Clarity BioSolutions For Synthetic DNA/RNA Advance Your. Oligonucleotide Work. From Sample Preparation to Analysis and Purification

Transcription

1 Clarity BioSolutions For Synthetic DNA/RNA Advance Your Oligonucleotide Work From Sample Preparation to Analysis and Purification

2 Optimized Oligonucleotide Purification and Analysis Designed to efficiently and effectively purify or characterize synthetic oligonucleotides, the Clarity BioSolutions Sample Preparation and LC portfolio includes solutions for all aspects of the oligo purification process. From desalting and cleanup from biological samples to analytical and preparative LC analysis, Clarity BioSolutions will help advance your oligonucleotide analyses. Guarantee If analytical Clarity LC Products do not provide at least an equivalent separation as compared to a competing product of the same particle size, similar phase and dimensions, return the column with comparative data within 4 days for a FULL REFUND. 217 Phenomenex, Inc. All rights reserved.

3 Table of Contents Analysis of Bioanalytical Samples Sample Preparation...pp. 4-7 LC/MS Analysis...pp. 8-9 Oligonucleotide Synthesis Sample Preparation DMT On (Trityl On)... pp DMT Off (Trityl Off)... pp Analytical LC...p. 14 Purification... p. 1 Analyte Characterization Reversed Phase... pp Ion-Exchange... pp

4 Analysis of Bioanalytical Samples Sample Preparation Clarity OTX Extraction Kits Prior to LC/MS analysis, therapeutic oligonucleotides must be isolated from interferences such as salts, sugars, large proteins, and genomic DNA. Using a mixed-mode solid phase extraction (SPE) sorbent in conjunction with carefully formulated buffers, Clarity OTX consistently delivers greater than 8 % recoveries. Designed for Throughput MeOH 4 Steps and 1 Minutes, with No Liquid-Liquid Extraction (LLE) Required! Elution Buffer Equil. Buffer STEP 1 Preparation of SPE sorbent to selectively retain the oligo of interest and its metabolites. Load Sample STEP 4 The addition of the elution buffer releases the target oligo therapeutic and its metabolites. The elution volume can be dried down or lyophilized and reconstituted prior to LC/MS analysis. Wash Buffer STEP 3 The wash buffer is formulated to strip off lipids and proteins from the sorbent, while not disturbing the oligo therapeutics and its metabolites. STEP 2 Salts, sugars, large proteins and genomic DNA flow through the cartridge. The oligo of interest, proteins, and lipids bind to the sorbent via a mixed-mode, weak anionic interaction. Oligo & metabolites Salts Sugars Genomic DNA Lipids Proteins 4

5 Intensity Effective Recoveries 8 4 UV Recovery Data Eliminate MS Interfering Compounds 1.3E E+-6 8.E+- 6.E E+-.E+- MS Recovery Data % Recovery min App ID App ID Plasma extracted 27mer phosphorothioate (1 µg) Area: 278 Recovery: 9 % Standard 27mer phosphorothioate (1 µg) Area: 231 Effective removal of plasma contaminants for improved detection of target oligo therapeutics Analysis of Bioanalytical Samples

6 Analysis of Bioanalytical Samples Peak Area Sample Preparation Clarity OTX Extraction Kits Excellent Linearity 1.6E+7 1.2E+7 8.E+6 Liver Tissue Linearity Curve y = x + 2E+6 =.998 Accurate, reliable results from 1 µg to 1 µg 4.E+6.E µg/g Liver Detect Low Dosage Levels Liver Tissue Linearity Curve 1 μg oligo in 1 g liver tissue 19mer Oligo Internal Std. Accurately detect down to 1 µg min Peak Area 1 1 μg oligo in 1 g liver tissue min 1 1 μg oligo and 1 µg internal standard App ID min 6

