Multiple choice questions (numbers in brackets indicate the number of correct answers)

Transcription

1 1 February 15, 2013 Multiple choice questions (numbers in brackets indicate the number of correct answers) 1. Which of the following statements are not true Transcriptomes consist of mrnas Proteomes consist of proteins The genetic code includes 3 termination codons DNA chips contain oligonucleotides Transcriptomes can be characterized by serial analysis of gene expression (SAGE) The yeast genome contains about 6000 genes RNA interference is not possible in prokaryotes Homologous recombination can be used to disrupt genes Transposons can be directed to disrupt specific genes A northern hybridization identifies genes that are transcribed Exon-intron boundaries can be easily located by a computer Open reading frames are only found in protein-coding genes Ribosomal RNAs are translated into proteins (3) 2. Protein-coding genes can be identified by Transposon tagging ORF scanning Zoo-blotting Nuclease S1 mapping (1) 3. The function of genes can be determined by Gene inactivation Homology search Exon trapping Zoo-blotting Northern analysis (2) 4. Dideoxynucleotides are used in PCR Southern hybridization Transformation Cloning DNA sequencing Culturing of bacteria (1)

2 2 5. Polypeptides Can fold into a double helix Can have a tertiary structure Can contain phosphate Can contain sulfur Consist of nucleotides Are synthesized in the nucleus (2) 6. Reporter genes Indicate the presence of stress conditions Are used to characterize proteomes Are all of bacterial origin Are used to delineate regulatory sequence elements Can often be detected by histochemical assays (2) 7. Microarrays Are used for analysis of transcriptomes Are made of glass Contain RNA sequences Contain DNA sequences Are smaller than DNA chips (2) 8. ORF scanning Is used to find exons Is used to find intergenic sequences Is used to find gene homologies Is used to find protein-coding genes (1) 9. Chromosome walking Is used in genetic mapping Can be used to close physical sequence gaps Occurs in mitosis Requires a genomic DNA library Can be done by PCR Is used in fluorescent in situ hybridization (FISH) (2) 10. A codon bias Is used in genome mapping Is found in intergenic regions Is found in functional RNAs Is not found in prokaryotes Is used to identify genes (1)

3 3 11. Expression of genes can be analyzed by Northern analysis Southern analysis Comparative genomics RNA interference (1) 12. Clone fingerprinting Is a cloning technique Identifies overlapping DNA sequences Is used in physical mapping of genomes Is used in sequence assembly (2) 13. Fluorescent in situ hybridization (FISH) requires deoxynucleotides requires a labeled probe is used in physical mapping of genomes is used in genetic mapping of genomes requires a DNA polymerase (2) 14. Genes can be altered or replaced by Transposon tagging RNA interference Homologous recombination (1) 15. An α-helix is a DNA structure is a protein structure winds to the left winds to the right is stabilized by hydrogen bonds is stabilized by disulfide bonds (3) 16. Ribosomal RNAs code for ribosomal proteins function in transcription of genes are the most abundant ribonucleic acids in cells are not found in mitochondria (1)

4 4 17. DNA is a polypeptide contains ribose contains guanine is always double-stranded is stabilized by base stacking (2) 18. Partial linkage was discovered in the eighteenth century was discovered by Gregor Mendel is used in physical mapping is only found for sequences that are on the same chromosome (1) 19. All template-dependent DNA polymerases use DNA as template synthesize DNA in 3 -> 5 direction require a primer to initiate DNA synthesis have also 5 -> 3 exonuclease activity (1) 20. β-sheets are stabilized by hydrophobic bonds ionic bonds hydrogen bonds covalent bonds all of the above none of the above (1) Total number of correct answers: 32 Try also to answer the multiple choice questions of chapters 1 to 5 in the Genomes 3 textbook. The answers to these questions can be found in a separate file (MCQ Chapters 1-9 Genomes3.pdf) in the Colloquia folder.

