Using GREAT.stanford.edu to interpret cis-regulatory rich datasets including ChIP-Seq, Epi markers, GWAS etc.
|
|
- Alvin Parker
- 5 years ago
- Views:
Transcription
1 Using GREAT.stanford.edu to interpret cis-regulatory rich datasets including ChIP-Seq, Epi markers, GWAS etc. Gill Bejerano Dept. of Developmental Biology & Dept. of Computer Science Stanford University 1
2 Human Gene Regulation different cells in an adult human. All these cells have the same Genome. 20,000 Genes encode how to make proteins. 1,000,000 Genomic switches determine which and how much proteins to make. Gene Gene Gene Gene Hundreds of different cell types. 2
3 Most Non-Coding Elements likely work in cis IRX1 is a member of the Iroquois homeobox gene family. Members of this family appear to play multiple roles during pattern formation of vertebrate embryos. gene deserts regulatory jungles Every orange tick mark is roughly 100-1,000bp long, each evolves under purifying selection, and does not code for protein. 9Mb 3
4 Many non-coding elements tested are cis-regulatory 4
5 Bejerano Lab : Human Cis-Regulation CIS REGULATION DEVELOPMENT EVOLUTION DISEASE We build tools, predict and test in house. 5
6 Combinatorial Regulatory Code 2,000 different proteins can bind specific DNA sequences. DNA Proteins Protein binding site Gene DNA A regulatory region encodes 3-10 such protein binding sites. When all are bound by proteins the regulatory region turns on, and the nearby gene is activated to produce protein. 6
7 ChIP-Seq: first glimpses of the regulatory genome in action Peak Calling Cis-regulatory peak 7
8 What is the transcription factor I just assayed doing? Collect known literature of the form Function A: Gene1, Gene2, Gene3,... Function B: Gene1, Gene2, Gene3,... Function C:... Ask whether the binding sites you discovered are preferentially binding (regulating) any one or more of the functions listed above. Form hypothesis and perform further experiments. Cis-regulatory peak Gene transcription start site 8
9 Example: inferring functions of Serum Response Factor (SRF) from its ChIP-seq binding profile Gene transcription start site SRF binding ChIP-seq peak ChIP-seq identified 2,429 SRF binding peaks in human Jurkat cells 1 SRF is known as a master regulator of the actin cytoskeleton In the ChIP-Seq peaks, we expect to find binding sites regulating (genes involved in) actin cytoskeleton formation. [1] Valouev A. et al., Nat. Methods,
10 Example: inferring functions of Serum Response Factor (SRF) from its ChIP-seq binding profile Gene transcription start site SRF binding ChIP-seq peak Ontology term (e.g. actin cytoskeleton ) Existing, gene-based method to analyze enrichment: Ignore distal binding events. Count affected genes. N = 8 genes in genome K = 3 genes annotated with n = 2 genes selected by proximal peaks k = 1 selected gene annotated with Rank by enrichment hypergeometric p-value. P = Pr(k 1 n=2, K =3, N=8) 10
11 We have (reduced ChIP-Seq into) a gene list! What is the gene list enriched for? Pro: A lot of tools out there for the analysis of gene lists. Cons: These tools are built for microarray analysis. Does it matter?? Microarray data Microarray data Deep sequencing data Microarray tool 11
12 SRF Gene-based enrichment results Original authors can only state: basic cellular processes, particularly those related to gene expression are enriched 1 SRF SRF acts on genes both in nucleus and cytoplasm, that are involved in transcription and various types of binding SRF Where s the signal? Top actin term is ranked #28 in the list. [1] Valouev A. et al., Nat. Methods,
13 Associating only proximal peaks loses a lot of information Relationship of binding peaks to nearest genes for eight human (H) and mouse (M) ChIP-seq datasets SRF (H: Jurkat) NRSF (H: Jurkat) GABP (H: Jurkat) Stat3 (M: ESC) p300 (M: ESC) p300 (M: limb) 0.7 p300 (M: forebrain) p300 (M: midbrain) Fraction of all elements Restricting to proximal peaks often leads to complete loss of key enrichments > 500 Distance to nearest transcription start site (kb) 13
