High Resolution LC or LC-MS Analysis of Oligonucleotides and Large DNA Fragments Using a New Polymer-Based Reversed Phase Column
|
|
|
- Sharon Reed
- 6 years ago
- Views:
Transcription
1 High Resolution LC or LC-MS Analysis of Oligonucleotides and Large DNA Fragments Using a New Polymer-Based Reversed Phase Column 5/24/216 Julia Baek, Jim Thayer, Shanhua Lin, Yizhu Guo, Yoginder Singh, Jessica Wang, Xiaodong Liu, Ilze Birznieks The world leader in serving science
2 Oligonucleotides as Tools for Molecular Biology Research DNA Amplification (PCR) Primers DNA Sequencing Fluorescent in situ hybridization (FISH) Molecular Diagnostics DNA Nanomaterials 2
3 Oligonucleotides as Therapeutic Agents Antisense Oligonucleotide 2 sirna (small interfering RNA) Aptamer 1 Ribozyme IVT mrna (in vitro transcribed mrna) isrna (immunostimulatory RNA) CRISPR/Cas9 3
4 4 Chemical Modifications of Oligonucleotides
5 Oligonucleotide Impurities N-1, N-2, N+1 PO impurity in PS sample Imperfect deprotection (DMT) Depurination 5
6 HPLC Analysis of Nucleic Acids Anion Exchange Chromatography Ion-Pair Reversed Phase Chromatography Provides high resolution separation oligonucleotides Low or no organic solvent Cannot be directly coupled to Mass spectrometer Provides high resolution separation oligonucleotides Can be directly coupled to Mass spectrometer 6
7 Anion Exchange Chromatography Cl - O O Base Na + O R O P O O Base Resin Cl - Na + O R Cl - Oligonucleotide Na + Na + Cl - 7
8 Ion-Pair Reversed-Phase Chromatography Ion-pairing reagent O O O R O P O O Base Base Resin O R Oligonucleotide LC/UV LC/MS Triethylammonium acetate (TEAA) Triethylamine (TEA) + Hexafluoroisopropanol (HFIP) F F F OH F F F 8
9 HPLC Analysis of Nucleic Acids Anion Exchange Chromatography Ion-Pair Reversed Phase Chromatography DNAPac PA1 DNAPac PA2 DNAPac PA2 RS DNASwift SAX-1S DNAPac RP NEW 9
10 DNAPac RP Column Reversed phase column designed for separation of oligonucleotides and large DNA/RNA fragments High resolution and high efficiency Excellent MS compatibility Wide operating ph range: -14 High temperature stability: Up to 1 ºC High throughput Substrate Poly(styrene-divinylbenzene) particles Particle Size 4 µm Pore Size Column Formats 1,~2, Å 3. 1 mm 3. 5 mm mm mm 1
11 Applications 28 High resolution / Fast separation MS compatible Absorbance (mau) Relative Abundance Ion current ph 9.9 Retention Time (min) 5 8 dsdna & long oligonucleotides Retention Time (min) 1 6 Absorbance (mau) Relative Abundance [M-4H] Retention Time (min) 14 11
12 Fast Sparation of 12-4mer Deoxythymidines (dts) Absorban nce (mau) Column: DNAPac RP, 4 µm Format: mm Mobile phase A:.1 M TEAA, ph 7. Mobile phase B:.1 M TEAA in Water / Acetonitrile (75:25 v/v) Gradient: Time (min) %A %B Gradient curve: 3 Flow rate:.8 ml/min Inj. volume: 4 µl Temperature: 8 ºC Detection: UV (26 nm) Sample: poly dt12-4 (1 A/mL) Peak label: Length of DNA Retention Time (min) 12
13 High Resolution Separation of 12-6mer dts Absorban nce (mau) Column: DNAPac RP, 4 µm Format: mm Mobile phase A:.1 M TEAA, ph 7. Mobile phase B:.1 M TEAA in Water / Acetonitrile (75:25 v/v) Gradient: Time (min) %A %B Gradient curve: 3 Flow rate:.8 ml/min Inj. volume: 1 µl Temperature: 8 ºC Detection: UV (26 nm) Sample: poly dt12-6 (.5 A/mL) Peak label: Length of DNA Retention Time (min) 13
14 LC/UV Analysis of Mixed-Base DNA Absorban nce (mau) Column: DNAPac RP, 4 µm Format: mm Mobile phase A:.1 M TEAA, ph 7. Mobile phase B:.1 M TEAA in Water / Acetonitrile (75:25 v/v) Gradient: Time (min) %A %B Gradient curve: 3 Flow rate:.8 ml/min Inj. volume: 2 µl Temperature: 8 ºC Detection: UV (26 nm) Sample: 8-Combo DNA (5 µm)* Peak label: Length of DNA Retention Time (min) 14
15 LC/MS Analysis of n and n-1 Sequences Relative Abundance Absorbance (mau) 1 24 Ion current UV n-1 n-1 n n Column: DNAPac RP, 4 µm Format: mm Mobile phase A: 15 mm TEA, 4 mm HFIP, ph 7.9 Mobile phase B: 15 mm TEA, 4 mm HFIP in Water / Methanol (5:5 v/v) Gradient: Time (min) %A %B Temperature: 6 ºC Flow rate:.25 ml/min Inj. volume: 4 µl Detection: UV (26 nm) MS (Negative-ion mode) Mass Spec: Q Exactive Plus Sample: 21mer DNA GATTGTAGGTTCTCTAACGCT Time (min) 15
16 LC/MS Analysis of n and n-1 Sequences: Mass Spectrum of n Sequence z=8 1 [M-4H] [M+Na-5H] Relative Abundance z= z= z= z= m/z 16
17 LC/MS Analysis of n and n-1 Sequences: Mass Spectrum of n-1 Sequence 1 -T Mi= Relative Abun ndance A Mi= G Mi= C Mi= m/z 17
18 LC/MS Analysis of Phosphorothioate Modified sirna Relative Abundance Absorbance (mau) 1 Ion current UV 2 2 Column: DNAPac RP, 4 µm Format: mm Mobile phase A: 35 mm TEA, 4 mm HFIP, ph 9.9 Mobile phase B: 35 mm TEA, 4 mm HFIP in Water / Methanol (75:25 v/v) Gradient: Time (min) %A %B Temperature: 3 ºC Flow rate:.25 ml/min Inj. volume: 3 µl Detection: UV (26 nm) MS (Negative-ion mode) Mass Spec: Q Exactive Plus Sample: 21mer sirna AGCUGACCCUGAAG S UUCAUdCdT O O Base Time (min) O S P O O R Base O R Rp Sp 18