7 Ordering Information Choose from 96-well plates or cartridges and stock up on 1L quantities of buffers. Part No. Description Unit Price KS-8494 Clarity OTX Starter Kit- Tubes Includes: 1 mg/3 ml cartridges (x) Lysis-loading buffer (6 ml) Equilibration buffer (2 ml) Wash buffer (3 ml) Elution buffer (6 ml) ea KS-923 Clarity OTX Starter Kit- 96-Well Plate 1 mg/ 96-well plate (x1) Lysis-loading buffer (6 ml) Equilibration buffer (2 ml) Wash buffer (3 ml) Elution buffer (6 ml) 8E-S13-EGA Clarity OTX Well Plate 1 mg/ well 1/box 8B-S13-EBJ Clarity OTX Cartridge 1 mg/3 ml /box AL-879 Clarity OTX Lysis-Loading Buffer V2. 1 L ea ea Flexible Formats Give it a Try Take Clarity OTX for a test run with a starter kit which includes either a 96-well plate or cartridges and all of the buffers you will need! Analysis of Bioanalytical Samples Easily Process Samples with the Presston 1 Positive Pressure Manifold Presston 1 Positive Pressure Manifold Part No. Description Price AH-9334 Presston 1 Positive Pressure Manifold, 96-Well Plate AH-9342 Presston 1 Positive Pressure Manifold, 1 ml Tube Complete Assembly AH-9347 Presston 1 Positive Pressure Manifold, 3 ml Tube Complete Assembly AH-9343 Presston 1 Positive Pressure Manifold, 6 ml Tube Complete Assembly Presston 1 Tube Adapter Kits (for AH-9334) Part No. Description Price AH ml Tube Adapter Kit AH ml Tube Adapter Kit AH ml Tube Adapter Kit WARRANTY Phenomenex warrants that for a period of 12 months following delivery, the Presston 1 Positive Pressure Manifold you have purchased will perform in accordance with the published specifications and will be free from defects in materials or workmanship. In the event that the Presston 1 Positive Pressure Manifold does not meet this warranty, Phenomenex will repair or replace defective parts. Please visit for complete warranty information. Phenomenex l WEB: 7

8 Analysis of Bioanalytical Samples LC/MS Analysis Clarity Oligo-XT An increased need for TK and PK/PD studies for oligo therapeutics has lead to an increase in LC/MS/MS analysis because of the specificity, sensitivity, and shorter method development times as compared to ligand binding assays or ELISA. Because sensitivity is of the utmost importance, it is crucial to select an LC column that provides both separation and high efficiencies to ensure accurate results. The Core-Shell Advantage Unlike traditional fully porous oligo columns, Clarity Oligo-XT relies on the power of core-shell technology to provide extremely high efficiencies for both low and high oligo concentrations. Because the Clarity Oligo-XT particle is not fully porous, analytes spend less time diffusing into and out of the pores as they travel through the column, resulting in less band broadening for higher peak efficiencies. Clarity Core-Shell Conventional Fully Porous Less Band Broadening More Band Broadening Fully Porous Clarity Core-Shell Average Efficiency Gain with Clarity * Fully Porous Clarity Core-Shell Average Efficiency Gain with Clarity * µm VS µm 9 % Higher 1.7 µm VS 1.7 µm 2 % Higher 3 µm VS 2.6 µm 8 % Higher * May not be representative of all applications 8