14 Bad Solution: Associating distal peaks brings in many false enrichments Why bad? 14% of human genes tagged multicellular organismal development. But 33% of base pairs have such a gene nearest upstream/downstream. SRF ChIP-seq set has >2,000 binding events. Throw a random set of 2,000 regions at the genome. What do you get from a gene list analysis? Term Bonferroni corrected p-value nervous system development 5x10-9 system development 8x10-9 anatomical structure development 7x10-8 multicellular organismal development 1x10-7 developmental process 2x10-6 Regulatory jungles are often next to key developmental genes 14
15 Real Solution: Do not convert to gene list. Analyze the set of genomic regions Gene transcription start site Ontology term ( actin cytoskeleton ) Gene regulatory domain Genomic region (ChIP-seq peak) p = 0.33 of genome annotated with n = 6 genomic regions k = 5 genomic regions hit annotation GREAT = Genomic Regions Enrichment of Annotations Tool P = Pr binom (k 5 n=6, p =0.33) Since 33% of base pairs are near a multicellular organismal development gene, we now expect 33% of genomic regions to hit this term by chance. => Toss 2,000 random regions at genome, get NO (false) enrichments. 15
16 How does GREAT know how to assign distal binding peaks to genes? Future: High-throughput assays based on chromosome conformation capture (3C) methods will elucidate complex regulation mechanisms Currently: Flexible computational definitions allow assignment of peaks to nearest gene, nearest two genes, etc. Default: each gene has a basal regulatory domain of 5 kb up- and 1kb downstream of transcription start site, extends to basal domain of nearest genes within 1 Mb Though some associations may be missed or incorrect, in general signal richness and robustness is greatly improved by associating distal peaks 16
17 Top gene-based enrichments of SRF GREAT infers many specific functions of SRF from its binding profile Ontology Term # Genes Binomial Experimental P-value support * Gene Ontology Pathway Commons Top GREAT enrichments of SRF actin cytoskeleton actin binding TRAIL signaling Class I PI3K signaling TreeFam FOS gene family 1x10-8 7x10-9 Miano et al x10-5 Miano et al x10-7 Bertolotto et al x10-6 Poser et al Chai & Tarnawski 2002 (top actin-related term 28 th in list) TF Targets Targets of SRF Targets of GABP Targets of YY1 Targets of EGR x x10-9 1x10-6 2x10-4 Positive control ChIp-Seq support Natesan & Gilman 1995 * Known from literature as in function is known, SOME of the genes are known, and the binding sites highlighted are NOT. Similar results for GABP, NRSF, Stat3, p300 ChIP-Seq [McLean et al., Nat Biotechnol., 2010] 17
18 GREAT data integrated Twenty ontologies spanning broad categories of biology 44,832 total ontology terms tested in each GREAT run (2,800 terms) (5,215) (834) (6,700) (3,079) (911) (150) (1,253) (288) (706) (5,781) (427) (456) (6,857) (8,272) (238) (615) (19) (222) (9) Michael Hiller 18
19 GREAT implementation Can handle datasets of hundreds of thousands of genomic regions Testing a single ontology term takes ~1 ms Enables real-time calculation of enrichment results for all ontologies Cory McLean 19
20 GREAT web app: input page Pick a genome assembly Input BED regions of interest Dave Bristor 20
21 As of February 11: Added Zebrafish 21
22 GREAT web app: (Optional): alter association rules Three association rule choices Lnp Evx2 HoxD cluster Literature-curated domains for a small subset of genes [adapted from Spitz, Gonzalez, & Duboule, Cell, 2003] 22
23 GREAT web app: output summary Additional ontologies, term statistics, multiple hypothesis corrections, etc. Ontology-specific enrichments 23
24 GREAT web app: term details page Genes annotated as actin binding with associated genomic regions Genomic regions annotated with actin binding Drill down to explore how a particular peak regulates Plectin and its role in actin binding 24
25 You can also submit any track straight from the UCSC Table Browser A simple, well documented programmatic interface allows any tool to submit directly to GREAT. (See our Help / Inquiries welcome!) 25
