCTGCTGCAACTTTGACGGCGCGGCTGGGCACCTGCTG GCCTCCGGCAGCTTCGACGAGACACTGCGGCTGTGGGATGTGCGCAGCGGGCGCTGCCTG CGGGAGGTGCCAGCGCACAGCGACCCAGTGACGTCGGCGGCCTTCAGCTACGACGGCAGC ATGGTCGTCACGAGCAGTCTGGACGGACTCATCCGGCTGTGGGACACTCAGACGGGCCAT TGCCTCAAGACGTTGTTCGACCGCGACTCACCGCCCGTGTCCTTCGCCGCCTTCACGCCC AACGCCAAGTACGTGCTGTGCAACACGCTGGACGGGCGCGCCAAGCTGTGGGACTACGCC GCCGGCCGCACCCGCCGCACCTACGCCGGCGGACACGTCAACACACAGTTCTGCATCAGC AGCGGCTTCCTCGGCGGCAGTAGCAGCGCCAGCTTCGATCTGGGCTGTAGCATGGTGGTG ACGGGCAGTGAGGACGGCAGCCTTGCGGCGTACGACATCTCGACGGGCCACGTGGTGGGT Cgcggggcggcggcggcggcagcggcggagggcggcggcgacgagggcagcgccgccgcc gcggcggcgggaggtgtggccggcgggcacacggcggcggtgctgtctgtgaatgtgcac CCCAGCGCGCCGCTGGTGGCCACGGGCGGGCACCACCCCGACAACAGCGTGCGGGTGTGG GCGGCGTCGCGCACAGAGCCAGCGGCCGCGTGA 10bp 3 most NlaIII

7 SAGED Species Sequence ID Tag position Sequence Length Cre#s

8 Conclusions The development of effective software/web tools to analyze SAGE data will aid in the progression of biological research. Perhaps with more time, a more effective algorithm, and efficient testing SAGED will become a common tool for the analysis of SAGE data.

9 References Velculescu VE, Vogelstein B, Kinzler KW. (2000) Analysing uncharted transcriptomes with SAGE. Trends Genet.vol.16,no. 10.p Flanagan, David. Java in a Nutshell. O Reilly & Associates, Inc. Cambridge, Qs,_Help,_and_Tutorials/Tutorials/

10 Acknowledgements Dr. Takis Benos Dr. Rajan Munshi BBSI NIH NSF Damione Moore Grambling State University

Chapter 1. from genomics to proteomics Ⅱ

Chapter 1. from genomics to proteomics Ⅱ Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more

More information

Serial Analysis of Gene Expression

Serial Analysis of Gene Expression Serial Analysis of Gene Expression Cloning of Tissue-Specific Genes Using SAGE and a Novel Computational Substraction Approach. Genomic (2001) Hung-Jui Shih Outline of Presentation SAGE EST Article TPE

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods

More information

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques

More information

Microarrays: since we use probes we obviously must know the sequences we are looking at!

Microarrays: since we use probes we obviously must know the sequences we are looking at! These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression

More information

Differential gene expression. General Introduction. Overview (1) Biology Fundamentals - Genes

Differential gene expression. General Introduction. Overview (1) Biology Fundamentals - Genes Differential gene expression General Introduction Overview (1) Reminder of biology Major steps in microarray analysis Microarray preparation design, clone/probe selection RNA extraction, hybridization

More information

Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility

Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility 2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

Recitation CHAPTER 9 DNA Technologies

Recitation CHAPTER 9 DNA Technologies Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown

More information

In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features

In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features Yiliang Ding, Yin Tang, Chun Kit Kwok, Yu Zhang, Philip C. Bevilacqua & Sarah M. Assmann (2014) Seminar RNA Bioinformatics

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

BENG 183 Trey Ideker The next generation

BENG 183 Trey Ideker The next generation BENG 183 Trey Ideker The next generation Sequencing topics to be covered in today s lecture (1) Devils in the details: DNA preparation prior to sequencing Amplification: vectors or cycle sequencing PAGE

More information

Then, we went on to discuss genome expression and described: Microarrays

Then, we went on to discuss genome expression and described: Microarrays In the previous lecture, we have discussed: - classical sequencing methods - newer authomatic sequencing methods - solid-phase parallel sequencing - Next Generation mass-sequencing methods Then, we went