9 Area Ratio Sensitive, Reliable Analysis Calibration curve of BNA in mini pig liver homogenate Quadratic regression 1-1 ng/ml Consistently quantify oligos down to 1 ng/ml LC/MS/MS Conditions Column: Clarity μm Oligo-XT Dimensions: x 2.1 mm Part No.: B-474-AN HPLC system: Shimadzu Nexera X2 UHPLC Mobile Phase: A: 1. % HFIP &.1 % DIEA with 1 μm EDTA in Methanol B: 1. % HFIP &.1 % DIEA with 1 μm EDTA in Methanol Water (: v/v) Gradient: Time (min) B % Flow Rate: μl/min Inj. Volume: 1 μl Temperature: 4 C Detection: Thermo Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer, HESI, negative polarity Analysis of Bioanalytical Samples Ordering Information SecurityGuard 1.7 µm Minibore Columns (mm) ULTRA Cartridges Phase x x 2.1 3/pk Oligo-XT B-4747-AN D-4747-AN AJ-91 for 2.1 mm ID 2.6 µm Minibore and Analytical Columns (mm) SecurityGuard ULTRA Cartridges Phase x x 2.1 x x 4.6 3/pk 3/pk Oligo-XT B-4746-AN D-4746-AN B-4746-E D-4746-E AJ-91 AJ-914 for 2.1 mm ID for 4.6 mm ID µm Minibore and Analytical Columns (mm) SecurityGuard ULTRA Cartridges Phase x x 4.6 3/pk 3/pk Oligo-XT B-474-AN F-474-E AJ-91 AJ-914 for 2.1 mm ID for 4.6 mm ID SecurityGuard µm Semi-Preparative Columns (mm) SemiPrep Cartridges* Phase x 1. 1 x 1. 1 x 1. 3/pk Oligo-XT B-474-N D-474-N F-474-N AJ-916 for 1 mm ID µm Axia Packed Preparative Columns (mm) SecurityGuard PREP Cartridges** SecurityGuard PREP Cartridges*** Phase 1 x x x x 3 /ea /ea Oligo-XT D-474-P-AX F-474-P-AX G-474-P-AX F-474-U-AX AJ-917 AJ-918 for 21.2 mm ID for 3 mm ID SecurityGuard ULTRA Cartridges require holder, Part No.: AJ-9 * SemiPrep SecurityGuard Cartridges require holder, Part No.: AJ-9281 ** PREP SecurityGuard Cartridges require holder, Part No.: AJ-8223 *** PREP SecurityGuard Cartridges require holder, Part No.: AJ-8277 Phenomenex l WEB: 9

10 Oligonucleotide Synthesis Sample Preparation: DMT On (Trityl On) Clarity QSP The DNA and RNA synthesis process results in a solution that contains target oligos as well as impurities and failure sequences. Target oligos must then be isolated and purified for further analysis. Using a Quick, Simple, and Pure (QSP) protocol, Clarity QSP produces greater than 9 % recoveries of target oligos in less than 2 minutes. It s Quick, Simple, and Pure (QSP) Pre-treatment Trityl-on oligo sample preparation. Mix equal volume of loading buffer with cleavage/deprotection solution STEP 1 Load crude oligo cocktail All trityl-off impurities flow directly through; no wash required. DCA > 9 % recoveries in under 2 minutes! Organic Mixture STEP 2 Detritylate Less than 2 % depurination observed. A faint orange band will appear at top half of cartridge indicating DMT retention. STEP 3 Elute target oligo ph buffered solutions used to maintain safe ph for oligo; select elution buffer based on downstream requirements. Full Length Trityl-On Oligo Impurity N-1 Sequence Detritylated Failure Sequences Trityl Group Full Length Target Oligo Request Technical Note TN-1 Comparing Performance of High- Throughput, Trityl-on RNA/DNA Purification Products to see the benefits of using Clarity QSP over other trityl-on solutions. 1

11 Guaranteed Complete Discrimination between Full-Length Trityl-On Sequences and Impurities High-Throughput DNA Purification min App ID 1646 Sequence: GTGGATCTGCGCACTTCAGGCTCCTGGGCT Synthesis Scale: 2 nmole Format: 96-Well Plate ( mg / well) 1. Crude Trityl-on 2. Load fraction 3. Detritylated final elution Concentrated, full-length sequence that is free of impurities Oligonucleotide Synthesis Crude Trityl-on Load Fraction Detritylated Final Elution Recovery Purity (Peak area) % 92 % Ordering Information Part No. Description Unit Price Formats 8E-S12-DGB Clarity QSP Well Plate mg/well 1/box 8B-S12-UBJ Clarity QSP Cartridge 6 mg/3 ml /box 8B-S12-SBJ Clarity QSP Cartridge 1 mg/3 ml /box 8B-S42-LFF Clarity QSP Cartridge g/6 ml 16/box Buffers * AL-828 Clarity QSP DNA Loading Buffer 1 L ea AL-8282 Clarity QSP RNA-TBDMS Loading Buffer 1 L ea * RNA-TOM loading buffer available upon request Easily Process Samples with the Presston 1 Positive Pressure Manifold Presston 1 Positive Pressure Manifold Part No. Description Price AH-9334 Presston 1 Positive Pressure Manifold, 96-Well Plate AH-9342 Presston 1 Positive Pressure Manifold, 1 ml Tube Complete Assembly AH-9347 Presston 1 Positive Pressure Manifold, 3 ml Tube Complete Assembly AH-9343 Presston 1 Positive Pressure Manifold, 6 ml Tube Complete Assembly Presston 1 Tube Adapter Kits (for AH-9334) Part No. Description Price AH ml Tube Adapter Kit AH ml Tube Adapter Kit AH ml Tube Adapter Kit WARRANTY Phenomenex warrants that for a period of 12 months following delivery, the Presston 1 Positive Pressure Manifold you have purchased will perform in accordance with the published specifications and will be free from defects in materials or workmanship. In the event that the Presston 1 Positive Pressure Manifold does not meet this warranty, Phenomenex will repair or replace defective parts. Please visit for complete warranty information. 11