26 GREAT web app: export data HTML output displays all user selected rows and columns Tab-separated values also available for additional postprocessing 26
27 GREAT Web Stats: 40 jobs/day x 300 days up 500 entries 27
28 GREAT can be used with any cis-reg set 28
29 Top 119 SNPs associated with diabetes from NIH GWAS Catalog
30 Human specific loss of regulatory seq. Human specific deletions appear significantly often next to: Steroid hormone receptors Neural tumor suppressors [McLean et al., Nature, 2011] 30
31 Summary Human genome chock-full of regulatory sequences GREAT accurately assesses functional enrichments of validated or putative cis-regulatory sequences using a novel genomic region-based approach [McLean et al., Nature Biotechnol., 2010] Online tool available at has been embraced by the biomedical research community 31
32 Bejerano Lab: Developmental Genomics & Evolutionary Developmental Genomics dry wet Funding: NIH / NICHD, NHGRI NSF / STC Packard Foundation HFSP Young Investigator Award Searle Scholar Network, Microsoft Research Mallinckrodt Foundation, A.P. Sloan Foundation Okawa Foundation, Borroughs-Wellcome Bejerano Lab Bruce Schaar, Ph.D Geetu Tuteja, Ph.D (Dean s Fellow,) Michael Hiller, Ph.D (HFSP Fellow) Andrew Doxey, Ph.D. (NSERC Fellow) Cory McLean (Bio-X Fellow) Shoa Clarke (HHMI Gilliam Fellow) Aaron Wenger (SiGF Fellow) Harendra Guturu (NSF Fellow) Jim Notwell (NSF Fellow) Tisha Chung Jose Soltren Saatvik Agarwal Jenny Chen Sushant Shankar Stanford David Kingsley & lab 32
33 33
: Genomic Regions Enrichment of Annotations Tool
http://great.stanford.edu/ : Genomic Regions Enrichment of Annotations Tool Gill Bejerano Dept. of Developmental Biology & Dept. of Computer Science Stanford University 1 Human Gene Regulation 10 13 different
More information3/15/2016. Genome = Genes + Gene Regulation. Personal Transcription Factor. Binding Site Mutations Point to. Personal Medical Histories
Personal Transcription Factor GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAG GCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGC
More informationGREAT improves functional interpretation of cis-regulatory regions
a n a ly s i s GREAT improves functional interpretation of cis-regulatory regions Cory Y McLean 1, Dave Bristor 1,2, Michael Hiller 2, Shoa L Clarke 3, Bruce T Schaar 2, Craig B Lowe 4, Aaron M Wenger
More informationIntroduction to genome biology
Introduction to genome biology Lisa Stubbs Deep transcritpomes for traditional model species from ENCODE (and modencode) Deep RNA-seq and chromatin analysis on 147 human cell types, as well as tissues,
More informationThe ENCODE Encyclopedia. & Variant Annotation Using RegulomeDB and HaploReg
The ENCODE Encyclopedia & Variant Annotation Using RegulomeDB and HaploReg Jill E. Moore Weng Lab University of Massachusetts Medical School October 10, 2015 Where s the Encyclopedia? ENCODE: Encyclopedia
More informationRelationship of Gene s Types and Introns
Chi To BME 230 Final Project Relationship of Gene s Types and Introns Abstract: The relationship in gene ontology classification and the modification of the length of introns through out the evolution
More informationIntegrating diverse datasets improves developmental enhancer prediction
1 Integrating diverse datasets improves developmental enhancer prediction Genevieve D. Erwin 1, Rebecca M. Truty 1, Dennis Kostka 2, Katherine S. Pollard 1,3, John A. Capra 4 1 Gladstone Institute of Cardiovascular
More informationIntroduction to genome biology
Introduction to genome biology Lisa Stubbs We ve found most genes; but what about the rest of the genome? Genome size* 12 Mb 95 Mb 170 Mb 1500 Mb 2700 Mb 3200 Mb #coding genes ~7000 ~20000 ~14000 ~26000
More informationAnalysis of RNA-seq Data. Feb 8, 2017 Peikai CHEN (PHD)
Analysis of RNA-seq Data Feb 8, 2017 Peikai CHEN (PHD) Outline What is RNA-seq? What can RNA-seq do? How is RNA-seq measured? How to process RNA-seq data: the basics How to visualize and diagnose your
More informationNGS Approaches to Epigenomics
