Human Gene Regulation

3/15/2016. Genome = Genes + Gene Regulation. Personal Transcription Factor. Binding Site Mutations Point to. Personal Medical Histories

Personal Transcription Factor GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAG GCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGC

SNPs - GWAS - eqtls. Sebastian Schmeier

SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association

NGS Approaches to Epigenomics

I519 Introduction to Bioinformatics, 2013 NGS Approaches to Epigenomics Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Background: chromatin structure & DNA methylation Epigenomic

What Can the Epigenome Teach Us About Cellular States and Diseases?

What Can the Epigenome Teach Us About Cellular States and Diseases? (a computer scientist s view) Luca Pinello Outline Epigenetic: the code over the code What can we learn from epigenomic data? Resources

A Genetic Screen to Identify Mammalian Chromatin Modifiers In Vivo.

Gus Frangou, Stephanie Palmer & Mark Groudine Fred Hutchinson Cancer Research Center, Seattle- USA A Genetic Screen to Identify Mammalian Chromatin Modifiers In Vivo. During mammalian development and differentiation

Title: Genome-Wide Predictions of Transcription Factor Binding Events using Multi- Dimensional Genomic and Epigenomic Features Background

Title: Genome-Wide Predictions of Transcription Factor Binding Events using Multi- Dimensional Genomic and Epigenomic Features Team members: David Moskowitz and Emily Tsang Background Transcription factors

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist

Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data

Practice Exam A. Briefly describe how IL-25 treatment might be able to help this responder subgroup of liver cancer patients.

Practice Exam 2007 1. A special JAK-STAT signaling system (JAK5-STAT5) was recently identified in which a gene called TS5 becomes selectively transcribed and expressed in the liver upon induction by a

From Machine Learning to Personalized Medicine

1101100000 0010101101 Karsten Borgwardt KRUPP SYMPOSIUM From Machine Learning to Personalized Medicine Max Planck Institute of Psychiatry Munich, Germany October 21, 2016 0010111011 The non-profit Alfried

Measuring Protein-DNA interactions

Measuring Protein-DNA interactions How is Biological Complexity Achieved? Mediated by Transcription Factors (TFs) 2 Transcription Factors are genetic switches 3 Regulation of Gene Expression by Transcription

Using GREAT.stanford.edu to interpret cis-regulatory rich datasets including ChIP-Seq, Epi markers, GWAS etc.

Using GREAT.stanford.edu to interpret cis-regulatory rich datasets including ChIP-Seq, Epi markers, GWAS etc. Gill Bejerano Dept. of Developmental Biology & Dept. of Computer Science Stanford University

Genetics Journal Club YoSon Park Feb 11, Announcement: Marco Trizzino s seminar March 25 th, 2016!

Genetics Journal Club YoSon Park Feb 11, 2016 Announcement: Marco Trizzino s seminar March 25 th, 2016! Craniofacial development Implications in brain development, bipedal postures, etc Most craniofacial

Trilateral Project WM4 Comparative studies in new technologies (biotechnology, business methods, etc.)

Trilateral Project WM4 Comparative studies in new technologies (biotechnology, business methods, etc.) Report on comparative study on Examination Practice Relating to Single Nucleotide Polymorphisms (SNPs)

: Genomic Regions Enrichment of Annotations Tool

http://great.stanford.edu/ : Genomic Regions Enrichment of Annotations Tool Gill Bejerano Dept. of Developmental Biology & Dept. of Computer Science Stanford University 1 Human Gene Regulation 10 13 different

Personal and population genomics of human regulatory variation

Personal and population genomics of human regulatory variation Benjamin Vernot,, and Joshua M. Akey Department of Genome Sciences, University of Washington, Seattle, Washington 98195, USA Ting WANG 1 Brief

ChIP-seq analysis 2/28/2018

ChIP-seq analysis 2/28/2018 Acknowledgements Much of the content of this lecture is from: Furey (2012) ChIP-seq and beyond Park (2009) ChIP-seq advantages + challenges Landt et al. (2012) ChIP-seq guidelines

