CH 3. methane 1,1-dimethylcyclohexane not OK (might as well scratch a blackboard)
|
|
|
- Blake Arnold
- 6 years ago
- Views:
Transcription
1 rganic hemistry Interactive Notes hapter 4: Stereoisomers of lkanes and ycloalkanes Stereochemistry Significance of tetrahedral bonds methane 1,1-dimethylcyclohexane not K (might as well scratch a blackboard) onformation versus onfiguration versus onstitutional Isomers 3 types of structural isomers onformational isomers: Same formula: Different structures based on rotation around sigma bonds. Start with ethane. ere are 3 different representations of the the two unique conformations of ethane. The last one is called a Newman projection and you need to be able to make these. Some figures from William Reusch, Virtual Textbook nergetic onsequences of ethane. ach eclipsed bond is about kcal/mole Degrees of Rotation θ
2 rganic hemistry Interactive Notes ow to construct a Newman projection: back bonds front bonds staggered eclipsed Practice Draw 2 Newman projection for staggered and eclipsed conformations of l 3-3 Group 1 = l 3 Group 1 = 3 Next consider propane: Show the two conformations of propane. clipsed 3.4 Staggered 0 What are the relative energies of the eclipsed bonds? -/- eclipsed -/- eclipsed -/- 3 eclipsed Degrees of Rotation θ onstruct the case for 2 different substituents like 1,2-dichloroethane. Label -. Which are the same? D Degrees of Rotation θ
3 rganic hemistry Interactive Notes Now consider butane Show the four conformations of butane: clipsed 3 3 Gauche clipsed D D nti Degrees of Rotation θ 3 3 Gauche 3 Formulaic breakdown of strain energies: Given (kcal/mole): ll eclipsed (-/-) = 1; (- 3 /- 3 ) = 2.6; (-/- 3 ) = 1.4. = 4.5 kcal/mole = (-/-) + (- 3 /- 3 ) = = 3.8 kcal/mole = (-/-) + (-/- 3 ) = The concept of strain: Molecular interactions are a combination of attraction and repulsion 3 new terms: Steric, ngle, and Torsion. Diatomics. onsider the simple one dimensional correlation of two objects to form a covalent bond: III + I Describe the situations for the 3 main regions: I II III II ringing - Distance the atoms too close together is related to what we call steric strain.
4 rganic hemistry Interactive Notes Triatomics are more complicated. onsider what happens to cyclics! onderwijs/oc1-2001/ollege 5.ppt 4-tomics: Torsional strain is based on overlapping areas of electron density on a sigma bond. Let s use a modified Newman projection to describe the molecule. 2 2, hydrogen peroxide. We call the /_ angle the torsion angle. Torsion ngle Which structure is the highest energy (most strained)? Which structure is the lowest energy (least strained)? D Reconsider butane and ethane in terms of torsional strain: D Degrees of Rotation θ Torsional nergy diagram of butane 0 Degrees of Rotation θ Torsional nergy diagram of ethane
5 rganic hemistry Interactive Notes ycloalkanes lthough the customary line drawings of simple cycloalkanes are geometrical polygons, the actual shape of these compounds in most cases is very different. Measuring strain. (a) ne way to measure energy of breaking similar bonds. onderwijs/oc1-2001/ollege 5.ppt What is the strain in cyclopropane compared to ethane? (b) nother is to see how much energy you can get out of a molecule (like potential energy). The difference in energy is attributed to the stability of the compound. Now consider rings in relationship to a linear unstrained alkane. onderwijs/oc1-2001/ollege 5.ppt
6 yclopropane --planar rganic hemistry Interactive Notes onderwijs/oc1-2001/ollege 5.ppt Steric Strain Torsional Strain ngle strain yclobutane 25 0 out of plane onderwijs/oc1-2001/ollege 5.ppt Steric Strain Torsional Strain ngle strain yclopentane -- puckered Look down the - bond to see how cyclopentane avoids - eclipsed. ngle strain Steric Strain Torsional Strain yclohexane -- chair Steric Strain Torsional Strain ngle strain onderwijs/oc1-2001/ollege 5.ppt