I519 Introduction to Bioinformatics, 2013 NGS Approaches to Epigenomics Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Background: chromatin structure & DNA methylation Epigenomic
More informationChIP-seq data analysis with Chipster. Eija Korpelainen CSC IT Center for Science, Finland
ChIP-seq data analysis with Chipster Eija Korpelainen CSC IT Center for Science, Finland chipster@csc.fi What will I learn? Short introduction to ChIP-seq Analyzing ChIP-seq data Central concepts Analysis
More informationDiscovering gene regulatory control using ChIP-chip and ChIP-seq. An introduction to gene regulatory control, concepts and methodologies
Discovering gene regulatory control using ChIP-chip and ChIP-seq An introduction to gene regulatory control, concepts and methodologies Ian Simpson ian.simpson@.ed.ac.uk bit.ly/bio2_2012 The Central Dogma
More informationHuman Gene Regulation
Human Gene Regulation 4 Transcriptional networks underlying development ~20,000 genes take up 2% of the human genome. 1,000,000 gene regulation regions (promoters, enhancers, silencers, insulators) controlling
More informationA step-by-step guide to ChIP-seq data analysis
A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D. EMBL-European Bioinformatics Institute Wellcome Trust Sanger Institute Target audience Wet-lab biologists with no experience
More informationWeek 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html
More informationIntroduction to BIOINFORMATICS
COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/
More information2/19/13. Contents. Applications of HMMs in Epigenomics
2/19/13 I529: Machine Learning in Bioinformatics (Spring 2013) Contents Applications of HMMs in Epigenomics Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2013 Background:
More informationChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
More informationApplications of HMMs in Epigenomics
I529: Machine Learning in Bioinformatics (Spring 2013) Applications of HMMs in Epigenomics Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2013 Contents Background:
More informationless sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput
Chapter 11: Gene Expression The availability of an annotated genome sequence enables massively parallel analysis of gene expression. The expression of all genes in an organism can be measured in one experiment.
More informationTales from the Dark Side of Your Genome
Tales from the Dark Side of Your Genome Gill Bejerano Dept. of Developmental Biology Dept. of Computer Science Stanford University http://bejerano.stanford.edu 1 Biology has become a quantitative science
More informationDiscovering gene regulatory control using ChIP-chip and ChIP-seq. Part 1. An introduction to gene regulatory control, concepts and methodologies
Discovering gene regulatory control using ChIP-chip and ChIP-seq Part 1 An introduction to gene regulatory control, concepts and methodologies Ian Simpson ian.simpson@.ed.ac.uk http://bit.ly/bio2links
More informationNon-coding Function & Variation, MPRAs II. Mike White Bio /5/18
Non-coding Function & Variation, MPRAs II Mike White Bio 5488 3/5/18 MPRA Review Problem 1: Where does your CRE DNA come from? DNA synthesis Genomic fragments Targeted regulome capture Problem 2: How do
More informationIntroduction to ChIP Seq data analyses. Acknowledgement: slides taken from Dr. H
Introduction to ChIP Seq data analyses Acknowledgement: slides taken from Dr. H Wu @Emory ChIP seq: Chromatin ImmunoPrecipitation it ti + sequencing Same biological motivation as ChIP chip: measure specific
More informationAnalysis of ChIP-seq data with R / Bioconductor
Analysis of ChIP-seq data with R / Bioconductor Martin Morgan Bioconductor / Fred Hutchinson Cancer Research Center Seattle, WA, USA 8-10 June 2009 ChIP-seq Chromatin immunopreciptation to enrich sample
More informationIntegrating Diverse Datasets Improves Developmental Enhancer Prediction
Integrating Diverse Datasets Improves Developmental Enhancer Prediction Genevieve D. Erwin 1,2, Nir Oksenberg 2,3, Rebecca M. Truty 1, Dennis Kostka 4, Karl K. Murphy 2,3, Nadav Ahituv 2,3, Katherine S.