BTRY 7210: Topics in Quantitative Genomics and Genetics

BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu Spring 2015, Thurs.,12:20-1:10

Lecture 14. ENCODE. Michael Schatz. March 15, 2017 JHU : Applied Comparative Genomics

Lecture 14. ENCODE Michael Schatz March 15, 2017 JHU 601.749: Applied Comparative Genomics Project Proposal! Due March 15 HW6: Due March 29 *-seq in 4 short vignettes RNA-seq Methyl-seq ChIP-seq Hi-C Chromatin

DNA. bioinformatics. epigenetics methylation structural variation. custom. assembly. gene. tumor-normal. mendelian. BS-seq. prediction.

Epigenomics T TM activation SNP target ncrna validation metagenomics genetics private RRBS-seq de novo trio RIP-seq exome mendelian comparative genomics DNA NGS ChIP-seq bioinformatics assembly tumor-normal

Reviewers' Comments: Reviewer #1 (Remarks to the Author)

Reviewers' Comments: Reviewer #1 (Remarks to the Author) In this study, Rosenbluh et al reported direct comparison of two screening approaches: one is genome editing-based method using CRISPR-Cas9 (cutting,

latestdevelopments relevant for the Ag sector André Eggen Agriculture Segment Manager, Europe

Overviewof Illumina s latestdevelopments relevant for the Ag sector André Eggen Agriculture Segment Manager, Europe Seminar der Studienrichtung Tierwissenschaften, TÜM, July 1, 2009 Overviewof Illumina

Computational Workflows for Genome-Wide Association Study: I

Computational Workflows for Genome-Wide Association Study: I Department of Computer Science Brown University, Providence sorin@cs.brown.edu October 16, 2014 Outline 1 Outline 2 3 Monogenic Mendelian Diseases

RP1: AN EXAMPLE OF REVERSE GENETICS APPROACH TO DESCRIBE COMMON RECESSIVE DEFECTS

RP1: AN EXAMPLE OF REVERSE GENETICS APPROACH TO DESCRIBE COMMON RECESSIVE DEFECTS C. Grohs GABI, INRA, AgroParisTech, Université Paris Saclay 28 / 08 / 2017 Outbreaks of recessive defects as a consequence

Non-coding Function & Variation, MPRAs. Mike White Bio5488 3/5/18

Non-coding Function & Variation, MPRAs Mike White Bio5488 3/5/18 Outline MONDAY Non-coding function and variation The barcode Basic versions of MRPA technology WEDNESDAY More varieties of MRPAs Some key

SUPPLEMENTARY INFORMATION

18Pura Brain Liver 2 kb 9Mtmr Heart Brain 1.4 kb 15Ppara 1.5 kb IPTpcc 1.3 kb GAPDH 1.5 kb IPGpr1 2 kb GAPDH 1.5 kb 17Tcte 13Elov12 Lung Thymus 6 kb 5 kb 17Tbcc Kidney Embryo 4.5 kb 3.7 kb GAPDH 1.5 kb

Pharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001

Pharmacogenetics: A SNPshot of the Future Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 1 I. What is pharmacogenetics? It is the study of how genetic variation affects drug response

FY10 INVITATION PROPOSAL SUMMARY PAGE

FY10 INVITATION PROPOSAL SUMMARY PAGE Project Title: Pilot Sequence: High Density DNA Sequencing to Detect Population Structure of Pacific Herring (Project Number: 10100165) Project Period: October 1,

Ecological genomics and molecular adaptation: state of the Union and some research goals for the near future.

Ecological genomics and molecular adaptation: state of the Union and some research goals for the near future. Louis Bernatchez Genomics and Conservation of Aquatic Resources Université LAVAL! Molecular

9. What proteins will be affected by mutations in the trans-acting elements? Cis-acting elements?

6. What regulates the expression of a gene? 7. What are the cis- and trans-acting elements? 8. Can a deficiency in a trans-acting element be overcome by the addition of another copy of the gene to a cell?

