Isolating the Ends of Genomic DNA Fragments Cloned in High-capacity Vectors: Vectorette Polymerase Chain Reactions

Size: px

Start display at page:

Download "Isolating the Ends of Genomic DNA Fragments Cloned in High-capacity Vectors: Vectorette Polymerase Chain Reactions"

Margaret Parker
5 years ago
Views:

1 1 of 5 4/29/2009 3:08 PM Cite as: Cold Spring Harb. Protoc.; 2006; doi: /pdb.prot4009 Protocol Isolating the Ends of Genomic DNA Fragments Cloned in High-capacity Vectors: Vectorette Polymerase Chain Reactions Joseph Sambrook and David W. Russell This protocol was adapted from Molecular Cloning, 3rd edition, by Joseph Sambrook and David W. Russell. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, 2001 INTRODUCTION This protocol describes the use of vectorette PCR and single-site PCR to amplify the terminal sequences of genomic sequences cloned in high-capacity vectors such as PACs and YACs. MATERIALS 10x Amplification buffer Include 0.01% (w/v) gelatin in the buffer. 10x Bacteriophage T4 DNA ligase buffer Bacteriophage T4 DNA ligase Ethanol Optional, please see Step 5. Oligonucleotide (linker) primer (5.0 OD 260 /ml [approx. 17 µm]) in TE (ph 7.6) 5'CATGCTCGGTCGGGATAGGCACTGGTCTAGAG3' This oligonucleotide is identical in sequence to the 32 nucleotides at the 5' end of the oligonucleotide cassette and is used as an amplimer in the PCR. There is no need to purify or phosphorylate the deprotected oligonucleotide before use. Dissolve the oligonucleotide in TE (ph 7.6) at a concentration of 5.0 OD 260 /ml solution (approx. 17 µm). Oligonucleotide cassette (5.0 OD 260 /ml [approx. 8.5 µm]) in TE (ph 7.6) 5'CATGCTCGGTCGGGATAGGCACTGGTCTAGAGGGTTAGGTTCCTGCTACATCTCCAGCCTTGCA3' This 64-nucleotide single-stranded cassette is designed for ligation to target DNAs carrying termini generated by PstI or NsiI. The four 3'-terminal nucleotides (underlined) are complementary to the protruding termini of fragments of DNA generated by cleavage with these enzymes. If another restriction enzyme is used, the nucleotides at the 3' end of the linker must be changed so as to complement the protruding terminus generated by the enzyme. Before use, the oligonucleotide should be purified by C 18 chromatography or electrophoresis through a 12% polyacrylamide gel. The 5' terminus of the oligonucleotide should not be phosphorylated. Phenol:chloroform (1:1, v/v) Restriction endonucleases PstI or NsiI

2 2 of 5 4/29/2009 3:08 PM Sequence-specific oligonucleotide (vector) primer (5.0 OD 260 /ml [approx. 17 µm]) in TE (ph 7.6) This primer is complementary to the vector when terminal sequences of a cloned segment of DNA are to be amplified or to cloned DNA sequences when a neighboring segment of genomic DNA is to be recovered. The primer should be nucleotides in length and its predicted melting temperature should be approximately equal to that of the 32-nucleotide oligonucleotide primer. There is no need to purify or phosphorylate the deprotected oligonucleotide before use. Dissolve the oligonucleotide in TE (ph 7.6) at a concentration of 5.0 OD 260 /ml solution (approx. 17 µm). Sodium acetate (3 M, ph 5.2) Template DNAs Template may be recombinant BAC, YAC, or cosmid DNA. YACs can either be embedded in an agarose plug (2 µg in 100-µl plug) or in solution. Unless the yeast strain is carrying more than one YAC, there is no need to purify YAC DNA by PFGE before use in vectorette or single-site PCR. DNAs should be purified by column chromatography using, e.g., Qiagen resin or GeneClean II (please see Purification of Plasmid DNA by Chromatography), and resuspended at a concentration of 1 µg/µl in TE (ph 7.6). Thermostable DNA polymerase For advice on which enzyme to use, please see Table in Protocol 5 in the print version of the manual. This protocol has been written with AmpliTaq CS in mind, but it will work well for thermostable enzymes with similar properties. dntps (1 mm) containing all four dntps (ph 8.0; PCR grade) METHOD 1. Digest approx. 5 µg of template DNA with PstI or NsiI. Check a small aliquot of the reaction by agarose gel electrophoresis to ensure that all of the DNA has been cleaved. 2. Extract the reaction mixture with phenol:chloroform, and recover the DNA by standard precipitation with ethanol and subsequent washing in 70% ethanol. Store the open tube in an inverted position on a bed of paper towels to allow the last traces of ethanol to evaporate, and then dissolve the damp pellet of DNA in 50 µl of H 2 O. 3. In a sterile 0.5-ml microcentrifuge tube, mix in the following order: 10x T4 DNA ligase buffer 10 µl digested template DNA 20 µl oligonucleotide cassette, 5.0 OD 260 /ml 2 µl T4 bacteriophage DNA ligase, 5 Weiss units/µl 2 µl H 2 O to 100 µl Set up three control reactions as described above but without template DNA in one tube, without linker oligonucleotide in another, and without T4 DNA ligase in the third. 4. Incubate the test ligation reaction and controls for hours at 15'C.