12 Oligonucleotide Synthesis Sample Preparation: DMT Off (Trityl off) Clarity RP-Desalting Trityl-off synthetic oligo synthesis mixtures must undergo a desalting process to remove salts and buffers that are not amenable to LC/MS analysis. Clarity RP-Desalting tubes and 96-well plates provide a high capacity, fast and effective desalting solution that results in greater than 7 % purity and 8 % recovery of trityl-off synthetic oligos. Desalting of Dye-Labeled DNA Crude Load Column: Clarity 3 µm Oligo-RP C18 Dimensions: x 4.6 mm Part No.: B-4441-E Mobile Phase: A: mm TEAA, ph 7. / % Acetonitrile B: Methanol Gradient: A/B (9:1) to A/B (4:6) in 2 min Flow Rate: 1 ml/ min Detection: 26 nm Sample: 2nt DNA oligonucleotide Wash Final Elution Final Purity: 71 % Final Recovery: 94 % 4 2 App ID min A quencher-labeled sample of DNA (2nt) with the sequence FAMTTGACTTAGACTTAGA- CTTAGTTT was desalted using Clarity RP-Desalting tubes in the 2 mg/3 ml format. Collection fractions were then analyzed for purity and recovery using the above protocol. 12

13 Desalt Crude DNA Crude Load Column: Clarity 3 µm Oligo-RP C18 Dimensions: x 4.6 mm Part No.: B-4441-E Mobile Phase: A: mm TEAA, ph 7. / % Acetonitrile B: Methanol Gradient: A/B (9:1) to A/B (4:6) in 2 min Flow Rate: 1 ml/ min Detection: 26 nm Sample: 4nt DNA Oligonucleotide Synthesis 1 Wash Final Elution App ID min Ordering Information Tubes 2 mg/3 ml * mg/3 ml ** Phase /box /box C18 8B-S41-FBJ 8B-S41-HBJ 96-Well Plates * Part No. Description Unit Price 8E-S41-SGA Clarity RP Desalting 1 mg/well ea * For 2 µmole synthesis ** For 1 µmole synthesis Easily Process Samples with the Presston 1 Positive Pressure Manifold Presston 1 Positive Pressure Manifold Part No. Description Price AH-9334 Presston 1 Positive Pressure Manifold, 96-Well Plate AH-9342 Presston 1 Positive Pressure Manifold, 1 ml Tube Complete Assembly AH-9347 Presston 1 Positive Pressure Manifold, 3 ml Tube Complete Assembly AH-9343 Presston 1 Positive Pressure Manifold, 6 ml Tube Complete Assembly Presston 1 Tube Adapter Kits (for AH-9334) Part No. Description Price AH ml Tube Adapter Kit AH ml Tube Adapter Kit AH ml Tube Adapter Kit WARRANTY Phenomenex warrants that for a period of 12 months following delivery, the Presston 1 Positive Pressure Manifold you have purchased will perform in accordance with the published specifications and will be free from defects in materials or workmanship. In the event that the Presston 1 Positive Pressure Manifold does not meet this warranty, Phenomenex will repair or replace defective parts. Please visit for complete warranty information. Phenomenex l WEB: 13