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Colin Dewey cdewey@biostat.wisc.edu Spring 2012 1. Understanding Human Genetic Variation

The ENCODE Encyclopedia. & Variant Annotation Using RegulomeDB and HaploReg

The ENCODE Encyclopedia & Variant Annotation Using RegulomeDB and HaploReg Jill E. Moore Weng Lab University of Massachusetts Medical School October 10, 2015 Where s the Encyclopedia? ENCODE: Encyclopedia

Crash-course in genomics

Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is

Nature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1

INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot

resequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics

RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative

BTRY 7210: Topics in Quantitative Genomics and Genetics

BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu January 29, 2015 Why you re here

elin grundberg JULY 2018 JK - PRESENTATION- 11 MINS [MIXED RESPONDENTS] [Other comments:]

elin grundberg JULY 2018 JK - PRESENTATION- 11 MINS [MIXED RESPONDENTS] [Other comments:] So, we're going to be talking about epigenomic research, so, Elin, are you around? Come over. You can introduce

Nature Genetics: doi: /ng Supplementary Figure 1

Supplementary Figure 1 Flowchart illustrating the three complementary strategies for gene prioritization used in this study.. Supplementary Figure 2 Flow diagram illustrating calcaneal quantitative ultrasound

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a

Introduction to Bioinformatics and Gene Expression Technologies

Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary

Genetics Lecture Notes Lectures 17 19

Genetics Lecture Notes 7.03 2005 Lectures 17 19 Lecture 17 Gene Regulation We are now going to look at ways that genetics can be used to study gene regulation. The issue is how cells adjust the expression

RNA-Seq Now What? BIS180L Professor Maloof May 24, 2018

RNA-Seq Now What? BIS180L Professor Maloof May 24, 2018 We have differentially expressed genes, what do we want to know about them? We have differentially expressed genes, what do we want to know about

File S1. Program overview and features

File S1 Program overview and features Query list filtering. Further filtering may be applied through user selected query lists (Figure. 2B, Table S3) that restrict the results and/or report specifically

Computational Systems Biology Deep Learning in the Life Sciences

Computational Systems Biology Deep Learning in the Life Sciences 6.802 6.874 20.390 20.490 HST.506 Christina Ji April 6, 2017 DanQ: a hybrid convolutional and recurrent deep neural network for quantifying

Huijuan Feng, Shining Ma,Chao Ye & Zhixing Feng

Huijuan Feng, Shining Ma,Chao Ye & Zhixing Feng Background-Author introduction Research interest: Methods for gene mapping of complex traits Inference of population structure from genetic data Genome variation

Deep learning sequence-based ab initio prediction of variant effects on expression and disease risk

Summer Review 7 Deep learning sequence-based ab initio prediction of variant effects on expression and disease risk Jian Zhou 1,2,3, Chandra L. Theesfeld 1, Kevin Yao 3, Kathleen M. Chen 3, Aaron K. Wong

Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010

Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of

Non-coding Function & Variation, MPRAs II. Mike White Bio /5/18

Non-coding Function & Variation, MPRAs II Mike White Bio 5488 3/5/18 MPRA Review Problem 1: Where does your CRE DNA come from? DNA synthesis Genomic fragments Targeted regulome capture Problem 2: How do

2/19/13. Contents. Applications of HMMs in Epigenomics

2/19/13 I529: Machine Learning in Bioinformatics (Spring 2013) Contents Applications of HMMs in Epigenomics Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2013 Background:

Microarray Informatics

Microarray Informatics Donald Dunbar MSc Seminar 31 st January 2007 Aims To give a biologist s view of microarray experiments To explain the technologies involved To describe typical microarray experiments

Applications of HMMs in Epigenomics

I529: Machine Learning in Bioinformatics (Spring 2013) Applications of HMMs in Epigenomics Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2013 Contents Background:

Traditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding.