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More informationChIP-seq and RNA-seq
ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)
More informationBCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
More informationNon-coding Function & Variation, MPRAs. Mike White Bio5488 3/5/18
Non-coding Function & Variation, MPRAs Mike White Bio5488 3/5/18 Outline MONDAY Non-coding function and variation The barcode Basic versions of MRPA technology WEDNESDAY More varieties of MRPAs Some key
More informationMicroarray Data Analysis in GeneSpring GX 11. Month ##, 200X
Microarray Data Analysis in GeneSpring GX 11 Month ##, 200X Agenda Genome Browser GO GSEA Pathway Analysis Network building Find significant pathways Extract relations via NLP Data Visualization Options
More informationTitle: Genome-Wide Predictions of Transcription Factor Binding Events using Multi- Dimensional Genomic and Epigenomic Features Background
Title: Genome-Wide Predictions of Transcription Factor Binding Events using Multi- Dimensional Genomic and Epigenomic Features Team members: David Moskowitz and Emily Tsang Background Transcription factors
More informationKnetMiner USER TUTORIAL
KnetMiner USER TUTORIAL Keywan Hassani-Pak ROTHAMSTED RESEARCH 10 NOVEMBER 2017 About KnetMiner KnetMiner, with a silent "K" and standing for Knowledge Network Miner, is a suite of open-source software
More informationKnowledge-Guided Analysis with KnowEnG Lab
Han Sinha Song Weinshilboum Knowledge-Guided Analysis with KnowEnG Lab KnowEnG Center Powerpoint by Charles Blatti Knowledge-Guided Analysis KnowEnG Center 2017 1 Exercise In this exercise we will be doing
More informationIntroduction to NGS analyses
Introduction to NGS analyses Giorgio L Papadopoulos Institute of Molecular Biology and Biotechnology Bioinformatics Support Group 04/12/2015 Papadopoulos GL (IMBB, FORTH) IMBB NGS Seminar 04/12/2015 1
More informationAnalyzing Gene Set Enrichment
Analyzing Gene Set Enrichment BaRC Hot Topics June 20, 2016 Yanmei Huang Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Purpose of Gene Set Enrichment Analysis
More informationObject Groups. SRI International Bioinformatics
Object Groups 1 SRI International Bioinformatics Object Groups Collect and save lists of genes, metabolites, pathways Transform, filter, and analyze them Share groups with colleagues Use groups in conjunction
More informationChIP-seq analysis 2/28/2018
ChIP-seq analysis 2/28/2018 Acknowledgements Much of the content of this lecture is from: Furey (2012) ChIP-seq and beyond Park (2009) ChIP-seq advantages + challenges Landt et al. (2012) ChIP-seq guidelines
More information2/10/17. Contents. Applications of HMMs in Epigenomics
2/10/17 I529: Machine Learning in Bioinformatics (Spring 2017) Contents Applications of HMMs in Epigenomics Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2017 Background:
More informationWhole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
More informationCharles Girardot, Furlong Lab. MACS, CisGenome, SISSRs and other peak calling algorithms: differences and practical use
Charles Girardot, Furlong Lab MACS, CisGenome, SISSRs and other peak calling algorithms: differences and practical use ChIP-Seq signal properties Only 5 ends of ChIPed fragments are sequenced Shifted read
More informationExpression Analysis Systematic Explorer (EASE)
Expression Analysis Systematic Explorer (EASE) EASE is a customizable software application for rapid biological interpretation of gene lists that result from the analysis of microarray, proteomics, SAGE,
More informationAnalysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ),
Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ), 2012-01-26 What is a gene What is a transcriptome History of gene expression assessment RNA-seq RNA-seq analysis
More informationuser s guide Question 1
Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. sndrop-seq overview.
