CPGR Services overview 2014

Size: px
Start display at page:

Download "CPGR Services overview 2014"

Transcription

1 CPGR Services overview 2014 Your gateway to Complete Genomics & Proteomics on the African continent!

2 SAMPLE PREPARATION Standardised protocols are available for: DNA isolation from Whole blood samples (fresh and stabilized) PBMC s Mammalian & human tissue Cell lines Plant tissue Saliva FFPE samples RNA isolation from Whole blood samples Blood, serum, PBMCs Cell lines Plant tissue Mammalian & human tissue Saliva FFPE samples mirna isolation from Plant tissue Blood, serum, PBMCs Cell lines Tissue culture supernatants Mammalian & human tissue Yeast Bacteria Depletion of blood, serum, plasma for itraq experiments Saliva FFPE samples Protein isolation from Plant tissue Blood, serum, Cell lines Tissue culture supernatants Mammalian & human tissue Yeast Bacteria Depletion of blood, serum, plasma for itraq experiments Whole blood fractions Isolation of PBMCs, serum and plasma from whole blood Whole genome Amplification of small amounts of DNA for downstream applications amplification 2 P a g e

3 GENOMICS Affymetrix cartridge arrays Assay Lab workflow Bioinformatics Output acgh Copy-number variation Copy number Analytical and LOH analysis on variation data QC high-density arrays Allele Specific report (SNP 6.0) LOH Analysis Gains and losses CHIP-on- Chip DNA methylation Exon expression Large-scale (to genome-wide) profiling of DNA (e.g. promoter) binding proteins Genome-wide detection of methylation patterns in the plant and animal kingdom Exon-specific RNA profiling for human, mouse and rat on high-density GeneChip arrays Support to be discussed with bioinformaticist Support to be discussed with bioinformaticist Gene level and alternative splicing analysis Analytical data QC Analytical data QC report Analytical Data QC Annotated gene lists for differentially expressed and alternatively spliced genes Gene expression Largest variety of eukaryotic and prokaryotic arrays mirna expression mirna expression analysis on high-density arrays Genotyping Genotyping / genome-wide association studies on SNP 6.0 arrays Data Quality assessment, normalization, data filtering, outlier identification. Differentially expressed annotated genes, clustering, gene set enrichment (GSE) analysis, classification Extract expressed mirna values Extract relevant species data Segmentation Analysis of detected segments Determination of abnormalities Analytical Data QC List of differentially expressed genes Analytical Data QC List of differentially expressed mirnas MicroRNA integration with gene expression Analytical Data QC Genotyping calls Annotated gains and losses 3 P a g e

4 DMET Plus Query 1,936 known ADME markers in a single GeneChip assay CytoScan HD Ultra-high density analysis of chromosomal aberrations, CNV and LOH Genotyping Call and copy number Generation of marker lists or pathways Genotyping, LOH, Copy number Copy number Analytical data QC Phenotype Star Allele Translation Analytical Data QC Genotyping Calls LOH Annotated Gains and Losses Phenotype Association Affymetrix GeneTitan arrays Assay Lab workflow Bioinformatics Output Gene expression profiling Genome-wide analysis and genotyping applications Exploration of gene expression profiles relating to important biological phenotypes such as disease or drug response in 16-, 24- and 96-well array formats Available for human, model and applied research organisms Population genetics, targeted genotyping (human) and markerassisted breeding (model and applied organisms) Custom arrays MyGeneChip Expression array plates for human and model and applied research organisms. Axiom mydesign Genotyping array plates genomic coverage tailored for human and agricultural populations, focussing on SNPs of interest Data Quality assessment, normalization, data filtering, outlier identification Differentially expressed annotated genes, clustering, gene set enrichment (GSE) analysis, classification SNP calls, single/multiple SNP association tests performed on allele, genotype, and dominant/recessive models To be discussed with bioinformaticist Analytical Data QC Annotated Gene lists Analytical Data QC Depending on application Analytical data QC report 4 P a g e

5 Next Generation Sequencing Assay Lab workflow Bioinformatics Output Microbial Genome Sequencing Whole genome de novo sequencing Whole genome sequencing Whole exome sequencing Sample Preparation (DNA) Library construction (single and paired end) High throughput sequencing on supported platforms viz. Ion Torrent, Roche 454 Junior, Illumina MiSeq Sample Preparation (DNA) Library construction (mate pair, single and paired end) High throughput sequencing on supported platforms viz. Roche 454 GS FLX, Illumina HiSeq 2000 and SOLiD 5500xl and for smaller genomes Illumina MiSeq Sample Preparation (DNA) Library construction (mate pair, single and paired end) High throughput sequencing on supported platforms viz. Roche 454 GS FLX, Illumina HiSeq 2000 and SOLiD 5500xl Sample Preparation (DNA) Experimental design support Read QC and data filtering Alignment to reference genome Consensus calling Annotation: ORF prediction, protein domain and sequence similarity search, gene ontology, metabolic pathway classification Experimental design support Read QC and data filtering Contig and scaffold building Assembly summary Customised annotation Experimental design support Read QC and data filtering Alignment to reference genome Consensus calling SNP calling, CNV, Indels, Quality scores and base coverage Genotyping Experimental design support Read QC and data Identification of structural features Data Visualisation Detailed analysis report EMBL files complete for ENSEMBL submission Raw sequence reads All data files Visualisation plots Custom analysis to address research question Detailed Analysis Data management Annotate known and novel variants Data files Visualisation plots Custom analysis to address research question Detailed Analysis Data management Identification of rare causal 5 P a g e