1 Introduction What is Genomic selection and how does it work? How can we best use DNA data in the selection of cattle? Mike Goddard 5/1/9 University of Melbourne and Victorian DPI of genomic selection

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11

Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the

MicroRNAs and Genome Editing Two Evolving Protagonists in Medicine

MicroRNAs and Genome Editing Two Evolving Protagonists in Medicine Gerald W Dorn II, MD, FACC Needleman Professor and Associate Chair Department of Internal Medicine Washington University in St Louis The

Nature Genetics: doi: /ng Supplementary Figure 1

Supplementary Figure 1 Characterization of Hi-C/CHi-C dynamics and enhancer identification. (a) Scatterplot of Hi-C read counts supporting contacts between domain boundaries. Contacts enclosing domains

Whole genome sequencing in the UK Biobank

Whole genome sequencing in the UK Biobank Part of the UK Government s Industrial Strategy Challenge Fund (ISCF) for the Data to Early Diagnosis and Precision Medicine initiative Aim to produce deep characterisation

Functional Genomics and Single-Cell Genomics. Christine Queitsch Department of Genome Sciences

Functional Genomics and Single-Cell Genomics Christine Queitsch Department of Genome Sciences queitsch@uw.edu 1 Outline Challenges Combining methods for better genome assembly Functional genomics let s

Comparative eqtl analyses within and between seven tissue types suggest mechanisms underlying cell type specificity of eqtls

Comparative eqtl analyses within and between seven tissue types suggest mechanisms underlying cell type specificity of eqtls, Duke University Christopher D Brown, University of Pennsylvania November 9th,

2/10/17. Contents. Applications of HMMs in Epigenomics

2/10/17 I529: Machine Learning in Bioinformatics (Spring 2017) Contents Applications of HMMs in Epigenomics Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2017 Background:

Problem Set 8. Answer Key

MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

MCB 102 University of California, Berkeley August 11 13, Problem Set 8

MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without

Using human genetics to make new medicines

Using human genetics to make new medicines Dr. Maya Ghoussaini Open targets, Wellcome Trust Sanger Institute, UK ELRIG, Drug Discovery, Liverpool, 3 rd -4 th October 2017 Drug development rarely succeeds

Bi8 Lecture 19. Review and Practice Questions March 8th 2016

Bi8 Lecture 19 Review and Practice Questions March 8th 2016 Common Misconceptions Where Words Matter Common Misconceptions DNA vs RNA vs Protein Su(H) vs Su(H) Replication Transcription Transcribed vs

What is Bioinformatics?

What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is

Finding Enrichments of Functional Annotations for Disease- Associated Single-Nucleotide Polymorphisms

Finding Enrichments of Functional Annotations for Disease- Associated Single-Nucleotide Polymorphisms Steven Homberg 11/10/13 1 Abstract Computational analysis of SNP-disease associations from GWAS as

res2)=)colocalisation(eqtl_file="icoslg_eqtl.txt",) gwas_file="uc_gwas_icoslg_locus.txt",)p1)=)1e+4,)p2)=)1e+4,)p12)=)1e+5,) region)=)200000)$

Homework 7 res1)=)colocalisation(eqtl_file="ptk2b_eqtl.txt",) gwas_file="ad_gwas_ptk2b_locus.txt",)p1)=)1e+4,)p2)=)1e+4,)p12)=)1e+5,) region)=)200000)$ ##))1.02e+06))2.43e+05))6.80e+04))1.51e+02))9.84e+01)$

Stefano Monti. Workshop Format

Gad Getz Stefano Monti Michael Reich {gadgetz,smonti,mreich}@broad.mit.edu http://www.broad.mit.edu/~smonti/aws Broad Institute of MIT & Harvard October 18-20, 2006 Cambridge, MA Workshop Format Morning

Toward a cohesive understanding of glyphosate resistance evolution in the common morning glory

Toward a cohesive understanding of glyphosate resistance evolution in the common morning glory Regina Baucom Dept of Ecology and Evolutionary Biology University of Michigan Ann Arbor, MI, USA Treated