19 LC/MS Analysis of Phosphorothioate Modified sirna Relative Abundance Peak 1: RT 4.36 min [M-4H] 4- Relative Abundance Peak 2: RT 4.93 min [M-4H] m/z 19
20 LC/MS Analysis of Phosphorothioate Modified sirna 1 Relative Abundance 56 UV Ion current Column: DNAPac RP, 4 µm Format: mm Mobile phase A: 35 mm TEA, 4 mm HFIP, ph 9.9 Mobile phase B: 35 mm TEA, 4 mm HFIP in Water / Methanol (75:25 v/v) Gradient: Time (min) %A %B Absorbance (mau) Temperature: 3 ºC Flow rate:.25 ml/min Inj. volume: 3 µl Detection: UV (26 nm) MS (Negative-ion mode) Mass Spec: Q Exactive Plus Sample: 21mer sirna AGCUGACCCUGAAGUUCAU S d S dt
21 LC/MS Analysis of Phosphorothioate Modified sirna 1 1 Peak 4: RT 4.96 min [M-4H] 4- Peak 1: RT 5.57 min [M-4H] PS/PO Relative Abundance 1 Peak 2: RT 5.76 min [M-4H] PS/PS 1 Peak 3: RT 5.93 min [M-4H] m/z 21
22 Analysis of CpG methylation Relative Abundance Absorbance (mau) 1 4 Ion current UV Column: DNAPac RP, 4 µm Format: mm Mobile phase A: 15 mm TEA, 4 mm HFIP, ph 7.6 Mobile phase B: 15 mm TEA, 4 mm HFIP in Water / Methanol (5:5 v/v) Gradient: Temperature: 6 ºC Flow rate:.25 Inj. volume: 3 µl Detection: Sample: Time (min) %A %B UV (26 nm) 1) CGGCATCCTTATTGG 2) /ime-dc/ggcatccttattgg Time (min) 22
23 Analysis of CpG methylation: Mass spectra Relative Abundance Relative Abundance Peak 1 Peak z= z=3 [M-3H] z=3 [M-3H] z= z= z= z= z= z= z= z= z= z= z= m/z 23
24 Separation of Fluorescein-Labeled DNA Absorbance (mau) 7 a Unmodified DNA Column: DNAPac RP, 4 µm Format: mm Mobile phase A:.1 M TEAA, ph 7. Mobile phase B:.1 M TEAA in Water / Acetonitrile (8:2 v/v) Gradient: Time (min) %A %B Absorbance (mau) 5 b Unmodified DNA Fluorescein labeled DNA Flow rate:.6 ml/min Inj. volume: 2.5 µl Temperature: 6 ºC Detection: UV (26 nm) Sample: a. 2mer DNA (6 µg/ml) b. Fluorescein labeled 2mer DNA (6 µg/ml) Retention Time (min) 24
25 Separation of Restriction Enzyme Digests of pdnas: Gel Restriction enzyme pdna 25
26 Separation of Restriction Enzyme Digests of pdnas: HPLC 45 a pbr322-bsuri digest Absorbance (mau) b ΦΧ174-BsuRI digest Absorbance (mau) Retention Time (min) 26
27 Separation of Thermo Scientific FastRuler DNA ladders 28 a Low Range k Absorban nce (mau) b Middle Range c High Range k 2k 5k 2k 4k 1k Retention Time (min) 27
28 Purification of a PCR product Absorban nce (mau) dntp impurities PCR product Column: DNAPac RP, 4 µm Format: mm Mobile phase A:.1 M TEAA, ph 7. Mobile phase B:.1 M TEAA in Water / Acetonitrile (75:25 v/v) Gradient: Flow rate:.25 Inj. volume: 5 µl Temperature: 5 ºC Detection: UV (26 nm) Sample: PCR product Time (min) %A %B Retention Time (min) 28
29 41mer RNA: Comparison with Competitors Absorban nce (mau) DNAPac RP 4 µm, 1,5Å Brand B, 3 µm, 1Å Brand D, 1.7 µm, 1Å Brand A, 1.7 µm, 13Å Format: mm Mobile phase A:.1 M TEAA, ph 7. Mobile phase B:.1 M TEAA in Water / Acetonitrile (9:1 v/v) Gradient: Temperature: 45 ºC Flow rate:.8 ml/min Inj. volume: 1 µl Detection: UV (26 nm) Sample: 41mer RNA Gradient slope: 1.73% B/min Gradient time: 7.5 min 34 Brand A, C µm, 13Å Retention Time (min) 29
30 Method Development Pre-Column Heater Gradient Curve Temperature Flow Rate Ion-Pair Reagent 3
31 Adjustment of Gradient Curve Absorba ance (mau) a b c d Column: DNAPac RP, 4 µm Format: mm Mobile phase A:.1 M TEAA, ph 7. Mobile phase B:.1 M TEAA in Water / Acetonitrile (25:75 v/v) Gradient: Time (min) %A %B Gradient curve: a) 5 (linear) b) 4 c) 3 d) 2 Temperature: 6 ºC Flow rate:.6 ml/min Inj. volume: 2 µl Detection: UV (26 nm) Sample: 8-Combo DNA (5 µm)* Retention Time (min) 31
32 Effect of Gradient Curve on Resolution 9 Effect of Gradient Curve on Resolution 8 7 Reso olution Length of DNA 32
33 Separation of Oligonucleotides at Different Temperatures Absorba ance (mau) 5 a b c d e f Retention Time (min) Column: DNAPac RP, 4 µm Format: mm Mobile phase A:.1 M TEAA, ph 7. Mobile phase B:.1 M TEAA in Water / Acetonitrile (25:75 v/v) Gradient: Time (min) %A %B Temperature: a) 3 ºC b) 4 ºC c) 5 ºC d) 6 ºC e) 7 ºC f) 8 ºC Flow rate:.4 ml/min Inj. volume: 2 µl Detection: UV (26 nm) Sample: 8-Combo DNA (5 µm)* 33
34 Effect of Temperature on Resolution g Effect of Temperature on Resolution Reso olution C 4 C 5 C 6 C 7 C 8 C Length of DNA 34
35 Separation of Oligonucleotides at Different Flow Rates 7 6 a b Column: DNAPac RP, 4 µm Format: mm Mobile phase A:.1 M TEAA, ph 7. Mobile phase B:.1 M TEAA in Water / Acetonitrile (75:25 v/v) Gradient: a) 12 to 36%B in 12 min. b) 12 to 36%B in 6 min. c) 12 to 36%B in 4 min. d) 12 to 36%B in 3 min. Absorba ance (mau) 6 c Gradient curve: 3 Temperature: 6 ºC Flow rate: a).2 b).4 c).6 d).8 5 d Inj. volume: 2 µl Detection: UV (26 nm) Sample: 8-Combo DNA (5 µm)* Retention Time (min) 35
36 Effect of Flow Rate on Resolution e Effect of Flow Rate on Resolution Reso olution Length of DNA 36