6 Whole transcriptome sequencing Sample enrichment Library construction (single and paired end) High throughput sequencing supported on the platforms Roche 454 GS FLX and Illumina HiSeq 2000 and SOLiD 5500xl Sample Preparation (RNA) Library construction (single and paired end) High throughput sequencing (Roche 454 GS FLX, Illumina HiSeq 2000, SOLiD 5500xl, Illumina MiSeq (small RNAseq) and Ion Torrent platforms) filtering Alignment to reference genome Consensus calling SNP calling, CNV, Indels, Quality scores and base coverage Genotyping Reference mapping De novo transcript assembly Isoform detection Quantification of transcripts SNP discovery Pathway Analysis Genotyping variants of Mendelian disorders Data files Visualisation plots Custom analysis to address research question Detailed Analysis Data management Expression profiling Co-expression clusters Variant detection Data files Visualisation Plots Detailed Analysis Data Management qrt-pcr Assay Lab workflow Bioinformatics Output Genotyping High-throughput (large sample over low gene number) TaqMan- based genotyping assays in 384 MTPs None Genotype clustering graphs to determine allelic discrimination qrt-pcr TLDA Compatibility High-throughput quantitative geneexpression profiling Pre-designed and custom TaqMan Low-Density Arrays (TLDA) for quantitative RNA profiling (e.g. cytokine expression) ABI, Superarray, Sybr Green, Roche qbaseplus (BioGazelle) qbaseplus (BioGazelle) Relative gene expression Relative gene expression Viral titres Determine titres of baculovirus stocks through Sybr Green assay None Relative abundance 6 P a g e

7 PROTEOMICS Mass spectrometry Instrumentation Q Exactive Thermo Fisher and Maldi Tof/Tof Absciex Assay Lab workflow Bioinformatics Output PMF Peptide Mass Fingerprinting Mascot Proteins (PMF) from samples digested either in solution or in gel slices. PMF confirmation can be provided via MS MS/MS analysis database searching identified Intact mass Intact protein masses can be determined for proteins and large peptides in the range m/z = A greater dynamic range is possible if the protein forms have multiple charges Sample Fractionation Simple and complex mixture protein identification Label based relative quantification Label free relative quantification Upstream fractionation of complex protein/peptide samples Samples fractionated by variety of methods including strong cation exchange chromatography, high ph reverse phase chromatography and 1 D SDS page Purified protein identification and identification of 100s to 1000s of proteins in complex whole tissue extractions Isobaric isotope labels that can be attached to peptides prior to LC- MS allowing relative (or absolute if an internal standard is available) quantitation of up to 8 protein samples Ideally suited for protein biomarker discovery with small sample sizes MS1 signal intensity used to quantify peptides/proteins Suited to biomarker discovery with large sample size (>8) None Molecular weight of intact proteins None Simplified fractions for MS analysis Mascot and Scaffold Power analysis to determine significant fold change threshold ProteinPilot & open source workflows Power analysis to determine significant fold change threshold Masoct, Sieve, Scaffold, open source Lists of identified proteins with confidence levels Relative abundance of proteins present in the sample Relative abundance of proteins present in the sample 7 P a g e

8 Phospho-proteome analysis Specific enrichment for phosphopeptides prior to LCMS Can be applied to both qualitative and quantitative analyses Data analysis In addition to the Mascot search algorithm data can also be analysed with the advanced ProteinPilot (AB SCiex) Paragon algorithm Data are also analysed using the Scaffold combining outputs into a single result output Protein QC/QA Quality control analysis for protein and peptide products can be developed to customers specifications. Protein purification Tailor made separation solutions can be developed according to customer needs. Protein extraction A variety of validated extraction protocols exists at the CPGR and new methods can be developed according to the customer s needs ProteinPilot & open source workflow s ProteinPilot & Scaffold Identity of phosphorylated proteins Identity of proteins and in the case of quantitative studies also relative abundance None Confirmation of sample integrity None Purified protein None Protein extracts suitable for MS analysis Protein microarrays Assay Lab workflow Bioinformatics Output Extract arrays Printing of crude or partially purified biological extracts for analysis of biological activity (e.g. antibody binding to immunogenic proteins) Protein arrays Arrays of purified single proteins in recombinant or natural form for protein-protein, protein-antibody or protein-molecule interaction Protein array printing Microarray hybridization Custom printing of a variety of protein array formats on a standard high- throughput QArray2 (Genetix) contact printer Standard protein hybridizations done in an automated processing and incubation station (Tecan HS 4800) in single, dual or quad format or in flexible 1-16 array-per slide formats (automated assays done in a Tecan HydroFlex) Scanning All scanning done in 4u microarray reader compatible with most existing microarray designs and formats as well as with arrays printed in 96 MTP None Printed microarrays suitable for use in capturing assays (e.g. antibody capturing) None Printed microarrays suitable for use in capturing assays (e.g. antibody capturing) None Printed microarrays suitable for use in capturing assays (e.g. antibody capturing) None Processed microarray slides ready for image acquisition Data acquisition and quality assessment TIFF files for data extraction and analysis 8 P a g e