3 3 of 5 4/29/2009 3:08 PM 5. In a sterile 0.5-ml microcentrifuge tube, mix in the following order: 10x amplification buffer 2 µl 1 mm solution of four dntps (ph 7.0) 2 µl linker primer oligonucleotide, 5.0 OD 260 /ml 1 µl vector primer oligonucleotide, 5.0 OD 260 /ml 1 µl test DNA ligation reaction, from Step 4 1 µl thermostable DNA polymerase, 5.0 units/µl 0.5 µl H 2 O to 20 µl Set up three control PCRs that contain 1 µl of the control ligation reactions instead of the test ligation reaction. 6. If the thermal cycler is not fitted with a heated lid, overlay the reaction mixtures with 1 drop (approx. 50 µl) of light mineral oil to prevent evaporation of the samples during repeated cycles of heating and cooling. Alternatively, place a bead of wax into the tube if using a hot-start approach. 7. Place the PCR tubes in the thermal cycler, programmed as follows, and start the amplification program. Cycle Number Denaturation Annealing Polymerization 1 2 min at 95'C sec at 94 C 30 sec at 60 C 3 min at 72 C Last 5 min at 72 C 8. Analyze aliquots (25%) of each amplification reaction on an agarose gel. A prominent DNA product visible by ethidium bromide staining should be present in the PCR containing the products of the test ligation. This DNA should be absent from the control reactions. The size of the product depends on the distance between the vector primer and the first cleavage site in the cloned insert. For PstI and NsiI, the amplified product is typically between 0.5 kb and 2 kb. The amplified DNA can be sequenced directly, cloned, radiolabeled by random hexamer priming or PCR, and even used as a transcription template if a bacteriophage promoter is added to the linker or is present in the amplified segment of vector DNA. REFERENCES 1. Allen, M.J., Collick, A., and Jeffreys, A.J Use of vectorette and subvectorette PCR to isolate transgene flanking DNA. PCR Methods Appl. 4: [Medline] 2. Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J.C., and Markham, A.F A novel rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res. 18: [Abstract/Free Full Text] 3. MacGregor, G.R. and Overbeek, P.A Use of a simplified single-site PCR to facilitate cloning of genomic DNA sequences flanking a transgene integration site. PCR Methods Appl. 2006: Caution

4 4 of 5 4/29/2009 3:08 PM Phenol:chloroform Phenol is extremely toxic, highly corrosive, and can cause severe burns. It may be harmful by inhalation, ingestion, or skin absorption. Wear appropriate gloves, goggles, and protective clothing. Always use in a chemical fume hood. Rinse any areas of skin that come in contact with phenol with a large volume of water and wash with soap and water; do not use ethanol! Chloroform (CHCl 3 ) is irritating to the skin, eyes, mucous membranes, and respiratory tract. It is a carcinogen and may damage the liver and kidneys. It is also volatile. Avoid breathing the vapors. Wear appropriate gloves and safety glasses. Always use in a chemical fume hood. Caution Sodium acetate (NaOAc) Sodium acetate (NaOAc), see Acetic acid Amplification Buffer, 10X 500 mm KCl 100 mm Tris-Cl (ph 8.3 at room temperature) 15 mm MgCl 2 Autoclave the 10x buffer for 10 minutes at 15 psi (1.05 kg/cm 2 ) on liquid cycle. Divide the sterile buffer into aliquots and store them at -20 C. Bacteriophage T4 DNA ligase buffer 200 mm Tris-Cl (ph 7.6) 50 mm MgCl mg/ml bovine serum albumin (Fraction V; Sigma) (optional) 50 mm dithiothreitol Divide the 10x buffer in small aliquots and store at -20 C. Add ATP when setting up the reaction. Add ATP to the reaction to an appropriate concentation (e.g., 1 mm). Sodium acetate To prepare a 3 M solution: Dissolve g of sodium acetate 3H 2 O in 800 ml of H 2 O. Adjust the ph to 5.2 with glacial acetic acid or to 7.0 with dilute acetic acid. Adjust the volume to 1 L with H 2 O. Dispense into aliquots and

5 5 of 5 4/29/2009 3:08 PM sterilize by autoclaving. dntp solution Dissolve each dntp (deoxyribonucleoside triphosphates) in H 2 O at an approximate concentration of 100 mm. Use 0.05 M Tris base and a micropipette to adjust the ph of each of the solutions to 7.0 (use ph paper to check the ph). Dilute an aliquot of the neutralized dntp appropriately, and read the optical density at the wavelengths given in the table below. Calculate the actual concentration of each dntp. Dilute the solutions with H 2 O to a final concentration of 50 mm dntp. Store each separately at -70 C in small aliquots. For polymerase chain reactions (PCRs), adjust the dntp solution to ph 8.0 with 2 N NaOH. Commercially available solutions of PCR-grade dntps require no adjustment. Base wavelength (nm) Extinction Coefficient (E) (M -1 cm -1 ) A x 10 4 G x 10 4 C x 10 3 T x 10 3 For a cuvette with a path length of 1 cm, absorbance = EM. 100 mm stock solutions of each dntp are commercially available (Pharmacia). Copyright 2006 by Cold Spring Harbor Laboratory Press. Online ISSN: Terms of Service All rights reserved. Anyone using the procedures outlined in these protocols does so at their own risk. Cold Spring Harbor Laboratory makes no representations or warranties with respect to the material set forth in these protocols and has no liability in connection with their use. All materials used in these protocols, but not limited to those highlighted with the Warning icon, may be considered hazardous and should be used with caution. For a full listing of cautions, click here. All rights reserved. No part of these pages, either text or images, may be used for any reason other than personal use. Reproduction, modification, storage in a retrieval system or retransmission, in any form or by any means-electronic, mechanical, or otherwise-for reasons other than personal use is strictly prohibited without prior written permission. CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?

Cycle Sequencing: Dideoxy-mediated Sequencing Reactions Using PCR and End-labeled Primers

1 of 6 4/29/2009 2:48 PM Cite as: Cold Spring Harb. Protoc.; 2006; doi:10.1101/pdb.prot3791 Protocol Cycle Sequencing: Dideoxy-mediated Sequencing Reactions Using PCR and End-labeled Primers Joseph Sambrook