37 Comparison of TEA and HA as Ion-Pairing Reagents Absorbance (mau) 7 a Column: DNAPac RP, 4 µm Format: mm Mobile phases a) Mobile phase A:.1 M TEAA, ph 7. Mobile phase B:.1 M TEAA in Water / Acetonitrile (75:25 v/v) b) Mobile phase A:.1 M HA, ph 7.4 Mobile phase B:.1 M HA in Water / Acetonitrile (5:5 v/v) Absorbance (mau) 7 b Retention Time (min) Gradient: a) Time (min) %A %B b) Time (min) %A %B Gradient curve: 3 Temperature: 8 ºC Flow rate:.8 ml/min Inj. volume: 2 µl Detection: UV (26 nm) Sample: 8-Combo DNA (5 µm)* 37
38 Other Ion-Pairing Reagents 38 Rapid Commun. Mass Spectrom. 214, 28,
39 Comparison of TEA and HA as Ion-Pairing Reagents 8 a Column: DNAPac RP, 4 µm Format: mm Absorbance (mau) Absorbance (mau) 8 b Mobile phases a) Mobile phase A:.1 M TEAA, ph 7. Mobile phase B:.1 M TEAA in Water / Acetonitrile (75:25 v/v) b) Mobile phase A:.1 M HA, ph 7.4 Mobile phase B:.1 M HA in Water / Acetonitrile (5:5 v/v) Gradient: a) 8 to 32%B in 3 min. b) 23 to 63.5%B in 3 min. Gradient curve: 3 Flow rate:.8 ml/min Inj. volume: 2 µl Temperature: 8 ºC Detection: UV (26 nm) Sample: 8-Combo DNA (5 µm)* Peak label: Resolution (ep) Retention Time (min) 39
40 Effect of Oligonucleotide Diluent Absorbance (mau) Absorbance (mau) 7 7 a b Column: DNAPac RP, 4 µm Format: mm Mobile phase A:.1 M TEAA, ph 7. Mobile phase B:.1 M TEAA in Water / Acetonitrile (75:25 v/v) Gradient: Time (min) %A %B Gradient curve: 3 Flow rate:.6 Inj. volume: 2 µl Temperature: 6 ºC Detection: UV (26 nm) Sample: Sample diluent: 8-Combo DNA (5 µm)* a) Water b) Mobile phase A Retention Time (min) 4
41 Separation of Diastereoisomers of sirna at Different phs Absorbance (mau) Absorbance (mau) 1 4 ph 7.9 ph 9.9 Column: DNAPac RP, 4 µm Format: mm Mobile phase A: 15 mm TEA, 4 mm HFIP, ph 7.9 Mobile phase B: 15 mm TEA, 4 mm HFIP in Water / Methanol (75:25 v/v) Gradient: Time (min) %A %B Flow rate:.25 ml/min Inj. volume: 3 µl Temperature: 3 ºC Detection: UV (26 nm) MS (Negative-ion mode) Mass Spec: Q Exactive Plus Sample: 21mer sirna AGCUGACCCUGAAG S UUCAUdCdT O O Base Time (min) O S P O O R Base O R Rp Sp 41
42 Separation of Mobility Modifier DNA at Different phs 18 ph 7. Column: Format: DNAPac RP mm a) Mobile phase A:.1 M TEAA, ph 7. Mobile phase B:.1 M TEAA in Water / Acetonitrile (9:1 v/v) Absorban nce (mau) 13 ph 1. Desired product N-1 PEG b) Mobile phase A: Mobile phase B: Gradient:.5 M TEAA +.5% TEA, ph 1..5 M TEAA +.5% TEA in Water / Acetonitrile (5:5 v/v) a) 5-35% B in 7.5 minutes b) 5-4% B in 7.5 minutes N-2 PEG Temperature: 45 ºC Flow rate:.8 ml/min Inj. volume: 2 µl Detection: UV (26 nm) Sample: Sequencing primer labeled with fluorescein and contains at least 1 units of mobility modifier (ethylene oxide) Retention Time (min) 42
43 DNAPac PA2 RS vs DNAPac RP DNAPac PA2 RS Anion Exchange Chromatography DNAPac RP Ion-Pair Reversed Phase Chromatography Provides ultra-high resolution separation oligonucleotides Low or no organic solvent Cannot be directly coupled to Mass spectrometer Provides high resolution separation oligonucleotides Can be directly coupled to Mass spectrometer Excellent separation of long oligonucleotides and large dsdna fragments 43
44 ssdna: 8-Combo 6 DNAPac RP 3.x1 mm Absorbance (mau) DNAPac PA2 RS 4.6x15 mm Absorbance (mau) Retention Time (min) 44
45 dsdna: ΦΧ174-BsuRI digest 45 DNAPac RP 3.x1 mm 12 Absorbance (mau) DNAPac PA2 RS 4.6x15 mm Retention Time (min) Absorbance (mau)
46 DNAPac RP vs Competitors: ssdna DNAPac RP, 4 µm Brand A 1 Å, 1.7 µm 9 Brand B, 1 Å, 2.7 µm Absorbance (mau) Brand B 1 Å, 5 µm Brand C, 3 µm Retention Time (min)
47 DNAPac RP vs Competitors: dsdna 5 DNAPac RP, 4 µm Brand A 1 Å, 1.7 µm Absorba ance (mau) Brand B, 1 Å, 2.7 µm Brand C 1 Å, 5 µm 35 Brand D, 3 µm Retention Time (min) 47
48 Lot-to-Lot Variability: ssdna Absorbance (mau) Absorba ance (mau) Absorbance (mau) Lot Lot Lot
49 Lot-to-Lot Variability: dsdna Absorbance (mau) Absorba ance (mau) Absorbance (mau) Lot Lot Lot Retention Time (min) 49
50 Summary DNAPac RP is a polymer based reversed phase column DNAPac RP provides high resolution separation of single-stranded oligonucleotides LC/MS analysis of oligonucleotides can be achieved by using DNAPac RP column coupled with Thermo Scientific Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer Wide-pore size of DNAPac RP column provides high resolution separation of large double-stranded DNA/RNA fragments DNAPac RP can be used with high ph mobile phase and at high temperature which often provides alternative selectivity and higher resolution for more challenging samples DNAPac RP has minimal lot-to-lot variability 5
51 Thank You! 51
Fast and High-Resolution Reversed-Phase Separation of Synthetic Oligonucleotides
Fast and High-Resolution Reversed-Phase Separation of Synthetic Oligonucleotides High-pH-stable, superficially porous particle columns for LC/UV and LC/MS Application Note Biologics and Biosimilars Authors