7 rganic hemistry Interactive Notes nalysis of the conformations of cyclohexane Figure William Reusch, Vitual Textbook The chair cyclohexane no strain all tetrahederal angles. Rapid interconversion between 6 axial and 6 equatorial s. Difference in energy from substitution in equatorial and axial positions. Figure William Reusch, Vitual Textbook 1 up up 2 axial 1 down equatorial 2 down quatorial substitution is preferred. Recognizing cis/trans: elow are chair forms of 1,3-dimethylcyclohexane up up 3 3 up 3 down 3 Practice Drawing hair-yclohexane
8 rganic hemistry Interactive Notes nergetics of yclohexane onformations Steric and Torsional Strain Y Y Preference for Y eq = Y (kcal/mol) l = 1.8 ( 3 ) 2 = 2.1 ( 3 ) 3 = 5.4 Torsional Strain onderwijs/oc1-2001/ollege 5.ppt onderwijs/oc1-2001/ollege 5.ppt
9 rganic hemistry Interactive Notes onformational Structures of Disubstituted yclohexanes 1,1-dimethylcyclohexane 1-t-butyl-1-methylcyclohexane cis-1,2-dimethylcyclohexane trans-1,2-dimethylcyclohexane cis-1,3-dimethylcyclohexane trans-1,3-dimethylcyclohexane cis-1,4-dimethylcyclohexane trans-1,4-dimethylcyclohexane Figure from William Reusch, Virtual Textbook Make sure you can identify stable conformations of substituted cyclohexanes. Substituent (eq/ax)k eq Methyl Isopropyl tert-utyl G = -RTlnK eq
10 rganic hemistry Interactive Notes Naturally occurring chair cyclohexanes steroids The majority of naturally occurring steroids contains the 6,6,6,5-trans-fused skeleton The simplest fused cyclohexane system is decalin. trans-decalin cis-decalin ow many gauche interactions are there in cis and trans decalin? Trans-decalin style fused cyclohexanes are the basis for steroids. Note all the trans-decalins holesterol
11 nabolic Steroids 3 3 rganic hemistry Interactive Notes jim.maxka@nau.edu 3 3 Testosterone ndrostenedione Responsible for many sex-linked (4-androstene-3,17-dione) behaviors Popular stimulant used in baseball Mark McGwire N N Nandrolone Stanozolol lympic anti-doping site Winning? Formula for the Sydney lympics arcelona lympic boost Information from D. Pavia, Sugars Glucose is one of the forms of energy storage in plants and animals and the building blocks of plant tissue and structure. Glucose is a 6-carbon molecule with corresponding groups. The straight chain form is not particularly stable and tends to cyclize with loss of water to make either an alpha (left side link) or eta (right side link) as shown below. 2 2 Straight chain -cyclized form planar projection -chair projection Practice turning the planar projection into the chair. an you make sense out of the cis and trans linkages?
12 rganic hemistry Interactive Notes Sugar Practice Turn these planar projections into chairs. an you see why glucose is the most abundant sugar in nature? β-d-glucopyranose β-d-galactopyranose β-d-llopyranose β-d-mannopyranose β-d-idopyranose β-d-ltropyranose β-d-gulopyranose β-d-talopyranose Naturally occurring in our diet order of abundance are glucose > galactose and fructose. Which other 6-carbon sugar would you predict to be important in metabolic cycles?
13 icyclics rganic hemistry Interactive Notes bridgehead bridgehead Norbornane icyclo[2.2.1]heptane camphor alpha-pinene Name these bicyclics: 3 N 3 Summaries 1. Make sure that you can draw tetrahedral molecules with dashed and wedged lines in the proper proportion and position. 2. What are the three types of isomers? 3. e able to draw and interpret a Newman projection. 4. Recognize and draw staggered and eclipsed conformations. 5. Recognize and draw gauche and anti conformations. 6. What are the 3 types of ring strain? 7. ow can you measure strain? Write a common reaction that will demonstrate the ring strain of comparable molecules. 8. Understand why cyclohexane is the most stable hydrocarbon cyclic. 9. Draw a chair form of cyclohexane. 10. Draw substituents on chair cyclohexane in the equatorial and axial positions. 11. Draw substituents on chair cyclohexane cis/trans. 12. e able to predict torsional strain in chair cyclohexanes based on 1,3-diaxial interactions and gauche relationships. 13. e able to count the number of gauche relationships in a substituted cyclohexane. 14. Understand the high and low energy conformations of chair cyclohexanes. 15. Understand the energy differences between equatorial and axial substitution. 16. See how the cyclohexane chair influences the type of bio-molecules that exist in nature.
