patent pending BioSolutions Purification solutions for synthetic RNA & DNA Clarity QSP (NEW) Oligo-RP Desalting

Transcription

1 Clarity BioSolutions patent pending Purification solutions for synthetic RNA & DNA Clarity QSP (NEW) Oligo-RP Desalting

2 A Demanding Industry Requires a Reliable Partner The increase in nucleotide demand, due to advances in biotechnology research and their recent therapeutic applications, has fostered a pressing need for more efficient and efficacious purification platforms. To better match the need of oligo manufacturers and their customers, Phenomenex introduces Clarity BioSolutions, a portfolio of purification products designed to deliver purified synthetic oligos based on requirements and specifications set forth by the industry. In addition to providing state-of-the-art purification solutions, Phenomenex offers unparalleled technical support and customer service to companies and core labs purifying synthetic DNA and RNA. We look forward to being your partner for efficient, economical, and efficacious synthetic oligo purification. Clarity BioSolutions for Synthetic DNA & RNA Purification A purification strategy is developed dependent upon many factors such as purity and yield requirements, synthesis scale, oligo length and sequence, and equipment available in the lab. Clarity BioSolutions offers several strategies to suit your purification needs ranging from high-throughput, high purity technologies to simple desalting. Please see below to review the Clarity solutions and select the one to fit your needs. Format(s) Equipment Required NEW Clarity QSP Clarity Oligo-RP Clarity Desalting mg/ 96-well plate mg/ 1 ml cartridges mg/ 3 ml cartridges g/ 6 ml cartridges Vacuum manifold or automated liquid handling system Analytical, semi-prep, & preparative HPLC columns HPLC system mg/ 3 ml tubes mg/ 3 ml tubes Vacuum manifold Purification Time ~8 utes per cartridge ~4 utes per well plate 3 utes 3 utes Oligo Length 1 nt 6 nt 6 nt Synthesis Scale Load nmole µmole nmole µmole 1 µmole Typical Purity 9 9 % % 4 ~7 % 4 Typical Recovery Yield ~9 % 2 ~7 % ~8 % 1. Purity value based on ion exchange chromatography and capillary electrophoresis 2. OD26 used for quantitation 3. Time dependent on dimension of HPLC column and flow rate 4. Purity value based on reversed phase chromatography Web: www.

3 Introducing Clarity QSP Addressing the global aim of a purification process, Clarity QSP delivers near impurity-free, concentrated full-length oligo sequences in a stable media suitable for in-vivo applications and downstream analysis conducive for MS, NMR, CE, and HPLC. Simple in practice and in theory, the product offers speed and efficacy in formats that can be readily automated for high-throughput parallel purification and is suitable for both combinatorial-scale and large-scale purifications. Quick, simple, and pure perfectly and accurately summarizes the Clarity QSP product line. 9 % typical purities and yields for both DNA & RNA Purify oligos ranging from 1 1 nt Simple three-step process delivers highly purified DNA/RNA in utes Formats easily amenable to high-throughput parallel processing Purified oligos suitable for in-vivo applications & downstream analysis Applicable for nmole to large µmole synthesis scales Clarity Quick, Simple, Pure (QSP) Process QSP purification of trityl-on DNA oligos begins after an equal volume of loading buffer is mixed with the cleavage and deprotection solution. After brief conditioning of the sorbent with methanol and water, the solubilized crude oligo is passed through the sorbent. The unique buffer formula synergistically works with ammonia-based deprotecting solutions to selectively retain the full-length trityl-on DNA sequence, while eliating tenaciously bound unlabeled truncated sequences and damaged fragments. The improved cleaning proficiency of the buffer when mixed directly with an alkaline solution eliates the need for subsequent wash steps leaving only detritylation and elution to follow. For RNA TBDMS chemistry, the sequential purification steps are consistent with the above descriptions; however, the crude oligo deprotection solution is diluted with water or an appropriate buffer prior to mixing the equal volume of loading buffer. Consists of 2 components: loading buffer and polymeric sorbent Provides complete discriation of trityl-on full length sequences from trityl-off impurities Ability to load oligo direct from synthesizer No toxic ion-pairing reagents used that interfere with downstream applications Negligible depurination caused by detritylation step Pre-treatment: Trityl-on oligo sample preparation Mix equal volume of loading buffer with cleavage/deprotection solution STEP 1 Load crude oligo cocktail All trityl-off impurities flow directly through; no wash required Loading of Crude Oligo DCA STEP 2 Detritylate Less than 2% depurination observed. A faint orange band will appear at top half of cartridge indicating DMT retention Detritylate Organic Mixture STEP 3 Elute target oligo ph buffered solutions used to maintain safe ph for oligo; select elution buffer based on downstream requirements Full Length Trityl - On Oligo Impurity N-1 Sequence Detritylated Failure Sequences Trityl Group Full Length Target Oligo Elution of Target Oligo Web: www.