9 formats Pin to pin and array to array normalisation Compatibility All Cy3 or Cy5 labelled analytes and detection antibodies; colorimetric assays and read-out also available BioPlex Assay Lab workflow Bioinformatics Output Antibody None assays Compatibility Multiplex bead-based sandwich immunoassays (typically 25 data-points per assay), e.g. for cytokine profiling BioRad, Luminex, Milliplex, R&D, Widescreen Relative determination of antigens in samples 9 P a g e

10 BIOINFORMATICS Analysis Supported platforms Workflows Data-analysis platforms Experimental design Microarray, protein array, itraq Study design recommendations such as replication, sample numbers, balancing and analysis considerations None RNA expression All existing microarray applications Data Quality assessment, normalization, data filtering, outlier identification; Differentially expressed annotated genes, clustering, gene set enrichment (GSE) analysis, classification Partek Genomics Suite SNP genotyping All existing microarrayand PCRbased applications SNP calls, single/multiple SNP association tests performed on allele, genotype, and dominant/recessive models. Partek Genomics Affymetrix console Qbase Copy-number variation (CNV) All suitable array-based applications Copy number variation (CNV) Allele Specific Copy Number LOH analysis Partek Genomics Affymetrix console Open source workflows Whole Genome Whole Exome Targeted DNA Sequencing Standard Sanger and highthroughput sequencers (454, SOLID, Solexa) Large-scale raw cdna sequence analysis, sequence clean-up, sequence contigs SignalP analysis, BLAST analysis De-novo sequencing, re-sequencing, targeted re-sequencing, micro-rna, RNA-seq, ChIp-Seq, gene expression Open source workflows Torrent Suite MiSec er Biological pathway analysis Cross-platform data integration Network relationship analysis Gene Ontology (GO) analysis, OMIM links, GEO Cross literature analysis from PubMed Biomarker discovery Ingenuity Pathway Analysis (IPA), Open source workflows 10 P a g e

11 CELL CULTURE Established cell culture assays (in single tube, 24- well and 96-well formats) Established screening assays All cell culture assays suitable for further indepth studies using Whole blood cell culture PBMCs HepG2 HepaRG All formats are suitable for stimulation as well as exposure (compound screening) assays. Please contact the CPGR for further information! Cytotoxicty by LDH & MTT Flow cytometry Genome-wide gene-/exon-expression analysis mirna expression analysis Genome-wide copy-number variation analysis Genome-wide methylation analysis qrt-pcr assays Luminex biomarker profiling Mass spectrometry based protein biomarker discovery RECOMBINANT PROTEIN EXPRESSION Baculovirus Expression System High-throughput sub-cloning into transfer vector containing expression purification tags Generation of recombinant bacmid DNA Generation of high titre viral stocks via transfection of insect cells with recombinant bacmid DNA Determination of virus titre using qpcr on the ABI 7900 Optimization of protein expression in insect cells in suspension Detection of protein expression with SDS-PAGE and Western Blot analysis Large scale protein expression and affinity purification QC of pure protein by Mass Spectrometry 11 P a g e

12 HUMAN CAPITAL DEVELOPMENT Internships Course/training type Description Outcome Technology Innovation Agency (TIA) Internship National Research Foundation (NRF) Internship Programmes The TIA internship programme is aimed at postgraduate MSc students training in bioinformatics, statistics, mathematics, biology or any relevant field The programme is eligible to South African citizens The National Research Foundation (NRF) internship programme targets undergraduate students specifically South African citizens Course/training type Description Outcome Mini Internship Programme (MIP) Knowledge Transfer Programme (KTP) Personal Development Programme (PDP) The MIP is a three months full time and six months part time programme aimed at postgraduate South African students. The pre-requisite to the programme is knowledge of a technology platform The Knowledge Transfer Programme (KTP) is an initiative to bring together experts and associates facilitated by a host institution to pursue specific projects with the aim of transferring knowledge in a natural and cost effective way. It targets postgraduates, postdoctoral and researchers The objective is to enable outstanding doctoral and post-doctorate graduates to further develop their research capabilities and to gain research experience, skills development in science and technology, attract and retain young scientists and professionals, support young scientists and professionals in basic and applied research In addition to the skills and knowledge acquired, at the end of the program interns are required to produce a technical report, poster and a presentation Interns are required to produce a technical report, poster and a presentation Production of a technical report, poster and presentation of the work done, knowledge and skills acquired is required The programme produces either a publication, patent or intellectual properties depending on the project. Industry ready post doctorate candidate, publications and patents 12 P a g e