Decoding Chromatin States with Epigenome Data Advanced Topics in Computa8onal Genomics

Decoding Chromatin States with Epigenome Data 02-715 Advanced Topics in Computa8onal Genomics HMMs for Decoding Chromatin States Epigene8c modifica8ons of the genome have been associated with Establishing

Introduction to genome biology

Introduction to genome biology Lisa Stubbs Deep transcritpomes for traditional model species from ENCODE (and modencode) Deep RNA-seq and chromatin analysis on 147 human cell types, as well as tissues,

Supplementary Table 1: Oligo designs. A list of ATAC-seq oligos used for PCR.

Ad1_noMX: Ad2.1_TAAGGCGA Ad2.2_CGTACTAG Ad2.3_AGGCAGAA Ad2.4_TCCTGAGC Ad2.5_GGACTCCT Ad2.6_TAGGCATG Ad2.7_CTCTCTAC Ad2.8_CAGAGAGG Ad2.9_GCTACGCT Ad2.10_CGAGGCTG Ad2.11_AAGAGGCA Ad2.12_GTAGAGGA Ad2.13_GTCGTGAT

Lecture 18. 2) Check to see whether the mutation is recessive and trans-acting (most will be).

Lecture 18 In the preceding examples of bacterial gene regulation, we have used known regulatory mechanisms to see how mutations in different elements of the system would behave in dominance tests and

ZBED6 the birth of a transcription factor in placental mammals. Wild Boar X domestic pig intercross initiated 1989

the birth of a transcription factor in placental mammals Wild Boar X domestic pig intercross initiated 1989 X Göran Andersson F1 X F1 Swedish University of Agricultural Sciences ALLBIO- Scilife-UPPNEX-BILS

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls

Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Mark Craven craven@biostat.wisc.edu Spring 2011 1. Understanding Human Genetic Variation!

a rj13 ORNLf CP CONF-~~/!CI~~--The Functional Genomics Initiative at Oak Ridge National Laboratory*

I I d ORNLf CP-94806 CONF-~~/!CI~~--The Functional Genomics Initiative at Oak Ridge National Laboratory* Dabney Johnson t, Monica Justice t; Ken Beattie t, Michelle Buchanan $, Michael Ramsey 0,Rose Ramsey

EPIB 668 Genetic association studies. Aurélie LABBE - Winter 2011

EPIB 668 Genetic association studies Aurélie LABBE - Winter 2011 1 / 71 OUTLINE Linkage vs association Linkage disequilibrium Case control studies Family-based association 2 / 71 RECAP ON GENETIC VARIANTS

The genetic code of gene regulatory elements

The genetic code of gene regulatory elements Ivan Ovcharenko Computational Biology Branch National Center for Biotechnology Information National Institutes of Health October 23, 2008 Outline Gene deserts

From Genotype to Phenotype

From Genotype to Phenotype Johanna Vilkki Green technology, Natural Resources Institute Finland Systems biology Genome Transcriptome genes mrna Genotyping methodology SNP TOOLS, WG SEQUENCING Functional

File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:

File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo

Can Semantic Web Technologies enable Translational Medicine? (Or Can Translational Medicine help enrich the Semantic Web?)

Can Semantic Web Technologies enable Translational Medicine? (Or Can Translational Medicine help enrich the Semantic Web?) Vipul Kashyap 1, Tonya Hongsermeier 1, Samuel Aronson 2 1 Clinical Informatics

Experimental validation of candidates of tissuespecific and CpG-island-mediated alternative polyadenylation in mouse

Karin Fleischhanderl; Martina Fondi Experimental validation of candidates of tissuespecific and CpG-island-mediated alternative polyadenylation in mouse 108 - Biotechnologie Abstract --- Keywords: Alternative

Nature Genetics: doi: /ng Supplementary Figure 1. H3K27ac HiChIP enriches enhancer promoter-associated chromatin contacts.