4 Clarity QSP Components Clarity QSP consists of two components, a loading buffer and a polymeric sorbent. Housed in three cartridge formats and a 96-well plate, the QSP resin is ph-stable and purifies oligo sequences of lengths ranging from 1 nt to 1 nt. In addition, the QSP media has enhanced flow characteristics to ensure consistent flow rates for increased analyte contact time resulting in unfailing performance. The accompanying loading buffer is composed of biological compatible agents and is free of toxic and meddlesome ion-pairing agents. Together, the sorbent and buffer create a simple three-step process that in utes delivers highly purified synthetic DNA with exceptional recovery yields. 96-well plate Ideal for high-throughput, parallel processing of purified oligos Load.2 µmole synthesis scale per well Purify 96 crude oligo samples in ~4 utes Use either vacuum or positive pressure systems Easily amenable to automated liquid handling systems Cartridge mg/ 1 ml ideal for purifying.2 µmole synthesis scale or less mg/ 3 ml ideal for purifying up to 1. µmole scale g/ 6 ml ideal for large scale purifications up to µmole Purify crude oligo samples in ~8 utes Use either vacuum or positive pressure systems Web: www.

5 DNA & RNA Purified by Clarity QSP Clarity QSP can be used for any synthetic single-stranded oligonucleotide regardless of length (up to 1 nt) or synthetic derivatization and/or adjunct. Our collaborators and we have purified several different types of DNA and RNA on each of the formats and have found that Clarity QSP is an quick and simple process to obtain highly purified oligos. RNA Purification Sequence: GAC UCA CAU CAA CUA CGA UCG AGC ACTT Format: mg/ 1 ml 1 Crude DMT-on RNA OD Load Fraction OD Detritylated Target DNA OD.3 Purity: 87.6 % (total peak area) Crude trityl-on: OD: Load: OD: Detritylated final elution: OD: 29 [Purity: 87.6 % (total peak area) DNA Purification Sequence: GTG GAT CTG CGC ACT TCA GGC TCC TGG GCA Format: mg/ 1 ml cartridge 1 Crude DMT-on DNA OD Load Fraction OD Detritylated Target DNA OD.3 Purity: 92.7 % (total peak area) Crude trityl-on: OD Load OD. 3. Detritylated final elution OD:.3 [Purity: 92.7 % (total peak area) Web: www.

6 Clarity Oligo-RP HPLC Columns Clarity Oligo-RP has been specifically designed for the reversed phase purification of oligonucleotides with balanced hydrophobicity and polar selectivity. The media is based on composite particle TWIN technology that is able to recognize ute differences in interaction features of two oligonucleotides with very closely resembling structures (for example N/N-1 sequences). This recognition ability enables Clarity Oligo-RP to provide better resolution between such close pairs of sequences both on the analytical and preparative scale. Ideal for trityl-off purification of DNA, RNA, thioates, and modified/labeled oligos > 9 % typical purity nmole - µmole loading capacity available with standard dimensions Full length oligonucleotides easily separated from N-1 and other failure sequences App ID 93 nt 21 nt Excellent selectivity characteristics of Clarity Oligo-RP allow baseline separation of failure N-1 sequences from target N sequences. Clarity Desalting Tubes RNA Purification of Failure N-1 sequence from target N sequence App ID 93 Column: Dimensions: Part No.: Mobile Phase: Gradient: Flow Rate: Detection: Sample: Clarity 3 μm Oligo-RP C18 x 4.6 mm B-4441-E A: 1 mm TPAC B: Methanol A/B (7:) to A/B (:4) in 8 ( run time) 1 ml/ 26 nm 1. nt RNA with sequence CUGUAAUCUCUUGUCUATT (2. μg) nt RNA with sequence UCUGUAAUCUCUUGUCUATT (2. μg) Clarity QSP purification cartridges and Oligo-RP can be used to yield highly purified target oligonucleotides (~9 % purity) from a synthesis mixture. However, some applications do not require a high degree of purity. For simple desalting of a synthetic oligonucleotide, Clarity desalting tubes can be used. 7 % typical purity by removing salt and excess reagent 8 % recovery of target oligonucleotide For the moderate purification of DMT-off oligonucleotides Removes salt prior to MS analysis Economical, disposable tubes Crude DNA Purity: 8 % Load Crude DNA Desalting App ID 991 Column: Clarity 3 μm Oligo-RP C18 Dimensions: x 4.6 mm Part No.: B-4441-E Mobile Phase: A: mm TEAA, ph 7. / % Acetonitrile B: Methanol Gradient: A/B (9:1) to A/B (4:6) in Flow Rate: 1 ml/ Detection: 26 nm Sample: nt DNA oligonucleotide Wash App ID Final Purity: 71 % Final Recovery: 94 % Final Elution A quencher-labeled sample of DNA ( nt) with the sequence FAM - TTTGACTTAGACTTAGACTTAGTTT was desalted using Clarity Desalting Tubes in the mg/3 ml format. Collection fractions were then analyzed for purity and recovery using the above protocol. Web: www.