CHEMISTRY Organic Chemistry I Laboratory Fall 2017 Lab 4: Computer Modeling of Cyclohexane Conformations
CHEMISTRY 243 - Organic Chemistry I Laboratory Fall 2017 Lab 4: Computer Modeling of Cyclohexane Conformations Purpose: You will explore how the molecular modeling software programs ChemDraw and Chem3D
Structural Bioinformatics (C3210) DNA and RNA Structure
Structural Bioinformatics (C3210) DNA and RNA Structure Importance of DNA/RNA 3D Structure Nucleic acids are essential materials found in all living organisms. Their main function is to maintain and transmit
EXPERIMENT 9 DEHYDRATION OF 2-METHYLCYCLOHEXANOL CH 3 H CH 3 OH H 3 PO 4 +
EXPERIMENT 9 DEHYDRATION OF 2-METHYLCYCLOHEXANOL CH 3 CH 3 H CH 3 OH H 3 PO 4 + + H 2 O In this experiment, a microscale distillation apparatus will be used to perform an acid-catalyzed dehydration reaction
Semiconductors. Types of Solids. Figure 10.30: Energy-level diagrams for (a) an n-type semiconductor and (b) a ptype semiconductor.
Figure 102: Partial representation of the molecular orbital energies in (a) diamond and (b) a typical metal Figure 1024: The p orbitals (a) perpendicular to the plane of the carbon ring system in graphite
Investigation of ignition behavior of dimethyl and ethyl isomers of cycloalkanes and furans
25 th ICDERS August 2 7, 2015 Leeds, UK Investigation of ignition behavior of dimethyl and ethyl isomers of cycloalkanes and furans Mazen A. Eldeeb, Ben Akih-Kumgeh Department of Mechanical and Aerospace
Certificate of Accreditation
PERRY JOHNSON LABORATORY ACCREDITATION, INC. Certificate of Accreditation Perry Johnson Laboratory Accreditation, Inc. has assessed the Laboratory of: (Hereinafter called the Organization) and hereby declares
Reduction of 4-t-Butylcyclohexanone Using NaBH4
Reduction of 4-t-Butylcyclohexanone Using NaB4 In this experiment you will explore the stereochemistry of the reduction of 4- t- butyl cyclohexanone using sodium borohydride. This is the organic counterpart
Virtual bond representation
Today s subjects: Virtual bond representation Coordination number Contact maps Sidechain packing: is it an instrumental way of selecting and consolidating a fold? ASA of proteins Interatomic distances
Density Computations
CHAPTER 3 THE STRUCTURE OF CRYSTALLINE SOLIDS Fundamental Concepts 3.1 What is the difference between atomic structure and crystal structure? Unit Cells Metallic Crystal Structures 3.2 If the atomic radius
Genetics Lecture Notes Lectures 17 19
Genetics Lecture Notes 7.03 2005 Lectures 17 19 Lecture 17 Gene Regulation We are now going to look at ways that genetics can be used to study gene regulation. The issue is how cells adjust the expression
Proteins Higher Order Structures
Proteins Higher Order Structures Dr. Mohammad Alsenaidy Department of Pharmaceutics College of Pharmacy King Saud University Office: AA 101 msenaidy@ksu.edu.sa Previously on PHT 426!! Protein Structures
Figure 16.31: Two-dimensional representations of (a) a quartz crystal and (b) a quartz glass.