mabs and ADCs analysis by RP
mabs and ADCs analysis by RP Shanhua Lin, Ph.D. The world leader in serving science Protein and mab Separation by HPLC Size difference? YES Size Exclusion Chromatography (SEC) MAbPac SEC-1 NO NO Charge
Martin Gilar Waters Corporation, Milford, MA, U.S. Origins of synthetic oligonucleotides impurities. Lab-scale isolation options
LIGNUCLETIDE SEPARATIN TECHNLGY: SYNTHESIS CHALLENGES AND HPLC ISLATIN PTINS Martin Gilar Waters Corporation, Milford, MA, U.S. INTRDUCTIN rigins of synthetic oligonucleotides impurities Use of synthetic
Clarity BioSolutions For Synthetic DNA/RNA Advance Your. Oligonucleotide Work. From Sample Preparation to Analysis and Purification
Clarity BioSolutions For Synthetic DNA/RNA Advance Your Oligonucleotide Work From Sample Preparation to Analysis and Purification Optimized Oligonucleotide Purification and Analysis Designed to efficiently
BioHPLC columns. Tim Rice Biocolumn Technical Specialist
BioHPLC columns Tim Rice Biocolumn Technical Specialist AU Typical Application Areas Size Exclusion: Aggregation Analysis Ion Exchange: Charge Isoform Analysis 0.035 Monomer 0.030 0.025 0.020 0.015 Dimer
Oligonucleotide Separation Technology
Oligonucleotide Separation Technology [ 1 ] Oligonucleotide Separation Technology Waters Oligonucleotide Separation Technology (OST) columns contain second-generation hybrid silica BEH Technology particles
4/4/2013. BioHPLC columns. Paul Dinsmoor Biocolumn Technical Specialist. April 23-25, Size Exclusion BioHPLC Columns
BioHPLC columns Paul Dinsmoor Biocolumn Technical Specialist April 23-25, 2013 Size Exclusion BioHPLC Columns 1 NEW Size Exclusion Columns 5 m Particle 100Å, 150Å, 300Å, 500Å, 1000Å, 2000Å pore sizes High
Purification of Oligonucleotides by Ion-pair Chromatography on Hybrid Silica Particles
Purification of Oligonucleotides by Ion-pair Chromatography on Hybrid Silica Particles WCBP 2001, Washington DC, February 20, 2001 Poster #: P-03-F Paul Rainville, Martin Gilar, Jeff R. Mazzeo, and Reb
Application of Agilent AdvanceBio Desalting-RP Cartridges for LC/MS Analysis of mabs A One- and Two-dimensional LC/MS Study
Application of Agilent AdvanceBio Desalting-RP Cartridges for LC/MS Analysis of mabs A One- and Two-dimensional LC/MS Study Application note Biotherapeutics and Biologics Authors Suresh Babu C.V., Anne
Development of Analysis Methods for Therapeutic Monoclonal Antibodies Using Innovative Superficially Porous Particle Biocolumns
Development of Analysis Methods for Therapeutic Monoclonal Antibodies Using Innovative Superficially Porous Particle Biocolumns Anne Blackwell Bio Columns Product Support Scientist Suresh Babu Senior Application
HIC as a Complementary, Confirmatory Tool to SEC for the Analysis of mab Aggregates
HIC as a Complementary, Confirmatory Tool to SEC for the Analysis of mab Aggregates Julia Baek, Shanhua Lin, Xiaodong Liu, Thermo Fisher Scientific, Sunnyvale, CA Application Note 2126 Key Words Size exclusion
PLRP-S Polymeric Reversed-Phase Column for LC/MS Separation of mabs and ADC
PLRP-S Polymeric Reversed-Phase Column for LC/MS Separation of mabs and ADC Analysis of Intact and Fragmented mabs and ADC Application Note Biotherapeutics and Biologics Author Suresh Babu C.V. Agilent
Rapid Extraction of Therapeutic Oligonucleotides from Primary Tissues for LC/ MS Analysis Using Clarity OTX, an Oligonucleotide Extraction Cartridge
Rapid Extraction of Therapeutic Oligonucleotides from Primary Tissues for LC/ MS Analysis Using Clarity OTX, an Oligonucleotide Extraction Cartridge G. Scott*, H. Gaus #, B. Rivera*, and M. McGinley* *Phenomenex,
Comparing Performance of High-Throughput, Trityl-on RNA/DNA Purification Products Author: Greg Scott
Application Note: TN-9 Comparing Performance of High-Throughput, Trityl-on RNA/DNA Purification Products Author: Greg Scott Introduction C larity QSP, which is part of Phenomenex s Clarity BioSolutions
Fast and Efficient Peptide Mapping of a Monoclonal Antibody (mab): UHPLC Performance with Superficially Porous Particles
Fast and Efficient Peptide Mapping of a Monoclonal Antibody (mab): UHPLC Performance with Superficially Porous Particles Application Note Biotherapeutics and Biosimilars Authors James Martosella, Alex
A highly sensitive and robust 150 µm column to enable high-throughput proteomics
APPLICATION NOTE 21744 Robust LC Separation Optimized MS Acquisition Comprehensive Data Informatics A highly sensitive and robust 15 µm column to enable high-throughput proteomics Authors Xin Zhang, 1
Thermo Scientific LC Columns for Biomolecules
LC Columns and Accessories Thermo Scientific Chromatography Columns and Consumables 2014-2015 Thermo Scientific LC Columns for Biomolecules The diversity of biological samples in terms of compound structure
Analysis of Monoclonal Antibodies and Their Fragments by Size Exclusion Chromatography Coupled with an Orbitrap Mass Spectrometer