14 Oligonucleotide Synthesis Analytical LC Clarity Oligo-RP Clarity Oligo-RP columns have been specifically designed for the reversed phase purification of oligonucleotides with balanced hydrophobicity and polar selectivity. Available in 3,, and 1 µm particles, Clarity Oligo-RP allows for high capacity analysis and purification of oligos. A Highly Selective Analysis 4nt nt Separation of failure N-1 from target N sequence min App 1621 Clarity Oligo-RP successfully separates a 4mer from a 39mer DNA oligonucleotide due to its excellent efficiency and resolving power. Column: Clarity 3 µm Oligo-RP C18 Dimensions: x 4.6 mm Part No.: B-4441-E Mobile Phase: A: mm TEAA ph 7. B: Methanol Gradient: 1 % to 4 % B in 3 minutes Flow Rate: 1 ml/ min Detection: 26 nm Sample: 1. 4nt DNA with sequence CTTCTGAACAGTTGATCTATG- CACTTCAGACTTATGATCA (2. μg) 2. 39nt DNA with sequence TTCTGAACAGTTGATCTATGCAC- TTCAGACTTATGATCA (2. μg) Ordering Information Minibore Columns (mm) SecurityGuard Cartridges (mm) Phase x 2. 1 x 2. 1 x 2. 4 x 2. * /1pk 3 µm Oligo-RP C18 B-4441-B D-4441-B F-4441-B AJ-8134 /1pk µm Oligo-RP C18 F-4442-B AJ-8134 for ID: mm 14 Analytical Columns (mm) SecurityGuard Cartridges (mm) Phase x x x x x 3. * /1pk 3 µm Oligo-RP C18 B-4441-E D-4441-E F-4441-E AJ-813 /1pk µm Oligo-RP C18 B-4442-E F-4442-E G-4442-E AJ-813 for ID: mm * SecurityGuard Analytical Cartridges require universal holder, Part No.: KJ-4282

15 Purification Clarity Oligo-RP Clarity Oligo-RP columns allow for high loadability and deliver high recovery and purity, from HPLC to Preparative Purification. Easily Scale from HPLC to Preparative Purification DNA Purification (A) Preparative Successfully separate impurities from target sequences min App ID 1947 Column: Clarity 3 µm Oligo-RP C18 Dimensions: A: x 1. mm B: x 4.6 mm Part No.: A: B-4441-N B: B-4441-E Mobile Phase: A: mm TEAA ph 7./ % Acetonitrile B: Methanol Gradient: 1 % to 6 % B in 2 minutes Flow Rate: A: 4.7 ml/ min B: 1. ml/ min Detection: 26 nm Sample: 2nt DNA Oligonucleotide Synthesis 16 (B) Analytical QC % Purity and 8 % Yield min App ID 1948 Ordering Information Semi-Prep Columns (mm) SecurityGuard Cartridges (mm) Phase x 1. 1 x 1. 1 x 1. 2 x 1. 1 x 1 /3pk 3 µm Oligo-RP C18 B-4441-N AJ-8136 /3pk µm Oligo-RP C18 B-4442-N D-4442-N F-4442-N G-4442-N AJ-8136 /3pk 1 µm Oligo-RP C18 F-444-N G-444-N AJ-8136 for ID: 9-16 mm Prep and Axia Packed Preparative Columns (mm) SecurityGuard Cartridges (mm) Phase 1 x x x x 3 2 x 1 x 21.2 ** 1 x 3. /ea /ea µm Oligo-RP C18 D-4442-P-AX G-4442-P-AX AJ-821 AJ-831 /ea /ea 1 µm Oligo-RP C18 F-444-P-AX G-444-P-AX F-444-U-AX G-444-V-AX AJ-821 AJ-831 Bulk material available upon request. for ID: mm 3-49 mm SemiPrep SecurityGuard Cartridges require holder, Part No.: AJ-9281 ** PREP SecurityGuard Cartridges require holder, Part No.: AJ-8223 PREP SecurityGuard Cartridges require holder, Part No.: AJ-8277 Phenomenex l WEB: 1