5 5 Home work (to copy and paste sequences and URLs please use the file that will be posted in the "Colloquia" folder on the MBV2010 web site) Annotating a genome sequence is mostly done by computers. Many of the annotation programs are freely available on the internet. Try to annotate the sequence below (5054 bp) from the chloroplast genome of the unicellular green alga Chlamydomonas reinhardtii. aaaaacacgccctgtaggaattgaacccacgacatcaggttttggaaacctgcgttctaccgactgaac taaggacgtaaaatttgttattataatttttatcatggtattattttaatgtcaatcagagtatttcac tacaaattgattttattgatatagttgttaatcatgggttaatttgtcttgaatttagtgattttatat taagggataccttgtagtgatatcccttaatataaaaacgaatatatatgtaactgcggtcaagctata gaccagttagagtaatacttatgcaagctacacaactaaaagatgaattccatattactaactattact ttcttgcgtttgtgtactatcacctactaaactagctcgactttctaataaacgttcttgtttactatc atgataactccaaacttgatttgtcatttctacaatactatgcattacttcatttgttgcaatttcatc agctaaaccataataaattgtttccattgcagttaaataaaaatcacgatctaaatcacgtaaaatttt atgtcttggtcggtacgttgataaagaataaatttctgctacatctaaacgaattttcataatttcttg actatcaatccaaatatctgaagcttgtccatttaaaccaccttcaggttggtgaatcatagtatgaca accttcagtaacataacgttcaccaattgtaccaccagctaaagctaaagaagcagcagatgcagctac acctaatgctaacgttaaagaacctgctttaataaattgtaaagcatcatgtacagtaataccattacc tacagaaccgccaaatgagttaataatcatgaacactttcttagattcttcttcttgaataacgcgttc tgtttgtttacgatataaagaacgacctgattcattatttaatgcaccttgatcaaggtaattataagc ttttaaagctttactattcgataatccaccagaacctaaacgttcttgaacataacgttgttttaaacg acgtcgacctaatgctttttcagacgaagctacaagcttttcagggctttgtaatctattcattaattc tttgtgtgataaattatcaattaatttttttgtaaaaggttggtttgtattttgtgtactagtttttaa tagtgaataaatttctgctaaattttgattagggtgttctaaattataattttgaggtgcaaaattagc taataatctaaatggagaatatacatctaaattttgttttacattttttgaccctgttgaaaaattttt tagattttttaaatttttaattaattttgtcatttcagcaggattttgaaaagcttgtttattcgcaga agatttagcaaaatttaaattagcagaatctttgtcttgattaggtgaaaaatctttagataaaatatc agctaaatagtataaataaggttcatcagaataatcaaaaaactgtgcgttccagtttaaccattccgt tgtaattttttgtaaagtatattgttctaacaggtgattttcttcaataccaaaatcattatctgaagt taataaatcttccacagattgacgttttgcactagcgccgccagataaattttctttttttactgtatc ttttccttttgtttttgcggtgccacttttaaataatccacttttttccatttcttttttttccaactc tttagaacgatcttccatatggatattaattaataaaccacaaatttggttacataattcatcatctaa atattgcattaaaaataccatacgacgacggaaaataaagttataaatatcagtccactgtgcaggtaa ttcttcaccccaacaataaataatacgaggtactccaatcggcataaattactttgttaataaaatgtt gtgttttattaatactagtctaatatcctagtagatagagcttttatttgcacgtaaataagctctgcg agtgctactgtaaaaattaaagtaccgtttacaggctcctttgaagcaaataaaaattttaaaccaaaa tggtttaaaaaatagataaattcaaacaaatattggctctacgttaaacttaaaatgccttcggccgga tttgaaccggcacgcctttcagcactggttcctaaaaccaggatgtctaccagttccatcacgaaggct aaaaaatattacttttataatatcatacttaattttttttgtctagttaaaaacactaaatgtgttaaa tgcatacacaattttttgtttagactagagacttggggttagttccgatcctttaaccagaatataact atggttaatttatagctaccccttatcaatgggccaacgggggatctggcagaaaccgccttgtcgaaa taaatagcacactcttgcatatctatattttaagatgtcagctttttgattcattgagttgtatatttt atttactttactagggtgtttatatattcctttttggggttgcccagatagttatataaccaatcacaa caacagtaaaaattgaagtttatttacccaaaggggtgtatcccctttgggtaaataaacttcaatggc caactgccttggaaacttacgtagcagcctaaaaaaagctagtcttatatccgaagcaagtaaaagaaa tggatattaaatattatagaggacctgaaataccttgtttacgaatcattaagaagtgcattaacatga aaacagctgttaaaagtggtaatacgaaagtgtgtaaactgtagaaacgtgttaaagttgcttgaccaa caccaacaccaccacgtaataactcaacaatgaaaccaccaacacctgggattgcatcaggaacacctg ttacaattttaaccgcccagtaaccaacttggtcccatggtaatgaataacctgttacaccaaaagaaa ctgtacatacagccatgattacacctgtaacccatgttaattcacgtggacgtttgaaaccacctgtta aatatacacggaaaacgtgtaaaaccatcataagaaccatcatactagctgaccaacggtgaattgaac gaattaaccaaccaaagttaacatcagtcataatgtattgtactgatgcgaaagcttctgctactgttg gacggtagtagaaagtcatagcaaaaccagtagctacttgcacaaggaaacatgtaaaagtaataccac caatacagtagaaaatatttacgtgtggtggaacatatttacttgtaatatcatcagcaattgcttgaa tttctaaacgttcttcaaaccaatcgtatactttactcatataaaatttttataagattgtgacatgac cattaggctttcttaagactaaaaaaatgtgtagcttaattatttaaagtttaaattaaagttataata