Analysis of Monoclonal Antibodies and Their Fragments by Size Exclusion Chromatography Coupled with an Orbitrap Mass Spectrometer Shanhua Lin, 1 Hongxia Wang, 2 Zhiqi Hao, 2 Patrick Bennett, 2 and Xiaodong
Fast mass transfer Fast separations High throughput and improved productivity Long column lifetime Outstanding reproducibility Low carryover
columns ProSwift Reversed-Phase Monolith Columns for Protein Analysis ProSwift reversed-phase columns use a unique monolith technology for fast, high-resolution HPLC and LC/MS separations of proteins.
Genotoxicity is the property of a compound
Impurities Analysis in Pharmaceuticals: Genotoxicity is the property of a compound known to have irreversible effects on the structure and functionality of the DNA in cells and cause DNA loss, DNA replication
Thermo Scientific Technical Resources Document 1.5. LC Columns and Accessories. for Biomolecules
1.5 1.0 0.5 Thermo Scientific Technical Resources Document LC Columns and Accessories for Biomolecules Section Contents Introduction...4-002 Bio Columns Selection Guide...4-003 HPLC s for Biomolecules...4-004
DNA Synthesis With IRDye 700 Phosphoramidite. Part #
DNA Synthesis With IRDye 700 Phosphoramidite Part #4200-33 Page 2 DNA Synthesis With IRDye 700 Phosphoramidite Principle and Scope The phosphoramidite of the near IR fluorescent dye, IRDye 700, can be
Analysis and Purification of Polypeptides by Reversed-Phase HPLC
Analysis and Purification of Polypeptides by Reversed-Phase HPLC Reversed-phase HPLC is a valuable tool for the analysis and purification of proteins and peptides. It is effective in separating peptide
DNA PURIFICATION BY REVERSED PHASE AND ANION EXCHANGE HPLC
DNA PURIFICATION BY REVERSED PHASE AND ANION EXCHANGE HPLC Hamilton Company offers three HPLC columns for the separation and purification of synthesized DNA. Two for reversed phase gradient elution chromatography:
Combining High Temperature and Small Particles: The Advantages of Zirconia
Combining High Temperature and Small Particles: The Advantages of Zirconia EAS 9 Dan owlan 1, Bingwen Yan 1, Clayton V. Mceff 1, R.A. Henry 1 ZirChrom Separations, Inc. 617 Pierce St., Anoka, M 5533 Independent
AdvanceBio Peptide Mapping
AdvanceBio Peptide Mapping An HPLC Column Technology for Faster Protein Biocharacterizations Tim Rice BioColumn Technical Specialist 1 What Is Peptide Mapping? The chemical or enzymatic treatment of a
Laboratory Reagents. for life science research.
Laboratory Reagents Research, quality control, or routine analysis whatever the field of activity, where there is a need for laboratory reagents, Thermo Fisher Scientific has a suitable product. We offer
Nucleic acid therapeutics. applications notebook
Nucleic acid therapeutics applications notebook Table of Contents Introduction...3 Analysis of Nucleic Acids...5 Analysis of Phosphorothioate Oligonucleotides...6 Analysis of ss- and dsrna...8 Anion-Exchange
A Complete Workflow Solution for Intact Monoclonal Antibody Characterization Using a New High-Performance Benchtop Quadrupole- Orbitrap LC-MS/MS
A Complete Workflow Solution for Intact Monoclonal Antibody Characterization Using a New High-Performance Benchtop Quadrupole- Orbitrap LC-MS/MS Zhiqi Hao, 1 Yi Zhang, 1 David Horn, 1 Seema Sharma, 1 Shiaw-Lin
Roche Molecular Biochemicals Technical Note No. LC 9/2000
Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats
Roche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
Bivalirudin Purification:
Bivalirudin Purification: Sorbent Screening and Overload Experiments Marc Jacob, Joshua Heng, and Tivadar Farkas Phenomenex, Inc., 411 Madrid Ave., Torrance, CA 90501 USA PO94190412_W Abstract In this
Size Exclusion Chromatography
Size Exclusion TSKgel PW-type PW PW XL TOSOH BIOSCIENCE TOSOH BIOSCIENCE LLC 156 Keystone Drive Montgomeryville, PA 18936-9637 Orders & Service: (800)366-4875 Fax: (215)283-5035 www.tosohbioscience.com
Reversed Phase Solutions for the Analysis of Proteins, Peptides, and Oligonucleotides
Reversed Phase Solutions for the Analysis of Proteins, Peptides, and Oligonucleotides The line, which includes and Proteo, offers various reversed phase solutions for biochromatography. With these two
2012 Waters Corporation 1
UPLC User meeeting April 2012 Principles and Practices for SEC, IEX for Intact Protein Analysis by UPLC anders_feldthus@waters.com 2012 Waters Corporation 1 Agenda Ion-Exchange Chromatography Theory and
Fast and High Resolution Analysis of Intact and Reduced Therapeutic Monoclonal Antibodies (mabs)
Fast and High Resolution nalysis of Intact and Reduced Therapeutic Monoclonal ntibodies (mbs) The gilent io-inert L and dvanceio RP-mb olumns pplication Note io-pharmaceutical uthor M. Sundaram Palaniswamy
Precise Characterization of Intact Monoclonal Antibodies by the Agilent 6545XT AdvanceBio LC/Q-TOF