16 Analyte Characterization Reversed Phase LC Clarity Oligo-XT Analyte Characterization Clarity Oligo-XT columns have the selectivity and efficiency required for demanding oligonucleotide methods, including separation of n-1 sequences. The particle and stationary phase have also been optimized to withstand the high temperature and harsh solvents required for oligo analysis. The Core-Shell Advantage Unlike traditional fully porous oligo columns, Clarity Oligo-XT relies on the power of core-shell technology to provide extremely high efficiencies for both low and high oligo concentrations. Because the Clarity Oligo-XT particle is not fully porous, analytes spend less time diffusing into and out of the pores as they travel through the column, resulting in less band broadening for higher peak efficiencies. Clarity Core-Shell Conventional Fully Porous Less Band Broadening More Band Broadening Fully Porous Clarity Core-Shell Average Efficiency Gain with Clarity * Fully Porous Clarity Core-Shell Average Efficiency Gain with Clarity * µm VS µm 9 % Higher 1.7 µm VS 1.7 µm 2 % Higher 3 µm VS 2.6 µm 8 % Higher * May not be representative of all applications 16

17 Relative Efficiency (%) Reliable Results Number of Cycles Achieve Consistently High Efficiencies Column: Clarity 2.6 µm Oligo-XT Dimensions: x 2.1 mm Part No.: B-4746-AN Guard Cartrdige: AJ-91 Guard Holder: AJ-9 Mobile Phase: A: H 2 O + mm HFIP + mm DIEA (ph 8.7) B: ACN + mm HFIP + mm DIEA Gradient: Time (min) % B Flow Rate:.3 ml/min Temperature: 6 C Detection: 24 nm Sample: Reversed Phase PTM 2 ( % dilution in Water) Analyte Characterization Ordering Information SecurityGuard 1.7 µm Minibore Columns (mm) ULTRA Cartridges Phase x x 2.1 3/pk Oligo-XT B-4747-AN D-4747-AN AJ-91 for 2.1 mm ID 2.6 µm Minibore and Analytical Columns (mm) SecurityGuard ULTRA Cartridges Phase x x 2.1 x x 4.6 3/pk 3/pk Oligo-XT B-4746-AN D-4746-AN B-4746-E D-4746-E AJ-91 AJ-914 for 2.1 mm ID for 4.6 mm ID µm Minibore and Analytical Columns (mm) SecurityGuard ULTRA Cartridges Phase x x 4.6 3/pk 3/pk Oligo-XT B-474-AN F-474-E AJ-91 AJ-914 for 2.1 mm ID for 4.6 mm ID SecurityGuard µm Semi-Preparative Columns (mm) SemiPrep Cartridges* Phase x 1. 1 x 1. 1 x 1. 3/pk Oligo-XT B-474-N D-474-N F-474-N AJ-916 for 1 mm ID µm Axia Packed Preparative Columns (mm) SecurityGuard PREP Cartridges** SecurityGuard PREP Cartridges*** Phase 1 x x x x 3 /ea /ea Oligo-XT D-474-P-AX F-474-P-AX G-474-P-AX F-474-U-AX AJ-917 AJ-918 for 21.2 mm ID for 3 mm ID SecurityGuard ULTRA Cartridges require holder, Part No.: AJ-9 * SemiPrep SecurityGuard Cartridges require holder, Part No.: AJ-9281 ** PREP SecurityGuard Cartridges require holder, Part No.: AJ-8223 *** PREP SecurityGuard Cartridges require holder, Part No.: AJ-8277 Phenomenex l WEB: 17

18 Analyte Characterization Ion-Exchange LC Clarity Oligo-SAX The characterization of synthetic oligos is important in the drug development process, and one common technique used is strong anion-exchange liquid chromatography. This high resolution technique is preferred when extensive characterization (i.e. LC/MS) is not necessary. Another valuable benefit is that n-1 failure sequences can still be separated without the use of an ion pair reagent. Clarity Oligo-SAX strong anion-exchange columns allow analysts to reliably characterize a variety of different sized synthetic oligos while providing excellent separation of oligos and synthesis impurities. A Sensitive Separation 2 Poly (dt) 12-18mer Excellent separation of 12-18mer oligos App ID min 2 Poly (dt) 19-24mer Reliably separate synthesis impurities from target oligos App ID min Column: Clarity μm Oligo-SAX Dimensions: 2 x 4.6 mm Part No.: G-4749-E Mobile Phase: See Table Flow Rate: 1.6 ml/ min Temperature: 3 C LC System: Agilent 12 Detection: 26 nm Oligo Type Mobile Phase A Mobile Phase B Gradient Program Poly (dt) 12-18mer 2 mm Tris, ph 8. 2 mm Tris M NaCl, ph % in 1 min Poly (dt) 19-24mer 2 mm Tris, ph 8. 2 mm Tris M NaCl, ph % in 1 min Poly (dt) 19/2mer, 39/4mer, 9/6mer 2 mm Tris, ph 8. 18