13 Other training Course/training type Description Outcome Specialised Workshops Workshops in bioinformatics led by Training in cutting-edge omics international experts and targeted at life scientists, biologists, bioinformaticians, biostatisticians, physicists and computer scientists in academia and industry A typical workshop stretches over five technologies, tools/software/pipelines, methodologies, data analysis and advanced bioinformatics applications consecutive days. Theoretical knowledge and practical skills Certification awarded Online Training Free online training offered in Ingenuity Pathway Programme (IPA), available at System requirements: Internet connection, web browser, IPA registration Runs several times a year Wet-lab Training Wet-lab training is offered to biologists in the field of Genomics and Proteomics Courses are organised in collaboration with international experts or carried out by CPGR experts A variety of core and custom modules Live or pre-recorded Internationally recognized IPA certification awarded Software Licenses offered to scientists in South Africa Detailed knowledge of genomic and proteomic workflows, and practical skills Opportunity to work with your own samples and generate raw data sets 13 P a g e

14 ABOUT THE CPGR The CPGR is based on an initiative by the South African Department of Science and Technology (DST), and funded by the Technology Innovation Agency (TIA), to boost biotech innovation and to grow an internationally competitive bio-economy in South Africa. The organisation was created in 2006 with a vision of establishing a modern, world-class facility that serves the needs of the scientific community in South Africa by providing state-of-the-art services, technical expertise and collaborative research capabilities in the high throughput genomics and proteomics sectors. CONTACT Specific Area Genomics Proteomics Bioinformatics Human Capital Development (HCD) General Contact info@cpgr.org.za info@cpgr.org.za bioinformatics@cpgr.org.za hcd@cpgr.org.za info@cpgr.org.za General Upper Level, St Peter s Mall Cnr Anzio Road & Lower Main Road Observatory Cape Town 7925 South Africa tel: fax: www: blog: 14 P a g e

15 15 P a g e

CPGR Services Your gateway to Complete Genomics & Proteomics on the African continent!

CPGR Services Your gateway to Complete Genomics & Proteomics on the African continent! CPGR Services 2016 Your gateway to Complete Genomics & Proteomics on the African continent! GENOMICS Affymetrix cartridge arrays Assay Lab workflow Data Analysis Output CHIP-on-Chip Large-scale (to genomewide)

More information

Services Your gateway to Complete Genomics & Proteomics on the African continent!

Services Your gateway to Complete Genomics & Proteomics on the African continent! Services 2016 Your gateway to Complete Genomics & Proteomics on the African continent! The CPGR is a specialist not-for-profit contract research organization established in South Africa through funding

More information

Capabilities & Services

Capabilities & Services Capabilities & Services Accelerating Research & Development Table of Contents Introduction to DHMRI 3 Services and Capabilites: Genomics 4 Proteomics & Protein Characterization 5 Metabolomics 6 In Vitro

More information

Redefine what s possible with the Axiom Genotyping Solution

Redefine what s possible with the Axiom Genotyping Solution Redefine what s possible with the Axiom Genotyping Solution From discovery to translation on a single platform The Axiom Genotyping Solution enables enhanced genotyping studies to accelerate your research

More information

Pioneering Clinical Omics

Pioneering Clinical Omics Pioneering Clinical Omics Clinical Genomics Strand NGS An analysis tool for data generated by cutting-edge Next Generation Sequencing(NGS) instruments. Strand NGS enables read alignment and analysis of

More information

The first and only fully-integrated microarray instrument for hands-free array processing

The first and only fully-integrated microarray instrument for hands-free array processing The first and only fully-integrated microarray instrument for hands-free array processing GeneTitan Instrument Transform your lab with a GeneTitan Instrument and experience the unparalleled power of streamlining

More information

Development of quantitative targeted RNA-seq methodology for use in differential gene expression

Development of quantitative targeted RNA-seq methodology for use in differential gene expression Development of quantitative targeted RNA-seq methodology for use in differential gene expression Dr. Jens Winter, Market Development Group Biological Biological Research Content EMEA QIAGEN Universal Workflows

More information

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative

More information

Gene expression microarrays and assays. Because your results can t wait

Gene expression microarrays and assays. Because your results can t wait Gene expression microarrays and assays Because your results can t wait A simple path from data to decision-making The power of expression microarrays Transcriptome-wide analysis can be complex. Matching

More information

Axiom Biobank Genotyping Solution

Axiom Biobank Genotyping Solution TCCGGCAACTGTA AGTTACATCCAG G T ATCGGCATACCA C AGTTAATACCAG A Axiom Biobank Genotyping Solution The power of discovery is in the design GWAS has evolved why and how? More than 2,000 genetic loci have been