Precise Characterization of Intact Monoclonal Antibodies by the Agilent 6545XT AdvanceBio LC/Q-TOF Application Note Author David L. Wong Agilent Technologies, Inc. Santa Clara, CA, USA Introduction Monoclonal
Analysis of TCM injections using the Agilent 1290 Infinity LC system
Analysis of TCM injections using the Agilent 1290 Infinity LC system Application Note Traditional Chinese Medicine Authors Zhixiu Xu Agilent Technologies Shanghai Shanghai 200131 China mau 400 350 300
Biomolecule Purification. Purification columns and media for peptides, oligonucleotides, and proteins
Biomolecule Purification Purification columns and media for peptides, oligonucleotides, and proteins Highest quality, highest performance Rigid polymerics for high-quality prep-to-process chromatography
Technical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
Analysis of Intact and C-terminal Digested IgG1 on an Agilent Bio MAb 5 µm Column
Analysis of Intact and C-terminal Digested IgG1 on an Agilent Bio MAb µm Column Application Note BioPharma Authors Xiaomi Xu and Phu T Duong Agilent Technologies, Inc. Abstract Nearly all proteins undergo
TSKgel STAT Columns for High Performance Ion Exchange Chromatography
Separation Report No. 09 TSKgel STAT Columns for High Performance Ion Exchange Chromatography Table of Contents. Introduction. Basic Characteristics of TSKgel STAT Columns - Characteristics of Packing
CQA Assessment by Peptide Mapping Using LC/MS with an AdvanceBio Peptide Plus Column
CQA Assessment by Peptide Mapping Using LC/MS with an AdvanceBio Peptide Plus Column Anne Blackwell, Ph.D. BioColumns Product Support Scientist June 7, 27 ASMS Analytical groups are tasked with method
AdvancedTools in HPLC methoddevelopment
AdvancedTools in HPLC methoddevelopment Remco Stol, Enrico Martina and Jeffrey Vos Analytical Sciences Chemistry, Quality Unit API/BT NL FHI symposium, Houten, 22 april 2010 What does the customer want?
Improved Peptide Maps Using Core-Shell Media: Explaining Better Biopharmaceutical Applications With Kinetex C18 Columns
Improved Peptide Maps Using Core-Shell Media: Explaining Better Biopharmaceutical Applications With Kinetex C18 Columns Michael McGinley, Jeff Layne, and Vita Knudson Phenomenex, Inc., 411 Madrid Ave.,Torrance,
Heart-cut 2D-LC/MS approach for pharmaceutical impurity identification using an Agilent 6540 Q-TOF LC/MS System
Heart-cut 2D-LC/M approach for pharmaceutical impurity identification using an Agilent 640 Q-TF LC/M ystem Application ote Pharmaceuticals Author iji Joseph Agilent Technologies, Inc. Bangalore, India
Kinetics Review. Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets)
Quiz 1 Kinetics Review Tonight at 7 PM Phys 204 We will do two problems on the board (additional ones than in the problem sets) I will post the problems with solutions on Toolkit for those that can t make
Thermo Scientific DNAPac Family of Columns. Superior. Oligonucleotide Analysis
Thermo Scientific DNAPac Family of Columns Suerior Olionucleotide Analysis SUPERIOR Olionucleotide Analysis Nucleic acid analysis is imortant for characterization of theraeutics, amlification rimers or
Method Translation in Liquid Chromatography
Method Translation in Liquid Chromatography Technical Overview Abstract Ronald E. Majors Agilent Technologies, Inc. 2850 Centerville Rd Wilmington, DE 19808 USA With the recent emphasis on high performance
Maximizing Chromatographic Resolution of Peptide Maps using UPLC with Tandem Columns
Maximizing Chromatographic Resolution of Peptide Maps using UPLC with Tandem Columns Hongwei Xie, Martin Gilar, and Jeff Mazzeo Waters Corporation, Milford, MA U.S. APPLICATION BENEFITS The ACQUITY UPLC
DNA Hybridization and Detection
Chapter 6 DNA Hybridization and Detection Fluorescence Polarization Detection of DNA Hybridization........................................................ 6-2 Introduction.............................................................................................................
Molecular Biology (1)
Molecular Biology (1) DNA structure and basic applications Mamoun Ahram, PhD Second semester, 2017-2018 Resources This lecture Cooper, pp. 49-52, 118-119, 130 What is molecular biology? Central dogma
N-Glycan Profiling Analysis of a Monoclonal Antibody Using UHPLC/FLD/Q-TOF
N-Glycan Profiling Analysis of a Monoclonal Antibody Using UHPLC/FLD/Q-TOF Application Note Authors Xianming Liu, Wei Zhang, Yi Du, Sheng Yin, Hong Que, and Weichang Zhou WuXi AppTec iopharmaceuticals
Improving Resolution and Column Loading Systematically in Preparative Liquid Chromatography for Isolating a Minor Component from Peppermint Extract
Improving Resolution and Column Loading Systematically in Preparative Liquid Chromatography for Isolating a Minor Component from Peppermint Extract Jo-Ann M. Jablonski and Rui Chen Waters Corporation,
GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual
GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.