More information

Advanced RNA-Seq course. Introduction. Peter-Bram t Hoen

Advanced RNA-Seq course. Introduction. Peter-Bram t Hoen Advanced RNA-Seq course Introduction Peter-Bram t Hoen Expression profiling DNA mrna protein Comprehensive RNA profiling possible: determine the abundance of all mrna molecules in a cell / tissue Expression

More information

Generation of longer cdna fragments from serial analysis of gene expression tags for gene identification

Generation of longer cdna fragments from serial analysis of gene expression tags for gene identification Generation of longer cdna fragments from serial analysis of gene expression tags for gene identification Jian-Jun Chen, Janet D. Rowley, and San Ming Wang* Section of Hematology Oncology, University of

More information

RNA-Seq data analysis course September 7-9, 2015

RNA-Seq data analysis course September 7-9, 2015 RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death

More information

3.1.4 DNA Microarray Technology

3.1.4 DNA Microarray Technology 3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns

More information

High-throughput Transcriptome analysis

High-throughput Transcriptome analysis High-throughput Transcriptome analysis CAGE and beyond Dr. Rimantas Kodzius, Singapore, A*STAR, IMCB rkodzius@imcb.a-star.edu.sg for KAUST 2008 Agenda 1. Current research - PhD work on discovery of new

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Microarrays & Gene Expression Analysis

Microarrays & Gene Expression Analysis Microarrays & Gene Expression Analysis Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE SBH Sequencing By Hybridization DNA Microarrays 1. Developed

More information

Genome annotation & EST

Genome annotation & EST Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary

More information

Polymerase chain reaction

Polymerase chain reaction Core course BMS361N Genetic Engineering Polymerase chain reaction Prof. Narkunaraja Shanmugam Dept. Of Biomedical Science School of Basic Medical Sciences Bharathidasan University The polymerase chain

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing

More information

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016 Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA

More information

Subtractive hybridization is a powerful technique particularly well-suited for the identification of target cdnas that correspond to rare

Subtractive hybridization is a powerful technique particularly well-suited for the identification of target cdnas that correspond to rare Subtractive hybridization is a powerful technique particularly well-suited for the identification of target cdnas that correspond to rare transcripts, that are expressed in one population but not in the

More information

Regulation of eukaryotic transcription:

Regulation of eukaryotic transcription: Promoter definition by mass genome annotation data: in silico primer extension EMBNET course Bioinformatics of transcriptional regulation Jan 28 2008 Christoph Schmid Regulation of eukaryotic transcription:

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 February 15, 2013 Multiple choice questions (numbers in brackets indicate the number of correct answers) 1. Which of the following statements are not true Transcriptomes consist of mrnas Proteomes consist

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID myeloperoxidase MPO Human Myeloperoxidase (MPO) is a heme protein synthesized during

More information

3'A C G A C C A G T A A A 5'

3'A C G A C C A G T A A A 5' AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of

More information

Applicazioni biotecnologiche

Applicazioni biotecnologiche Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence

More information

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8

Bi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8 Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically

More information

Partial list of differentially expressed genes from cdna microarray, comparing MUC18-

Partial list of differentially expressed genes from cdna microarray, comparing MUC18- Supplemental Figure legends Table-1 Partial list of differentially expressed genes from cdna microarray, comparing MUC18- silenced and NT-transduced A375SM cells. Supplemental Figure 1 Effect of MUC-18

More information

Intro to RNA-seq. July 13, 2015

Intro to RNA-seq. July 13, 2015 Intro to RNA-seq July 13, 2015 Goal of the course To be able to effectively design, and interpret genomic studies of gene expression. We will focus on RNA-seq, but the class will provide a foothold into

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID Glyceraldehyde-3-phosphate dehydrogenase Gapdh Rat This gene encodes a member of

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the

More information

SideStep Lysis and Stabilization Buffer

SideStep Lysis and Stabilization Buffer SideStep Lysis and Stabilization Buffer INSTRUCTION MANUAL Catalog #400900 Revision B.0 For Research Use Only. Not for use in diagnostic procedures. 400900-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

Bootcamp: Molecular Biology Techniques and Interpretation

Bootcamp: Molecular Biology Techniques and Interpretation Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing

More information

Applied Bioinformatics - Lecture 16: Transcriptomics

Applied Bioinformatics - Lecture 16: Transcriptomics Applied Bioinformatics - Lecture 16: Transcriptomics David Hendrix Oregon State University Feb 15th 2016 Transcriptomics High-throughput Sequencing (deep sequencing) High-throughput sequencing (also