More information

Deep Sequencing technologies

Deep Sequencing technologies Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

CytoScan. Join the Resolution Revolution

CytoScan. Join the Resolution Revolution CytoScan Join the Resolution Revolution CytoScan HD Cytogenetics Solution designed by cytogeneticists for cytogeneticists Traditional cytogenetics techniques such as karyotyping and fluorescent in situ

More information

Computing with large data sets

Computing with large data sets Computing with large data sets Richard Bonneau, spring 2009 Lecture 14 (week 8): genomics 1 Central dogma Gene expression DNA RNA Protein v22.0480: computing with data, Richard Bonneau Lecture 14 places

More information

Agilent Genomics Software Future Directions

Agilent Genomics Software Future Directions Agilent Genomics Software Future Directions Michael Rosenberg, PhD Director, Genomics Software Agilent: A Focused Measurement Company Serving Diverse End Markets Electronic Measurement 2008 Revenue: $3.6

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

Contact us for more information and a quotation

Contact us for more information and a quotation GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

IMGM Laboratories GmbH. Sales Manager

IMGM Laboratories GmbH. Sales Manager IMGM Laboratories GmbH Dr. Jennifer K. Kuhn Sales Manager About IMGM Laboratories IMGM Laboratories was founded in 2001 IMGM operates as professional provider of advanced genomic services from research

More information

About Strand NGS. Strand Genomics, Inc All rights reserved.

About Strand NGS. Strand Genomics, Inc All rights reserved. About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES ABOUT T H E N E W YOR K G E NOM E C E N T E R NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. Through

More information

Matthew Tinning Australian Genome Research Facility. July 2012

Matthew Tinning Australian Genome Research Facility. July 2012 Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909

More information

Measuring and Understanding Gene Expression

Measuring and Understanding Gene Expression Measuring and Understanding Gene Expression Dr. Lars Eijssen Dept. Of Bioinformatics BiGCaT Sciences programme 2014 Why are genes interesting? TRANSCRIPTION Genome Genomics Transcriptome Transcriptomics

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

More information

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary

More information

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.

DNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel. DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private

More information

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance

More information

Research Powered by Agilent s GeneSpring

Research Powered by Agilent s GeneSpring Research Powered by Agilent s GeneSpring Agilent Technologies, Inc. Carolina Livi, Bioinformatics Segment Manager Research Powered by GeneSpring Topics GeneSpring (GS) platform New features in GS 13 What

More information

High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays

High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays High Cross-Platform Genotyping Concordance of Axiom High-Density Microarrays and Eureka Low-Density Targeted NGS Assays Ali Pirani and Mohini A Patil ISAG July 2017 The world leader in serving science

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

Introduction to RNA-Seq in GeneSpring NGS Software

Introduction to RNA-Seq in GeneSpring NGS Software Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,

More information

GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS. Genomics Solutions Portfolio

GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS. Genomics Solutions Portfolio GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS Genomics Solutions Portfolio WORKFLOW SOLUTIONS FROM EXTRACTION TO ANALYSIS Application-based answers for every step of your workflow Scientists

More information

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer.

Proteomics And Cancer Biomarker Discovery. Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar. Overview. Cancer. Proteomics And Cancer Biomarker Discovery Dr. Zahid Khan Institute of chemical Sciences (ICS) University of Peshawar Overview Proteomics Cancer Aims Tools Data Base search Challenges Summary 1 Overview

More information

GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS. Genomics Solutions Portfolio

GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS. Genomics Solutions Portfolio GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS Genomics Solutions Portfolio WORKFLOW SOLUTIONS FROM EXTRACTION TO ANALYSIS Application-based answers for every step of your workflow Scientists

More information

Microbial Metabolism Systems Microbiology

Microbial Metabolism Systems Microbiology 1 Microbial Metabolism Systems Microbiology Ching-Tsan Huang ( 黃慶璨 ) Office: Agronomy Hall, Room 111 Tel: (02) 33664454 E-mail: cthuang@ntu.edu.tw MIT OCW Systems Microbiology aims to integrate basic biological

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Improving Productivity with Applied Biosystems GPS Explorer

Improving Productivity with Applied Biosystems GPS Explorer Product Bulletin TOF MS Improving Productivity with Applied Biosystems GPS Explorer Software Purpose GPS Explorer Software is the application layer software for the Applied Biosystems 4700 Proteomics Discovery

More information

02 Agenda Item 03 Agenda Item

02 Agenda Item 03 Agenda Item 01 Agenda Item 02 Agenda Item 03 Agenda Item SOLiD 3 System: Applications Overview April 12th, 2010 Jennifer Stover Field Application Specialist - SOLiD Applications Workflow for SOLiD Application Application

More information

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS. !! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