6 6 tatattatatataaaataaaaaaaacgttagtaattcaaaagttttaatattatacaattgaactatta tgtattaaatataagaatgtcacctcttaccatatttctatactccaaagtaactttttacataaatgt cccctctggggctgcctccttccccttccccttcggtatataaatatagggcaagtaaacttagcataa actttagttgcccgaaggggtttacatactccgaaggaggacaaatttatttattgtggtacaataaat aaattgtatgtaaacccctttcgggtaactaaagtttatcacggcaataagtttctgcttacgcagtat tatatctgacgcagtattatataagaagttggcaggataaaaatgtgtaagtatggcaatcttttaaaa tagtgttcaattcatttaaggcagataaaaagaaaaaagtccacaggatttaattttgaatagttctct atcaaaaaaaggtttgccgaacaatgtttttattcctggagtttgattttatgaaattagctgtttacg gaaaaggtggtattggaaaatcaacgacaagttgtaatatttcgattgctttacgaaaacgtggtaaaa aagtgttacaaattggttgtgatcctaaacatgatagtacttttacattgacagggtttttaattccaa ccattattgatacattaagttctaaagattatcattatgaagatatttggcccgaagatgttatttacg gaggttatgggggtgtagattgtgttgaagctggaggaccacctgccggtgcggggtgtggtggttatg ttgtaggtgaaacggtaaaacttttaaaagagttaaatgcttttttcgaatacgatgttattttatttg atgttttaggtgatgttgtttgtggtggctttgctgctccattaaactacgctgattattgtattattg taactgataatggttttgatgctttatttgctgcaaatcgtattgcagcttcagttcgtgaaaaagcac gtacacatccattgcgtttagcgggtttaatcggaaatcgtacatcaaaacgtgatttaattgataaat atgtagaagcttgtcctatgccagtattagaagttttaccattaattgaagaaattcgtatttcacgtg ttaaaggcaaaactttatttgaaatgtcaaataaaaataatatgacttcggctcatatggatggctcta aaggtgacaattctacagtaggagtgtcagaaactccatcggaagattatatttgtaatttttatttaa atattgctgatcaattattaacagaaccagaaggagttattccacgtgaattagcagataaagaacttt ttactcttttatcagatttctatcttaaaatttaataagaataaagcagctttaaatactttcctgttt ataatttaggaaattaaatggatatttgttgaaactaatccccagttggatacccattggtagttaatt gccactgcctgcttcaccttacaaaatgtatggacacaaaacggctaataaatacagactcccggtggc atttgttggctgcttcg Try to answer the following questions: 1. How many protein-coding genes are in the sequence? (you can use the following server to identify open reading frames: ) There are 3 coding regions in the sequence: #1 in 5'->3' frame 3 (coding for a protein of 302 aa) #2 in 3'->5' frame 2 (coding for a protein of 215 aa) #3 in 3'->5' frame 3 (coding for a protein of 524 aa) 2. Are the genes located on the same DNA strand? No. One gene is on the sequence shown, the other two genes are on the complementary strand. 3. What are the functions of the proteins encoded by the genes? (use the BLAST server (protein BLAST) to identify the function of the genes: S=blastp&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=bl asthome #1 is a protochlorophyllide reductase (involved in chlorophyll synthesis) #2 is cytochrome b6 (functions in the photosynthetic electron transport chain) #3 is the proteolytyic subunit of an ATP-dependent Clp protease (a serine protease)

7 7 4. Do the proteins contain any conserved domains that are also found in other proteins? Yes. All three proteins contain conserved domains that are also found in other proteins.