Analysis of Monoclonal Antibodies and Their Fragments by Size-Exclusion Chromatography Coupled with an Orbitrap Mass Spectrometer
Analysis of Monoclonal Antibodies and Their Fragments by ize-exclusion Chromatography Coupled with an Orbitrap Mass pectrometer hanhua Lin, Hongxia Wang, Zhiqi Hao, and Xiaodong Liu Thermo Fisher cientific,
Optimizing the Purification of a Standard Chiral Compound Utilizing a Benchtop, Multi-Purpose, Semi-Preparative to Preparative HPLC System
Optimizing the Purification of a Chiral Compound Utilizing a Benchtop, Multi-Purpose, Semi-Preparative to Preparative HPLC System Application Note PHA0111 Keywords Chiral, Enantiomer, HPLC, Normal Phase
Improved SPE for UPLC/MS Determination of Diquat and Paraquat in Environmental
Improved SPE for UPLC/MS Determination of Diquat and Paraquat in Environmental Samples Michael S.Young, Jeremy C. Shia, Kim vantran, Kevin M. Jenkins and Masayo Yabo Waters Corporation 34 Maple Street,
Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...
Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.
Microarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays Aminoallyl Method AfCS Procedure Protocol PP Version 1, 10/20/03
Microarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays AfCS Procedure Protocol PP00000184 Version 1, 10/20/03 The following procedure details the preparation of fluorescently labeled
HPLC to UPLC Method Migration: An Overview of Key Considerations and Available Tools
HPLC to UPLC Method Migration: An Overview of Key Considerations and Available Tools Dr. Michael Swartz, Ph. D. Principal Consulting Scientist Worldwide Pharmaceutical Business Operations Waters Corporation
Promix TM. Enter a New Era in Biomolecule Analysis with. Columns. Unsurpassed Selectivity and Peak Capacity for Peptides and Proteins
Promix TM Enter a New Era in Biomolecule Analysis with Promix TM Columns Unsurpassed electivity and Peak Capacity for Peptides and Proteins Applications: Proteomics Peptide/Protein Analysis Peptide/Protein
ReverTra Ace qpcr RT Master Mix
Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template
P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
Application Note # ET-20 BioPharma Compass: A fully Automated Solution for Characterization and QC of Intact and Digested Proteins
Application Note # ET-20 BioPharma Compass: A fully Automated Solution for Characterization and QC of Intact and Digested Proteins BioPharma Compass TM is a fully automated solution for the rapid characterization
Product Specifications & Manual
Product Specifications & Manual Custom Oligo Synthesis, antisense oligos, RNA oligos, chimeric oligos, Fluorescent dye labeled oligos, Molecular Beacons, sirna, phosphonates Affinity Ligands, 2-5 linked
User Guide for the Fluorous Affinity Purification of Oligonucleotides
T A B L E O F C O N T E N T S User Guide for the Fluorous Affinity Purification of Oligonucleotides Fluoro-Pak Columns and Fluorous Phosphoramidites Table of Contents Introduction....................................................
Zwitterion Chromatography ZIC
Zwitterion Chromatography ZIC A novel technique, with unique selectivity, suitable for preparative scale separations? PhD Einar Pontén What is Zwitterion Chromatography? Our definition: Liquid chromatography
Supplementary Material
Supplementary Material Gene Inactivation Study on gntk, a Putative C-methyltransferase Gene in Gentamicin Biosynthesis from Micromonospora echinospora Suman Karki Jin-Yong Kim Si-Hyung Park Hyung-Jin Kwon
Application Note. Kwasi Antwi, Amanda Ribar, Urban A. Kiernan, and Eric E. Niederkofler Thermo Fisher Scientific, Tempe, Arizona
Analysis of an Antibody Drug Conjugate using MSIA D.A.R.T. S. Technology, an Integral Part of Ligand Binding Mass Spectrometric Immunoassay (LB-MSIA) Workflow Application Note Kwasi Antwi, Amanda Ribar,
Fluorous Affinity Purification of Oligonucleotides
Fluorous Affinity Purification of Oligonucleotides A higher affinity alternative to RP cartridge purification. One-pass loading without ammonia removal. High recoveries (typically 70-100%). High selectivity
High-Throughput Peptide Mapping with the Vanquish UHPLC System and the Q Exactive HF Mass Spectrometer
High-Throughput Peptide Mapping with the Vanquish UHPLC System and the Q Exactive HF Mass Spectrometer Martin Samonig 1, Kai Scheffler 2, Remco Swart 1, and Jonathan Josephs 3 1 Thermo Fisher Scientific,
Application Note LCMS-87 Automated Acquisition and Analysis of Data for Monitoring Protein Conjugation by LC-MS Using BioPharma Compass
Application Note LCMS-87 Automated Acquisition and Analysis of Data for Monitoring Protein Conjugation by LC-MS Using BioPharma Compass Abstract Here we describe the development and use of an automated
Thermo Scientific Peptide Mapping Workflows. Upgrade Your Maps. Fast, confident and more reliable peptide mapping.
Thermo Scientific Peptide Mapping Workflows Upgrade Your Maps Fast, confident and more reliable peptide mapping. Smarter Navigation... Peptide mapping is a core analytic in biotherapeutic development.