Surely Better Target Enrichment from Sample to Sequencer

Surely Better Target Enrichment from Sample to Sequencer sureselect TARGET ENRICHMENT solutions Surely Better Target Enrichment from Sample to Sequencer Agilent s market leading SureSelect platform provides a complete portfolio of catalog to custom products,

More information

Overcome limitations with RNA-Seq

Overcome limitations with RNA-Seq Buyer s Guide Simple, customized RNA-Seq workflows Evaluating options for next-generation RNA sequencing Overcome limitations with RNA-Seq Next-generation sequencing (NGS) has revolutionized the study

More information

Bioinformatics Advice on Experimental Design

Bioinformatics Advice on Experimental Design Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics

More information

Sequencing and PCR. Training: Ion S5 and S5 XL Systems workflow training

Sequencing and PCR. Training: Ion S5 and S5 XL Systems workflow training Training: Ion S5 and S5 XL Systems workflow training This interactive course focuses on the Ion S5 and Ion S5 XL Systems operation and the Ion AmpliSeq workflow on the Ion Chef System for sequencing. The

More information

BR-10455A. Automated Multiplexed Gene Expression Profiling Process Solutions. Multiplex Quantitative High-throughput

BR-10455A. Automated Multiplexed Gene Expression Profiling Process Solutions. Multiplex Quantitative High-throughput BR-10455A Automated Multiplexed Gene Expression Profiling Process Solutions Multiplex Quantitative High-throughput As a scientist, you understand the challenges of working with limited amounts of sample,

More information

RNA-Seq data analysis course September 7-9, 2015

RNA-Seq data analysis course September 7-9, 2015 RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive

More information

Applications and Uses. (adapted from Roche RealTime PCR Application Manual)

Applications and Uses. (adapted from Roche RealTime PCR Application Manual) What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it

More information

Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility

Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility 2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,

More information

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene

More information

TREE CODE PRODUCT BROCHURE

TREE CODE PRODUCT BROCHURE TREE CODE PRODUCT BROCHURE Single Molecule, Real-Time (SMRT) Sequencing technology offers: Long read sequencing ~10 Gb with 20 kb average read lengths for WGS ~20 Gb with 40 kb average read length for

More information

Exploring of microrna markers for body fluid identification using NGS

Exploring of microrna markers for body fluid identification using NGS Exploring of microrna markers for body fluid identification using NGS Zheng Wang, Yiping Hou Institute of Forensic Medicine Sichuan University, China Barcelona May, 11, 2016 Outline Introduction of Institute

More information

WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS)

WELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) WELCOME Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) Director, UB Genomics and Bioinformatics Core (GBC) o o o o o o o o o o o o Grow

More information

High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center

High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina Still-imaging of clusters (~1000

More information

Introducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight

Introducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight Introducing QIAseq Accelerate your NGS performance through Sample to Insight solutions Sample to Insight From Sample to Insight let QIAGEN enhance your NGS-based research High-throughput next-generation

More information

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s

More information

Sample to Insight. Dr. Bhagyashree S. Birla NGS Field Application Scientist

Sample to Insight. Dr. Bhagyashree S. Birla NGS Field Application Scientist Dr. Bhagyashree S. Birla NGS Field Application Scientist bhagyashree.birla@qiagen.com NGS spans a broad range of applications DNA Applications Human ID Liquid biopsy Biomarker discovery Inherited and somatic

More information

Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service. Dr. Ruth Burton Product Manager

Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service. Dr. Ruth Burton Product Manager Introducing combined CGH and SNP arrays for cancer characterisation and a unique next-generation sequencing service Dr. Ruth Burton Product Manager Today s agenda Introduction CytoSure arrays and analysis

More information

Proteomics and some of its Mass Spectrometric Applications

Proteomics and some of its Mass Spectrometric Applications Proteomics and some of its Mass Spectrometric Applications What? Large scale screening of proteins, their expression, modifications and interactions by using high-throughput approaches 2 1 Why? The number

More information

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11 Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the

More information

Novel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.

Novel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART

More information

Develop Better Assays for Every Human Protein

Develop Better Assays for Every Human Protein Develop Better Assays for Every Human Protein OriGene overview Application of transfected over-expression lysates Application of purified recombinant human proteins About OriGene Started in1996 with the

More information

Illumina s Suite of Targeted Resequencing Solutions

Illumina s Suite of Targeted Resequencing Solutions Illumina s Suite of Targeted Resequencing Solutions Colin Baron Sr. Product Manager Sequencing Applications 2011 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,

More information

Agrigenomics Genotyping Solutions. Easy, flexible, automated solutions to accelerate your genomic selection and breeding programs

Agrigenomics Genotyping Solutions. Easy, flexible, automated solutions to accelerate your genomic selection and breeding programs Agrigenomics Genotyping Solutions Easy, flexible, automated solutions to accelerate your genomic selection and breeding programs Agrigenomics genotyping solutions A single platform for every phase of your