Supplementary Figure 1 sndrop-seq overview. A. sndrop-seq method showing modifications needed to process nuclei, including bovine serum albumin (BSA) coating and droplet heating to ensure complete nuclear
More informationThe first thing you will see is the opening page. SeqMonk scans your copy and make sure everything is in order, indicated by the green check marks.
Open Seqmonk Launch SeqMonk The first thing you will see is the opening page. SeqMonk scans your copy and make sure everything is in order, indicated by the green check marks. SeqMonk Analysis Page 1 Create
More informationTraining materials.
Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation
More informationGene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
More informationUnderstanding protein lists from proteomics studies. Bing Zhang Department of Biomedical Informatics Vanderbilt University
Understanding protein lists from proteomics studies Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu A typical comparative shotgun proteomics study IPI00375843
More informationMapping long-range promoter contacts in human cells with high-resolution capture Hi-C
CORRECTION NOTICE Nat. Genet. 47, 598 606 (2015) Mapping long-range promoter contacts in human cells with high-resolution capture Hi-C Borbala Mifsud, Filipe Tavares-Cadete, Alice N Young, Robert Sugar,
More informationMethods and tools for exploring functional genomics data
Methods and tools for exploring functional genomics data William Stafford Noble Department of Genome Sciences Department of Computer Science and Engineering University of Washington Outline Searching for
More informationCapabilities & Services
Capabilities & Services Accelerating Research & Development Table of Contents Introduction to DHMRI 3 Services and Capabilites: Genomics 4 Proteomics & Protein Characterization 5 Metabolomics 6 In Vitro
More informationThe ENCODE Encyclopedia. Zhiping Weng University of Massachusetts Medical School ENCODE 2016: Research Applications and Users Meeting June 8, 2016
The ENCODE Encyclopedia Zhiping Weng University of Massachusetts Medical School ENCODE 2016: Research Applications and Users Meeting June 8, 2016 The Encyclopedia Of DNA Elements Consortium Goals: - Catalog
More informationThe human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.
Data mining in Ensembl with BioMart Worked Example The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Which other genes related to human
More informationGenome 541 Gene regulation and epigenomics Lecture 3 Integrative analysis of genomics assays
Genome 541 Gene regulation and epigenomics Lecture 3 Integrative analysis of genomics assays Please consider both the forward and reverse strands (i.e. reverse compliment sequence). You do not need to
More informationIntroduction to 'Omics and Bioinformatics
Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current
More informationUnderstanding Transcripts in UCSC Genome Browser
Understanding Transcripts in UCSC Genome Browser Cline and Kent, Nature Biotechnology 27, 153-155 (2009) 1 Gene Annotations 2 Gene Annotations 2 3 Galaxy Databases are not analyses tools. Databases are
More informationUpstream/Downstream Relation Detection of Signaling Molecules using Microarray Data
Vol 1 no 1 2005 Pages 1 5 Upstream/Downstream Relation Detection of Signaling Molecules using Microarray Data Ozgun Babur 1 1 Center for Bioinformatics, Computer Engineering Department, Bilkent University,
More informationBi8 Lecture 19. Review and Practice Questions March 8th 2016
Bi8 Lecture 19 Review and Practice Questions March 8th 2016 Common Misconceptions Where Words Matter Common Misconceptions DNA vs RNA vs Protein Su(H) vs Su(H) Replication Transcription Transcribed vs
More informationThe Human Genome Project
The Human Genome Project The Human Genome Project Began in 1990 The Mission of the HGP: The quest to understand the human genome and the role it plays in both health and disease. The true payoff from the
More informationGenomes: What we know and what we don t know
Genomes: What we know and what we don t know Complete draft sequence 2001 October 15, 2007 Dr. Stefan Maas, BioS Lehigh U. What we know Raw genome data The range of genome sizes in the animal & plant kingdoms!