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name heat shock 10kDa protein 1 (chaperonin 10) Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HSPE1 Human This gene encodes a major

More information

https://de.wikipedia.org/wiki/operon Procaryotic Operon

https://de.wikipedia.org/wiki/operon Procaryotic Operon 2 Basics of Cloning https://de.wikipedia.org/wiki/operon Procaryotic Operon Promotor Operator ATG..TAA CDS Expression plasmid Required factors for protein expression Promoters Constitutive promoters Always

More information

A comparison of gene expression profiles produced by SAGE, long SAGE, and oligonucleotide chips

A comparison of gene expression profiles produced by SAGE, long SAGE, and oligonucleotide chips Genomics 84 (2004) 631 636 www.elsevier.com/locate/ygeno A comparison of gene expression profiles produced by SAGE, long SAGE, and oligonucleotide chips Jun Lu a, Anita Lal b, Barry Merriman c, Stan Nelson

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name integrin, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID ITGA1 Human This gene encodes the alpha 1 subunit of integrin

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Gene Finding Genome Annotation

Gene Finding Genome Annotation Gene Finding Genome Annotation Gene finding is a cornerstone of genomic analysis Genome content and organization Differential expression analysis Epigenomics Population biology & evolution Medical genomics

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name 3-hydroxybutyrate dehydrogenase, type 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID BDH1 Human This gene encodes a member of

More information

NCode mirna profiling. Sensitive, reproducible mirna profiling

NCode mirna profiling. Sensitive, reproducible mirna profiling Sensitive, reproducible mirna profiling Complete solutions for profiling mirna expression patterns Complete, optimized platform for mirna profiling Quick and efficient mirna expression analysis Superior

More information

Applied Biosystems SOLiD 3 Plus System. RNA Application Guide

Applied Biosystems SOLiD 3 Plus System. RNA Application Guide Applied Biosystems SOLiD 3 Plus System RNA Application Guide For Research Use Use Only. Not intended for any animal or human therapeutic or diagnostic use. TRADEMARKS: Trademarks of Life Technologies Corporation

More information

Concerns About Unreliable Data from Spotted cdna Microarrays Due to Cross-Hybridization and Sequence Errors

Concerns About Unreliable Data from Spotted cdna Microarrays Due to Cross-Hybridization and Sequence Errors Carnegie Mellon University Research Showcase @ CMU Department of Philosophy Dietrich College of Humanities and Social Sciences 10-2004 Concerns About Unreliable Data from Spotted cdna Microarrays Due to

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name keratin 78 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT78 Human This gene is a member of the type II keratin gene family

More information

Preparing normalized cdna libraries for transcriptome sequencing (Illumina HiSeq)

Preparing normalized cdna libraries for transcriptome sequencing (Illumina HiSeq) Preparing normalized cdna libraries for transcriptome sequencing (Illumina HiSeq) Last updated: Oct 28, 2016 Overview First-strand cdna is synthesized using oligo-dt containing primers and an RNA oligo

More information

Quiz Submissions Quiz 4

Quiz Submissions Quiz 4 Quiz Submissions Quiz 4 Attempt 1 Written: Nov 1, 2015 17:35 Nov 1, 2015 22:19 Submission View Released: Nov 4, 2015 20:24 Question 1 0 / 1 point Three RNA polymerases synthesize most of the RNA present

More information

Quant Reverse Transcriptase

Quant Reverse Transcriptase 1. Quant Reverse Transcriptase For first-strand cdna synthesis and two-step RT-PCR www.tiangen.com RT080530 Kit Contents Quant Reverse Transcriptase Contents Cat. no. ER103 ER103-02 25 rxns ER103-03 50

More information

Biology 252 Nucleic Acid Methods

Biology 252 Nucleic Acid Methods Fall 2015 Biology 252 Nucleic Acid Methods COURSE OUTLINE Prerequisites: One semester of college biology (BIO 101 or BIO 173) and one semester of college English (ENG 111); completion of CHM 111is recommended.