Figure 16.31: Two-dimensional representations of (a) a quartz crystal and (b) a quartz glass. Figure 16.28: The p orbitals (a) perpendicular to the plane of th carbon ring system in graphite can combine
Super Models. Nucleotides Molecular Model Kit Copyright 2015 Ryler Enterprises, Inc. Recommended for ages 10 - adult
Super Models! ucleotides Molecular Model Kit Copyright 015 Ryler Enterprises, Inc. Recommended for ages 10 - adult Caution: Atom centers and vinyl tubing are a choking hazard. Do not eat or chew model
Nucleic Acids, Proteins, and Enzymes
3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural
PETROLEUM AS AN ENERGY SOURCE
SECTION B PETROLEUM AS AN ENERGY SOURCE People have used petroleum for almost 5000 years. The first oil well was drilled in the United States in 1859 in Pennsylvania. Since then, human life has been greatly
PowerPoint Images. Chapter 7. Failures Resulting from Variable Loading. Shigley Mischke Budynas. Mechanical Engineering Design Seventh Edition
PowerPoint Images Chapter 7 Failures Resulting from Variable Loading Mechanical Engineering Design Seventh Edition Shigley Mischke Budynas Copyright The McGraw-Hill Companies, Inc. Permission required
Molecular Biology I: DNA Replication
Molecular Biology I: DNA Replication Learning Goals: To work with a physical model of DNA in order to help you to understand: o rules for DNA structure o base-pairing o DNA replication Introduction: In
AP Chemistry A. Allan Chapter 18 - The Representative Elements: Groups 1A through 4A
AP Chemistry A. Allan Chapter 18 - The Representative Elements: Groups 1A through 4A 18.1 A Survey of the Representative Elements A. Basic Trends 1. Metals tend to lose electrons and form cations 2. Nonmetals
MAE 322 Machine Design Lecture 5 Fatigue. Dr. Hodge Jenkins Mercer University
MAE 322 Machine Design Lecture 5 Fatigue Dr. Hodge Jenkins Mercer University Introduction to Fatigue in Metals Cyclic loading produces stresses that are variable, repeated, alternating, or fluctuating
Molecular interaction study of two aliphatic alcohols with cyclohexane
Indian Journal of Pure & Applied Physics Vol. 46, December 2008, pp. 852-856 Molecular interaction study of two aliphatic alcohols with cyclohexane R Thiyagarajan & L Palaniappan* Department of Physics,
A Discovery Laboratory Investigating Bacterial Gene Regulation
Chapter 8 A Discovery Laboratory Investigating Bacterial Gene Regulation Robert Moss Wofford College 429 N. Church Street Spartanburg, SC 29307 mosssre@wofford.edu Bob Moss is an Associate Professor of
Chapter 3: Torsion. Chapter 4: Shear and Moment Diagram. Chapter 5: Stresses In beams
Chapter 3: Torsion Chapter 4: Shear and Moment Diagram Chapter 5: Stresses In beams Torsion Torsion or Torque, T, put simply, is referred to as a twisting moment. θ The derived formulas are: Where: Torsional
C C. Carbanion. Chemical speciates known as initiatiors are required, or photons.
FEE ADICALS C C C C Free adical Carbocation Carbanion Carbene adical eaction Characteristic---three step process 1) Initiation Step----required to get a free radical 2) Propagation Steps--- The reaction
Experiment 7: Characterization of uncrosslinked natural rubber from rubber tree latex and of crosslinked natural rubber.
Experiment 7: Characterization of uncrosslinked natural rubber from rubber tree latex and of crosslinked natural rubber. Aim: To study the stress-strain properties (and effects of time and temperature)
Structure analysis from X-ray powder data using real-space methods and pair distribution function analysis
Structure analysis from X-ray powder data using real-space methods and pair distribution function analysis Martin U. Schmidt Institute of Inorganic and Analytical Chemistry Goethe-University, Frankfurt
Packing of atoms in solids
MME131: Lecture 6 Packing of atoms in solids A. K. M. B. Rashid Professor, Department of MME BUET, Dhaka Today s topics Atomic arrangements in solids Points, directions and planes in unit cell References:
Fast GC Analyses of Volatiles
6 Fast GC Analyses of Volatiles Michael D. Buchanan mike.buchanan@sial.com Introduction The primary aim of Fast GC is to maintain (compared to conventional GC) sufficient resolving power in a shorter time.
In the boxes below, draw the structure of the organic compounds formed by each reaction.
1 Many α-amino acids have several functional groups. (a) Serine, shown below, is a naturally occurring α-amino acid. In the boxes below, draw the structure of the organic compounds formed by each reaction.