More information

Surely Better Target Enrichment from Sample to Sequencer and Analysis

Surely Better Target Enrichment from Sample to Sequencer and Analysis sureselect TARGET ENRIChment solutions Surely Better Target Enrichment from Sample to Sequencer and Analysis Agilent s market leading SureSelect platform provides a complete portfolio of catalog to custom

More information

Ion S5 and Ion S5 XL Systems

Ion S5 and Ion S5 XL Systems Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5

More information

Genome annotation & EST

Genome annotation & EST Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary

More information

ChIP-seq and RNA-seq. Farhat Habib

ChIP-seq and RNA-seq. Farhat Habib ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions

More information

CM581A2: NEXT GENERATION SEQUENCING PLATFORMS AND LIBRARY GENERATION

CM581A2: NEXT GENERATION SEQUENCING PLATFORMS AND LIBRARY GENERATION CM581A2: NEXT GENERATION SEQUENCING PLATFORMS AND LIBRARY GENERATION Fall 2015 Instructors: Coordinator: Carol Wilusz, Associate Professor MIP, CMB Instructor: Dan Sloan, Assistant Professor, Biology,

More information

TRANSCRIPTOME SEQUENCING. RNA sequencing solutions. Simple, fast, and affordable. PG1595-PJT1209-COL11768-Ion-RNA-Expressions-Updates-Global.

TRANSCRIPTOME SEQUENCING. RNA sequencing solutions. Simple, fast, and affordable. PG1595-PJT1209-COL11768-Ion-RNA-Expressions-Updates-Global. TRANSCRIPTOME SEQUENCING RNA sequencing solutions Simple, fast, affordable PG1595-PJT1209-COL11768-Ion-RNA-Expressions-Updates-Global.indd 1 Sequencing for every lab, every budget, every application Transcriptome

More information

solid S Y S T E M s e q u e n c i n g See the Difference Discover the Quality Genome

solid S Y S T E M s e q u e n c i n g See the Difference Discover the Quality Genome solid S Y S T E M s e q u e n c i n g See the Difference Discover the Quality Genome See the Difference With a commitment to your peace of mind, Life Technologies provides a portfolio of robust and scalable

More information

Frequently asked questions

Frequently asked questions Frequently asked questions Affymetrix Mouse Diversity Genotyping Array The Affymetrix Mouse Diversity Genotyping Array features more than 623,000 single nucleotide polymorphisms (SNPs) and more than 916,000

More information

FirePlex mirna Assay. Multiplex microrna profiling from low sample inputs

FirePlex mirna Assay. Multiplex microrna profiling from low sample inputs FirePlex mirna Assay Multiplex microrna profiling from low sample inputs Abstract We introduce a new assay for multiplex microrna (mirna) discovery and verification that enables simultaneous profiling

More information

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio

More information

Ingenuity Pathway Analysis (IPA )

Ingenuity Pathway Analysis (IPA ) Ingenuity Pathway Analysis (IPA ) For the analysis and interpretation of omics data IPA is a web-based software application for the analysis, integration, and interpretation of data derived from omics

More information

Plant Breeding and Agri Genomics. Team Genotypic 24 November 2012

Plant Breeding and Agri Genomics. Team Genotypic 24 November 2012 Plant Breeding and Agri Genomics Team Genotypic 24 November 2012 Genotypic Family: The Best Genomics Experts Under One Roof 10 PhDs and 78 MSc MTech BTech ABOUT US! Genotypic is a Genomics company, which

More information

Understanding the science and technology of whole genome sequencing

Understanding the science and technology of whole genome sequencing Understanding the science and technology of whole genome sequencing Dag Undlien Department of Medical Genetics Oslo University Hospital University of Oslo and The Norwegian Sequencing Centre d.e.undlien@medisin.uio.no

More information

Ion S5 and Ion S5 XL Systems

Ion S5 and Ion S5 XL Systems Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5

More information

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods

More information

Course Agenda. Day One

Course Agenda. Day One Course Agenda BioImmersion: Biotech for the Non-Scientist A three-day, in-depth course that provides the background required for understanding today s fast-paced biotech marketplace. Beginning with an

More information

Workflows and Pipelines for NGS analysis: Lessons from proteomics

Workflows and Pipelines for NGS analysis: Lessons from proteomics Workflows and Pipelines for NGS analysis: Lessons from proteomics Conference on Applying NGS in Basic research Health care and Agriculture 11 th Sep 2014 Debasis Dash Where are the protein coding genes

More information

Reads to Discovery. Visualize Annotate Discover. Small DNA-Seq ChIP-Seq Methyl-Seq. MeDIP-Seq. RNA-Seq. RNA-Seq.