SEC-MS with Volatile Buffers for Characterization of Biopharmaceuticals
SE-MS with Volatile uffers for haracterization of iopharmaceuticals Martin Samonig, Remco Swart Thermo Fisher Scientific, Germering, Germany pplication Note 1133 Key Words Monoclonal ntibodies, MbPac SE-1,
Rapid Soft Spot Analysis using the SCIEX Routine Biotransform Solution
Rapid Soft Spot Analysis using the SCIEX Routine Biotransform Solution Rapidly Identify Top Metabolites with the SCIEX X500R QTOF System and MetabolitePilot TM 2.0 Software Shaokun Pang and Ian Moore SCIEX,
Rapid Peptide Mapping via Automated Integration of On-line Digestion, Separation and Mass Spectrometry for the Analysis of Therapeutic Proteins
Rapid Peptide Mapping via Automated Integration of On-line Digestion, Separation and Mass Spectrometry for the Analysis of Therapeutic Proteins Esther Lewis, 1 Kevin Meyer, 2 Zhiqi Hao, 1 Nick Herold,
High Resolution Analysis of Heparin and Heparin-like Impurities on Glycomix TM an Anion Exchange Column
High Resolution Analysis of and -like Impurities on Glycomix TM an Anion Exchange Column Authors Xiaomi Xu Yuna Li Aiyan Cui Haiying Chen Sepax Technologies, Inc. 5 Innovation Way Newark, DE 19711 USA
Supporting Information
Supporting Information Wiley-VCH 26 69451 Weinheim, Germany A new homogenous assay for studying mira maturation Brian Patrick Davies and Christoph Arenz General Information For MALDI-TF measurements a
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
APPLICATIONS TN Overview of Kinetex 2.6 µm Core-Shell Technology
TN-7 Determination of Impurities and Related Substances for Glibenclamide (EP Monograph 78). Increased Sensitivity, Improved Resolution and Faster Analysis Using Kinetex.6 µm Core-Shell LC Columns Elli
MAbPac SCX-10 Column for Monoclonal Antibody Variant Analysis and Characterization
CHROMTOGRPHY MbPac SCX- Column for Monoclonal ntibody Variant nalysis and Characterization Product Specifications The Thermo Scientific MbPac SCX- columns separate closely-related monoclonal antibody variants
Artificial Nucleic Acids -Their Developments and Recent Applications
Artificial Nucleic Acids -Their Developments and Recent Applications Bioorganic Chemistry Laboratory D2 Kenichiro Ito Organic Seminar 2012/5/7 1 Nucleic acids play central roles in life Replication Transcription
Presented at the 51st Annual ASMS Conference on Mass Spectrometry and Allied Topics Montreal, 2003
FRET Measurements of Trapped Oligonucleotide Anions Allison S. Danell and Joel H. Parks ROWLAND INSTITUTE AT HARVARD, 100 EDWIN LAND BLVD., CAMBRIDGE, MA 02142 Presented at the 51st Annual ASMS Conference
R R Innovation Way P/N SECKIT-7830 Newark, DE 19711, USA Tel: Fax: Website: Published in November 2013
5-100 Innovation Way Newark, DE 19711, USA Tel:302-3661101 Fax:302-3661151 Website: www.sepax-tech.com Published in November 2013 P/N SECKIT-7830 These Phases are developed based on innovative surface
SMART Digest Kit User Manual. Version 2
SMART Digest Kit User Manual Version 2 XX21543 Revision A August 2016 SMART Digest Kit Delivering simple, fast and reproducible digestion of proteins Thermo Scientific SMART Digest kits are designed for
New Core-Shell Technology
New Core-Shell Technology Fortis Speedcore columns are the very latest in core-shell technology. Incorporating our optimised bonding and packing practices with a core-shell particle provides the analyst
Concentration of Human Hormones in Drinking Water Using Solid Phase Extraction and Analysis by High Performance Liquid Chromatography
Concentration of Human Hormones in Drinking Water Using Solid Phase Extraction and Analysis by High Performance Liquid Chromatography Carl Fisher, Monika Verma, and Pranathi Perati; Thermo Fisher Scientific,
Analysis of Glyphosate and AMPA in Environmental Water Samples by Ion Chromatography and On-Line Mass Spectrometry with Minimal Sample Preparation
Analysis of Glyphosate and AMPA in Environmental Water Samples by Ion Chromatography and On-Line Mass Spectrometry with Minimal Sample Preparation Cees Bruggink, Frans Schoutsen Thermo Fisher Scientific,
Analysis of Intact Monoclonal Antibodies Using an M3 MicroLC with the TripleTOF 6600
Procedures Analysis of Intact Monoclonal Antibodies Using an M3 MicroLC with the TripleTOF 66 Robust and Sensitive Workflow for Qualitative and Quantitative Analysis of Biotherapeutic IgGs Khatereh Motamedchaboki,
Determination of Adenovirus pviii (31K) Concentration for Estimation of the Empty Capsid Concentration of the Adenovirus Reference Material (ARM)
Determination of Adenovirus pviii (31K) Concentration for Estimation of the Empty Capsid Concentration of the Adenovirus Reference Material (ARM) Sundari Ravindran, Mei Lin, Gary Vellekamp, (SPRI) Summary:
Ion Chromatography Coupled to MS, a Powerful Approach for Polar Pesticides Determination
Ion Chromatography Coupled to MS, a Powerful Approach for Polar Pesticides Determination Dott. Luca Gerardo IC/SP Application Specialist, Thermo Fisher Scientific, Rodano (MI) The world leader in serving
Development and evaluation of Nano-ESI coupled to a triple quadrupole mass spectrometer for quantitative proteomics research
PO-CON138E Development and evaluation of Nano-ESI coupled to a triple quadrupole mass spectrometer for quantitative proteomics research ASMS 213 ThP 115 Shannon L. Cook 1, Hideki Yamamoto 2, Tairo Ogura
Separation of Recombinant Human Erythropoietin (repo) Using Agilent Bio SEC-3
Separation of Recombinant Human Erythropoietin (repo) Using Agilent Bio SEC-3 Application Note BioPharma Authors Phu T Duong and James Martosella Agilent Technologies, Inc. 285 Centerville Rd, Wilmington,
XactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
Technical Data. Analytical Data
Technical Data High resolution analysis of monoclonal antibodies utilizing cation exchange column YMC-BioPro SP-F Analysis of Monoclonal Antibody (MAb) Pharmaceuticals Using Non-Porous Type Ion Exchange
Reverse Transcriptase Reverse Transcriptase 100 µl 5X RT Buffer 0.1 M DTT 500 µl Storage -20 C for 24 months
www.smobio.com Product Information Reverse Transcriptase ExcelRT series RP1000 20,000 units Reverse Transcriptase 100 µl 5X RT Buffer 1 ml 0.1 M DTT 500 µl Storage -20 C for 24 months Description The ExcelRT
Two-Dimensional LC Protein Separation on Monolithic Columns in a Fully Automated Workflow
Technical Note Two-Dimensional LC Protein Separation on Monolithic Columns in a Fully Automated Workflow Introduction The complex nature of proteomics samples requires high-resolution separation methods
Choosing the Right Calibration for the Agilent Bio SEC-3 Column
Choosing the Right Calibration for the Agilent Bio SEC-3 Column Application Note Biotherapeutics & Biosimilars Author Keeley Mapp Agilent Technologies, Inc Introduction Size exclusion chromatography (SEC)