19 Go Beyond Traditional Oligo Analysis 3 2 Poly (dt) 19/2mer, 39/4mer, 9/6mer Analyze longer oligos, up to 6mer! Analyte Characterization App ID min Ordering Information Analytical Columns (mm) Phase x x x x 4.6 µm Oligo-SAX B-4749-E D-4749-E F-4749-E G-4749-E We re Here to Help on Live Chat! Request a Method Search Applications Download Resources Column Care Instructions Quality and Safety Documents Training and On-Site Support Do-it-Yourself Web Tools Live Chat with a Phenom Phenomenex.com/chat Phenomenex l WEB: 19

20 Clarity BioSolutions For Synthetic DNA/RNA Advance Your Oligonucleotide Work From Sample Preparation to Analysis and Purification Australia t: +61 () f: +61 () Austria t: +43 () f: +43 () Belgium t: +32 () (French) t: +32 () (Dutch) f: +31 () beinfo@phenomenex.com Canada t: +1 (8) f: +1 (31) info@phenomenex.com China t: f: +86 () phen@agela.com Denmark t: f: nordicinfo@phenomenex.com Finland t: +38 () f: nordicinfo@phenomenex.com France t: +33 () f: +33 () franceinfo@phenomenex.com Germany t: +49 () f: +49 () anfrage@phenomenex.com India t: +91 () f: +91 () indiainfo@phenomenex.com Ireland t: +33 () f: eireinfo@phenomenex.com Luxembourg t: +31 () f: +31 () nlinfo@phenomenex.com Mexico t: f: tecnicomx@phenomenex.com The Netherlands t: +31 () f: +31 () nlinfo@phenomenex.com New Zealand t: +64 () f: +64 () nzinfo@phenomenex.com Norway t: f: nordicinfo@phenomenex.com Puerto Rico t: +1 (8) 41-HPLC f: +1 (31) info@phenomenex.com Spain t: f: espinfo@phenomenex.com Sweden t: +46 () f: nordicinfo@phenomenex.com United Kingdom t: +44 () f: +44 () ukinfo@phenomenex.com USA t: +1 (31) 212- f: +1 (31) info@phenomenex.com All other countries Corporate Office USA t: +1 (31) 212- f: +1 (31) info@phenomenex.com Italy t: f: italiainfo@phenomenex.com Phenomenex products are available worldwide. For the distributor in your country, contact Phenomenex USA,International Department at international@phenomenex.com BR _W Terms and Conditions Subject to Phenomenex Standard Terms and Conditions, which may be viewed at Trademarks Clarity is a registered trademark and Axia, OTX, QSP, RP-Desalting, Oligo-RP, Presston, and SecurityGuard are trademarks of Phenomenex. Q Exactive and Orbitrap are trademarks of Thermo Fisher Scientific. Shimadzu and Nexera are registered trademarks of Shimadzu Corporation. Agilent is a registered trademark of Agilent Technologies, Inc. Disclaimer Comparative separations may not be representative of all applications. Phenomenex is in no way affiliated with Thermo or Agilent. Axia column and packing technology is patented by Phenomenex. U.S. Patent No. 7,674,383 Clarity Oligo-XT is patented by Phenomenex. U.S. Patent No. 7,63,367 and 8,68,38 and foreign counterparts. Clarity OTX and QSP are patented by Phenomenex. U.S. Patent No. 7,119,14. SecurityGuard is patented by Phenomenex. U.S. Patent No. 6,162,362 CAUTION: this patent only applies to the analytical-sized guard cartridge holder, and does not apply to SemiPrep, PREP, or ULTRA holders, or to any cartridges. 217 Phenomenex, Inc. All rights reserved.