7 Ordering Information Clarity QSP Well Plates & Cartridges Formats Part No. Description Unit 8E-S12-DGB Clarity QSP Well Plate mg/well 1/Box 8B-S12-DAK Clarity QSP Cartridge mg/1 ml /Box 8B-S12-SBJ Clarity QSP Cartridge mg/3 ml /Box 8B-S42-LFF Clarity QSP Cartridge g/6 ml /Box Accessories Buffers Part No. Description Unit AL-8279 Clarity QSP DNA Loading Buffer 1 ml Ea AL-828 Clarity QSP DNA Loading Buffer 1 L Ea AL-8281 Clarity QSP RNA Loading Buffer ml Ea AL-8282 Clarity QSP RNA Loading Buffer 1 L Ea AH-788 Clarity Nuclease Free Water 1 L Ea Part No. Description Unit AH Well Plate Manifold Acrylic Ea AH Position Vacuum Manifold Complete Set Ea AH Square Well Collection Plate 2 ml/well (Polypropylene) /pk AH-748 Solvent Waste Reservoir Tray for Well Plate Manifolds /pk AH Well Pierceable Sealing Mat Square Well /pk Clarity Oligo-RP HPLC Columns *SecurityGuard Analytical Cartridges require universal holder Part No.: KJO µm Minibore & Analytical Columns (mm) SecurityGuard TM Cartridges x 2. 1 x 2. x x x 2.* mm 4 x 3.* mm Phase /1pk /1pk C18 B-4441-B D-4441-B B-4441-E D-4441-E AJ-8134 AJ-813 for ID: mm mm 3 µm Semi-Prep Columns (mm) SecurityGuard TM Cartridges x 1. 1 x 1 mm Phase /3pk C18 B-4441-N AJ-8136 for ID: 9-16 mm *SecurityGuard Analytical Cartridges require universal holder Part No.: KJO-4282 µm Analytical Columns (mm) SecurityGuard TM Cartridges x 4.6 x x 3. mm* Phase /1pk C18 B-4442-E OF-4442-EO AJ-813 for ID: mm Semi-prep SecurityGuard Cartridges require holder, Part No.: AJ-72 **PREP SecurityGuard Cartridges require holder, Part No.: AJ-8223 µm Semi-Prep and PREP Columns (mm) SecurityGuard TM Cartridges x 1. 1 x 1. x x 1 mm x 21 mm** Phase /3pk ea C18 B-4442-N D-4442-N G-4442-P AJ-8136 AJ-821 for ID: 9-16 mm 18-3 mm Clarity Desalting Tubes. * For µmole synthesis ** For 1 µmole synthesis Clarity Desalting Tubes mg/3 ml* mg/3 ml** Phase /box /box C18 8B-SO41-FBJ 8B-SO41-HBJ Evaluate Clarity Biosolutions in your lab for 4 days, if you are not completely satisfied return it for a full refund. Clarity is a registered trademark of Phenomenex, Inc. SecurityGuard, Oligo-RP, QSP and TWIN Technology are trademarks of Phenomenex, Inc. 7 Phenomenex, Inc. All rights reserved. Web: www.

8 Clarity BioSolutions patent pending www. Phenomenex products are available worldwide. For the distributor in your country, contact Phenomenex USA, International Department by telephone, fax or mail: tel.: fax: mail: tel.: fax: Australia PO Box 484 Lane Cove, NSW 66 Australia au Ireland Queens Avenue, Hurdsfield Ind. Est., Macclesfield, Cheshire SK1 2BN, UK eire Austria Zeppelinstr Aschaffenburg Germany anfrage@ Italy Via Emilia, 1/C 411 Anzola Emilia (BO) Italy italia Canada 411 Madrid Ave. Torrance, CA USA (8) (31) New Zealand P O Box Milford 741 North Shore City New Zealand phenomenex.co.nz Denmark Gydevang Allerød Denmark dk Puerto Rico 273 Sierra Morena, Suite #14 San Juan, Puerto Rico 926 (8) 41-HPLC (31) France Parc des Grillons, Bat.3 6 route de Sartrouville Le Pecq Cedex France france United Kingdom Queens Avenue, Hurdsfield Ind. Est., Macclesfield, Cheshire SK1 2BN, UK uk Germany Zeppelinstr Aschaffenburg Germany anfrage@ USA 411 Madrid Ave. Torrance, CA USA (31) 212- (31) _L