More informationTraining materials.
Training materials - Ensembl training materials are protected by a CC BY license - http://creativecommons.org/licenses/by/4.0/ - If you wish to re-use these materials, please credit Ensembl for their creation
More informationProtein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger
Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger This Lecture Protein-protein interactions Characteristics Experimental detection methods Databases Protein-protein interaction networks Ulf
More informationInferring Cellular Networks Using Probabilis6c Graphical Models. Jianlin Cheng, PhD University of Missouri 2010
Inferring Cellular Networks Using Probabilis6c Graphical Models Jianlin Cheng, PhD University of Missouri 2010 Bayesian Network So@ware hap://www.cs.ubc.ca/~murphyk/so@ware/ BNT/bnso@.html Demo References
More informationIntroduction to the UCSC genome browser
Introduction to the UCSC genome browser Dominik Beck NHMRC Peter Doherty and CINSW ECR Fellow, Senior Lecturer Lowy Cancer Research Centre, UNSW and Centre for Health Technology, UTS SYDNEY NSW AUSTRALIA
More informationAbout Strand NGS. Strand Genomics, Inc All rights reserved.
About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive
More informationSupporting Information
Supporting Information Ho et al. 1.173/pnas.81288816 SI Methods Sequences of shrna hairpins: Brg shrna #1: ccggcggctcaagaaggaagttgaactcgagttcaacttccttcttgacgnttttg (TRCN71383; Open Biosystems). Brg shrna
More informationMachine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
More informationSection C: The Control of Gene Expression
Section C: The Control of Gene Expression 1. Each cell of a multicellular eukaryote expresses only a small fraction of its genes 2. The control of gene expression can occur at any step in the pathway from
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory http://collaboratory.lifesci.ucla.edu Workshop Outline ü Day 1 UCLA galaxy
More informationChIP. November 21, 2017
ChIP November 21, 2017 functional signals: is DNA enough? what is the smallest number of letters used by a written language? DNA is only one part of the functional genome DNA is heavily bound by proteins,
More informationProtein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger
Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger This Lecture Protein-protein interactions Characteristics Experimental detection methods Databases Biological networks Ulf Leser: Introduction
More informationGENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
More informationPRIMEGENSw3 User Manual
PRIMEGENSw3 User Manual PRIMEGENSw3 is Web Server version of PRIMEGENS program to automate highthroughput primer and probe design. It provides three separate utilities to select targeted regions of interests
More informationLARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES
1 LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES Ezekiel Adebiyi, PhD Professor and Head, Covenant University Bioinformatics Research and CU NIH H3AbioNet node Covenant University,
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review
More informationGenome 541! Unit 4, lecture 3! Genomics assays
Genome 541! Unit 4, lecture 3! Genomics assays I d like a bit more background on the assays and bioterminology.!! The phantom peak concept was confusing.! I didn t quite understand what the phantom peak
More informationNature Genetics: doi: /ng Supplementary Figure 1. H3K27ac HiChIP enriches enhancer promoter-associated chromatin contacts.
Supplementary Figure 1 H3K27ac HiChIP enriches enhancer promoter-associated chromatin contacts. (a) Schematic of chromatin contacts captured in H3K27ac HiChIP. (b) Loop call overlap for cohesin HiChIP
More informationLinking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls
Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Mark Craven craven@biostat.wisc.edu Spring 2011 1. Understanding Human Genetic Variation!
More informationProteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125
Proteomics Manickam Sugumaran Department of Biology University of Massachusetts Boston, MA 02125 Genomic studies produced more than 75,000 potential gene sequence targets. (The number may be even higher
More informationMassive Analysis of cdna Ends for simultaneous Genotyping and Transcription Profiling in High Throughput
Next Generation (Sequencing) Tools for Nucleotide-Based Information Massive Analysis of cdna Ends for simultaneous Genotyping and Transcription Profiling in High Throughput Björn Rotter, PhD GenXPro GmbH,
More informationCrash-course in genomics
Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is
More informationTUTORIAL. Revised in Apr 2015
TUTORIAL Revised in Apr 2015 Contents I. Overview II. Fly prioritizer Function prioritization III. Fly prioritizer Gene prioritization Gene Set Analysis IV. Human prioritizer Human disease prioritization
More informationChIP-seq experimental design and analysis
ChIP-seq experimental design and analysis Martin Morgan (mtmorgan@fhcrc.org) Fred Hutchinson Cancer Research Center Seattle, WA, USA 19 November, 2009 Classical ChIP-chip Biological context Punctuations,
More informationThe genetic code of gene regulatory elements
The genetic code of gene regulatory elements Ivan Ovcharenko Computational Biology Branch National Center for Biotechnology Information National Institutes of Health October 23, 2008 Outline Gene deserts
More informationComputational Analysis of Ultra-high-throughput sequencing data: ChIP-Seq
Computational Analysis of Ultra-high-throughput sequencing data: ChIP-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne Data flow in ChIP-Seq data analysis Level 1:
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationTHE HEALTH AND RETIREMENT STUDY: GENETIC DATA UPDATE
: GENETIC DATA UPDATE April 30, 2014 Biomarker Network Meeting PAA Jessica Faul, Ph.D., M.P.H. Health and Retirement Study Survey Research Center Institute for Social Research University of Michigan HRS
More informationTranscriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
More information3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome
Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts
More informationNature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
More informationLinking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls
Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Colin Dewey cdewey@biostat.wisc.edu Spring 2012 1. Understanding Human Genetic Variation
More informationChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014
ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind
More informationIn silico identification of transcriptional regulatory regions
In silico identification of transcriptional regulatory regions Martti Tolvanen, IMT Bioinformatics, University of Tampere Eija Korpelainen, CSC Jarno Tuimala, CSC Introduction (Eija) Program Retrieval
More informationPractice Exam A. Briefly describe how IL-25 treatment might be able to help this responder subgroup of liver cancer patients.
Practice Exam 2007 1. A special JAK-STAT signaling system (JAK5-STAT5) was recently identified in which a gene called TS5 becomes selectively transcribed and expressed in the liver upon induction by a
More informationCyVerse Overview. National Academies Special Topics Summer Institute on Quantitative Biology
Transforming Science Through Data-driven Discovery CyVerse Overview National Academies Special Topics Summer Institute on Quantitative Biology Jason Williams Lead, CyVerse Education, Outreach, Training
More informationDNA. bioinformatics. epigenetics methylation structural variation. custom. assembly. gene. tumor-normal. mendelian. BS-seq. prediction.
Epigenomics T TM activation SNP target ncrna validation metagenomics genetics private RRBS-seq de novo trio RIP-seq exome mendelian comparative genomics DNA NGS ChIP-seq bioinformatics assembly tumor-normal
More informationReading Between the Genes: Computational Models to Discover Function from Noncoding DNA
Reading Between the Genes: Computational Models to Discover Function from Noncoding DNA Yves A. Lussier, Joanne Berghout, Francesca Vitali, Kenneth S. Ramos Center for Biomedical Informatics and Biostatistics,
More informationComplete draft sequence 2001
Genomes: What we know and what we don t know Complete draft sequence 2001 November11, 2009 Dr. Stefan Maas, BioS Lehigh U. What we know Raw genome data The range of genome sizes in the animal & plant kingdoms
More information