Reads to Discovery. Visualize Annotate Discover. Small DNA-Seq ChIP-Seq Methyl-Seq. MeDIP-Seq. RNA-Seq. RNA-Seq. Reads to Discovery RNA-Seq Small DNA-Seq ChIP-Seq Methyl-Seq RNA-Seq MeDIP-Seq www.strand-ngs.com Analyze Visualize Annotate Discover Data Import Alignment Vendor Platforms: Illumina Ion Torrent Roche

More information

Agilent GeneSpring GX 10: Beyond. Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008

Agilent GeneSpring GX 10: Beyond. Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008 Agilent GeneSpring GX 10: Gene Expression and Beyond Pam Tangvoranuntakul Product Manager, GeneSpring October 1, 2008 GeneSpring GX 10 in the News Our Goals for GeneSpring GX 10 Goal 1: Bring back GeneSpring

More information

Bioinformatics. Dick de Ridder. Tuinbouw Digitaal, 12/11/15

Bioinformatics. Dick de Ridder. Tuinbouw Digitaal, 12/11/15 Bioinformatics Dick de Ridder Tuinbouw Digitaal, 12/11/15 Bioinformatics is not Bioinformatics is also not Bioinformatics Bioinformatics (2) Bioinformatics (3) US National Institutes of Health (NIH): Bioinformatics:

More information

Single Cell Genomics

Single Cell Genomics Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell

More information

DNA concentration and purity were initially measured by NanoDrop 2000 and verified on Qubit 2.0 Fluorometer.

DNA concentration and purity were initially measured by NanoDrop 2000 and verified on Qubit 2.0 Fluorometer. DNA Preparation and QC Extraction DNA was extracted from whole blood or flash frozen post-mortem tissue using a DNA mini kit (QIAmp #51104 and QIAmp#51404, respectively) following the manufacturer s recommendations.

More information

Massive Analysis of cdna Ends for simultaneous Genotyping and Transcription Profiling in High Throughput

Massive Analysis of cdna Ends for simultaneous Genotyping and Transcription Profiling in High Throughput Next Generation (Sequencing) Tools for Nucleotide-Based Information Massive Analysis of cdna Ends for simultaneous Genotyping and Transcription Profiling in High Throughput Björn Rotter, PhD GenXPro GmbH,

More information

scgem Workflow Experimental Design Single cell DNA methylation primer design

scgem Workflow Experimental Design Single cell DNA methylation primer design scgem Workflow Experimental Design Single cell DNA methylation primer design The scgem DNA methylation assay uses qpcr to measure digestion of target loci by the methylation sensitive restriction endonuclease

More information

FRAUNHOFER INSTITUTE FOR INTERFACIAL ENGINEERING AND BIOTECHNOLOGY IGB NEXT-GENERATION SEQUENCING. From wet lab to dry lab complete sample analysis

FRAUNHOFER INSTITUTE FOR INTERFACIAL ENGINEERING AND BIOTECHNOLOGY IGB NEXT-GENERATION SEQUENCING. From wet lab to dry lab complete sample analysis FRAUNHOFER INSTITUTE FOR INTERFACIAL ENGINEERING AND BIOTECHNOLOGY IGB NEXT-GENERATION SEQUENCING From wet lab to dry lab complete sample analysis »Progress in science depends on new techniques, new discoveries

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

Microarray Informatics

Microarray Informatics Microarray Informatics Donald Dunbar MSc Seminar 4 th February 2009 Aims To give a biologistʼs view of microarray experiments To explain the technologies involved To describe typical microarray experiments

More information

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology.

This place covers: Methods or systems for genetic or protein-related data processing in computational molecular biology. G16B BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY Methods or systems for genetic

More information

Next Gen Sequencing. Expansion of sequencing technology. Contents

Next Gen Sequencing. Expansion of sequencing technology. Contents Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND

More information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information

Outline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/

More information

The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow

The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow Marcus Hausch, Ph.D. 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life, Oligator,

More information

Applications of Next Generation Sequencing in Metagenomics Studies

Applications of Next Generation Sequencing in Metagenomics Studies Applications of Next Generation Sequencing in Metagenomics Studies Francesca Rizzo, PhD Genomix4life Laboratory of Molecular Medicine and Genomics Department of Medicine and Surgery University of Salerno

More information

MULTIPLEXING SIMULTANEOUSLY DETECT MULTIPLE TARGETS IN SINGLE ASSAYS. WhiteSci Whitehead Scientific (Pty) Ltd. Products. Expertise. Support.

MULTIPLEXING SIMULTANEOUSLY DETECT MULTIPLE TARGETS IN SINGLE ASSAYS. WhiteSci Whitehead Scientific (Pty) Ltd. Products. Expertise. Support. MULTIPLEXING SIMULTANEOUSLY DETECT MULTIPLE TARGETS IN SINGLE ASSAYS WhiteSci Whitehead Scientific (Pty) Ltd Products. Expertise. Support. MULTIPLEXING Allowing researchers to gain more insight into precious

More information

NextGen Sequencing and Target Enrichment

NextGen Sequencing and Target Enrichment NextGen Sequencing and Target Enrichment Laurent FARINELLI 7 September 2010 Agilent 3rd Analytic Forum Basel, Switzerland Outline The illumina HiSEQ 2000 system Applications Target enrichment Outlook 7

More information