Supplementary Figure 1 H3K27ac HiChIP enriches enhancer promoter-associated chromatin contacts. (a) Schematic of chromatin contacts captured in H3K27ac HiChIP. (b) Loop call overlap for cohesin HiChIP

This summary statement was issued in 2004 for a PHS 398 application. We will post a more recent sample summary statement soon.

Posted May 22, 2007. See more samples here: http://www.niaid.nih.gov/ncn/grant/app/default.htm This summary statement was issued in 2004 for a PHS 398 application. We will post a more recent sample summary

ChIP-Seq Tools. J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015

ChIP-Seq Tools J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA or

ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015

ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA

with different microfluidic device parameters. Distribution of number of transcripts (y-axis) detected across nuclei, ranked in decreasing

Supplementary Figure 1 DroNc-seq benchmarking experiments. (a) Overview of DroNc-seq. (b) CAD schema of DroNc-seq microfluidic device. (c) Comparison of library complexity from experiments with different

ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014

ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind

Review of Transposable elements have rewired the core regulatory network of human embryonic stem cells

Review of Transposable elements have rewired the core regulatory network of human embryonic stem cells RNA structure Mutagenic screens using transposons Nature Genetics, 42(7), 631-635 (2010). Bradly Alicea

Many transcription factors! recognize DNA shape

Many transcription factors! recognize DN shape Katie Pollard! Gladstone Institutes USF Division of Biostatistics, Institute for Human Genetics, and Institute for omputational Health Sciences ENODE Users

Experimental genetics - 2 Partha Roy

Partha Roy Experimental genetics - 2 Making genetically altered animal 1) Gene knock-out k from: a) the entire animal b) selected cell-type/ tissue c) selected cell-type/tissue at certain time 2) Transgenic

CyVerse Overview. National Academies Special Topics Summer Institute on Quantitative Biology

Transforming Science Through Data-driven Discovery CyVerse Overview National Academies Special Topics Summer Institute on Quantitative Biology Jason Williams Lead, CyVerse Education, Outreach, Training

www.illumina.com/hiseq www.illumina.com FOR RESEARCH USE ONLY 2012 2014 Illumina, Inc. All rights reserved. Illumina, BaseSpace, cbot, CSPro, Genetic Energy, HiSeq, Nextera, TruSeq, the pumpkin orange

Applications of ChIP. November 05, David Grotsky, PhD Scientific Support Specialist - Epigenetics

Applications of ChIP November 05, 2014 David Grotsky, PhD Scientific Support Specialist - Epigenetics Overview Introduction to chromatin and ChIP The histone code hypothesis What we learn from ChIP-on-chip

Our website:

Biomedical Informatics Summer Internship Program (BMI SIP) The Department of Biomedical Informatics hosts an annual internship program each summer which provides high school, undergraduate, and graduate

Stalking the Genetic Basis of a Trait

OVERVIEW This activity supplements the short film Popped Secret: The Mysterious Origin of Corn. It focuses on the tb1 gene, whose expression is related to phenotypic changes associated with the evolution

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.

!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,

HLA and other tales: The different perspectives of Celiac Disease Gutierrez Achury, Henry Javier

University of Groningen HLA and other tales: The different perspectives of Celiac Disease Gutierrez Achury, Henry Javier IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's

SUPPLEMENTARY INFORMATION

doi:10.1038/nature11094 Supplementary Figures Supplementary Figure 1: Analysis of GFP expression in P0 wild type and mutant ( E1-4) Fezf2-Gfp BAC transgenic mice. Epifluorescent images of sagittal forebrain

Transcriptomics. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona

Transcriptomics Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Central dogma of molecular biology Central dogma of molecular biology Genome Complete DNA content of

Lecture 2: Height in Plants, Animals, and Humans. Michael Gore lecture notes Tucson Winter Institute version 18 Jan 2013

Lecture 2: Height in Plants, Animals, and Humans Michael Gore lecture notes Tucson Winter Institute version 18 Jan 2013 Is height a polygenic trait? http://en.wikipedia.org/wiki/gregor_mendel Case Study