More information

Transcriptomics analysis with RNA seq: an overview Frederik Coppens

Transcriptomics analysis with RNA seq: an overview Frederik Coppens Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

Random matrix analysis for gene co-expression experiments in cancer cells

Random matrix analysis for gene co-expression experiments in cancer cells Random matrix analysis for gene co-expression experiments in cancer cells OIST-iTHES-CTSR 2016 July 9 th, 2016 Ayumi KIKKAWA (MTPU, OIST) Introduction : What is co-expression of genes? There are 20~30k

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID caspase 9, apoptosis-related cysteine peptidase CASP9 Human This gene encodes a

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name major histocompatibility complex, class II, DR beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HLA-DRB1 Human HLA-DRB1 belongs

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David

More information

Evaluation of the chicken transcriptome by SAGE of B cells and the DT40 cell line

Evaluation of the chicken transcriptome by SAGE of B cells and the DT40 cell line Evaluation of the chicken transcriptome by SAGE of B cells and the DT40 cell line Matthias B. Wahl 1, 4#, Randy Caldwell 1#, Andrzej M. Kierzek 2, HiroshiArakawa 1, Nina Hubner 1, Christian Jung 1, Manuel

More information

Single-Cell Whole Transcriptome Profiling With the SOLiD. System

Single-Cell Whole Transcriptome Profiling With the SOLiD. System APPLICATION NOTE Single-Cell Whole Transcriptome Profiling Single-Cell Whole Transcriptome Profiling With the SOLiD System Introduction The ability to study the expression patterns of an individual cell

More information

Direct RNA vs cdna sequencing of C. elegans transcriptome

Direct RNA vs cdna sequencing of C. elegans transcriptome Direct RNA vs cdna sequencing of C. elegans transcriptome Rachael Workman Timp Lab Johns Hopkins University Why compare direct RNA vs cdna sequencing? Many advantages to direct RNA: Poly-A profiling Modification

More information

The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica

The Ensembl Database. Dott.ssa Inga Prokopenko. Corso di Genomica The Ensembl Database Dott.ssa Inga Prokopenko Corso di Genomica 1 www.ensembl.org Lecture 7.1 2 What is Ensembl? Public annotation of mammalian and other genomes Open source software Relational database

More information

PLNT2530 (2018) Unit 6b Sequence Libraries

PLNT2530 (2018) Unit 6b Sequence Libraries PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the

More information

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha

More information

DNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.

DNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this

More information

Student Learning Outcomes (SLOS)

Student Learning Outcomes (SLOS) Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein kinase N1 PKN1 Human The protein encoded by this gene belongs to the protein

More information

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name cytochrome P450, family 2, subfamily C, polypeptide 9 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID CYP2C9 Human This gene encodes

More information

TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA

TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA Stranded, Illumina ready library construction in

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name minichromosome maintenance complex component 8 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID MCM8 Human The protein encoded by

More information

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name keratin associated protein 9-2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRTAP9-2 Human This protein is a member of the keratin-associated

More information

microrna Shifra Ben-Dor March 2010

microrna Shifra Ben-Dor March 2010 microrna Shifra Ben-Dor March 2010 Outline Biology of mirna Prediction of mirna mirna Databases Prediction of mirna Targets micrornas (mirna) Naturally expressed small RNAs Involved in regulation of target

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein phosphatase, Mg2+/Mn2+ dependent, 1A PPM1A Human The protein encoded by

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID mcf.2 transforming sequence-like Mcf2l Mouse Description Not Available C130040G20Rik,

More information

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated

More information

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name keratin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT3 Human The protein encoded by this gene is a member of the keratin

More information

Gene expression analysis. Gene expression analysis. Total RNA. Rare and abundant transcripts. Expression levels. Transcriptional output of the genome

Gene expression analysis. Gene expression analysis. Total RNA. Rare and abundant transcripts. Expression levels. Transcriptional output of the genome Gene expression analysis Gene expression analysis Biology of the transcriptome Observing the transcriptome Computational biology of gene expression sven.nelander@wlab.gu.se Recent examples Transcriptonal

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID PARK2 co-regulated PACRG Human This gene encodes a protein that is conserved across

More information

Please purchase PDFcamp Printer on to remove this watermark. DNA microarray

Please purchase PDFcamp Printer on  to remove this watermark. DNA microarray DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of

More information

Experimental Design. Dr. Matthew L. Settles. Genome Center University of California, Davis

Experimental Design. Dr. Matthew L. Settles. Genome Center University of California, Davis Experimental Design Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu What is Differential Expression Differential expression analysis means taking normalized sequencing

More information

Videos. Lesson Overview. Fermentation

Videos. Lesson Overview. Fermentation Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

More information

An introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy

An introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy An introduction to RNA-seq Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy The central dogma Genome = all DNA in an organism (genotype) Transcriptome = all RNA (molecular

More information