Structure formation and association of biomolecules. Prof. Dr. Martin Zacharias Lehrstuhl für Molekulardynamik (T38) Technische Universität München
Structure formation and association of biomolecules Prof. Dr. Martin Zacharias Lehrstuhl für Molekulardynamik (T38) Technische Universität München Motivation Many biomolecules are chemically synthesized
Crystal Structures of Interest
rystal Structures of Interest Elemental solids: Face-centered cubic (fcc) Hexagonal close-packed (hcp) ody-centered cubic (bcc) Diamond cubic (dc) inary compounds Fcc-based (u 3 u,nal, ß-ZnS) Hcp-based
Chapter 10: Phase Diagrams
hapter 10: Phase Diagrams Show figures 10-1 and 10-3, and discuss the difference between a component and a phase. A component is a distinct chemical entity, such as u, Ni, NiO or MgO. A phase is a chemically
Understanding DNA Structure
Understanding DNA Structure I619 Structural Bioinformatics Molecular Biology Basics + Scale total length of DNA in a human cell is about 2m DNA is compacted in length by a factor of 10000 the compaction
Final DRAFT API TECHNICAL REPORT. Carbon Content, Sampling, & Calculation
Final DRAFT API TECHNICAL REPORT Carbon Content, Sampling, & Calculation Final Draft: August 27, 2012 This document is not an API Standard; it is under consideration within an API technical committee but
Paper : 03 Structure and Function of Biomolecules II Module: 02 Nucleosides, Nucleotides and type of Nucleic Acids
Paper : 03 Structure and Function of Biomolecules II Module: 02 Nucleosides, Nucleotides and type of Nucleic Acids Principal Investigator Paper Coordinators Prof. Sunil Kumar Khare, Professor, Department
Chapter 3 Nucleic Acids, Proteins, and Enzymes
3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural
CSE : Computational Issues in Molecular Biology. Lecture 19. Spring 2004
CSE 397-497: Computational Issues in Molecular Biology Lecture 19 Spring 2004-1- Protein structure Primary structure of protein is determined by number and order of amino acids within polypeptide chain.
EMPIRICAL FORMULA DETERMINATION
Name Date Class Chapter 10 Chemical Quantities EXPERIMENT EMPIRICAL FORMULA DETERMINATION Text Reference Section 10.3 PURPOSE To determine the empirical formula of magnesium oxide. BACKGROUND Carbon dioxide
Appendix F: Hazardous Gases and Vapors
Appendix F: Hazardous Gases and Vapors The following pages contain excerpts from the National Fire Protection Association (NFPA) publication NFPA 497M Classification of Gases, Vapors, and Dusts for Electrical
green B 1 ) into a single unit to model the substrate in this reaction. enzyme
Teacher Key Objectives You will use the model pieces in the kit to: Simulate enzymatic actions. Explain enzymatic specificity. Investigate two types of enzyme inhibitors used in regulating enzymatic activity.
Chemistry of Petrochemical Processes
Chemistry of Petrochemical Processes ChE 464 Instructor: Dr. Ahmed Arafat, PhD Office: building 45 room 106 E-mail: akhamis@kau.edu.sa www.kau.edu.sa.akhamis files Book Chemistry of Petrochemical Processes
Diffraction Basics. The qualitative basics:
The qualitative basics: Diffraction Basics Coherent scattering around atomic scattering centers occurs when x-rays interact with material In materials with a crystalline structure, x-rays scattered in
Thomas G. Braga Manager, Research and Development. SulfaTreat, a Business Unit of M I L.L.C. A Smith/Schlumberger Company
Thomas G. Braga Manager, Research and Development SulfaTreat, a Business Unit of M I L.L.C. A Smith/Schlumberger Company Who is SulfaTreat? A World Leader in H 2 S Removal for More than a Decade Today
Reinforced Concrete Design. A Fundamental Approach - Fifth Edition
CHAPTER REINFORCED CONCRETE Reinforced Concrete Design A Fundamental Approach - Fifth Edition Fifth Edition REINFORCED CONCRETE A. J. Clark School of Engineering Department of Civil and Environmental Engineering
By the end of today, you will have an answer to: How can 1 strand of DNA serve as a template for replication?
Name: Period: Date: KIPP NYC College Prep Genetics and Biotech UNIT 9: Introduction to DNA Lecture 4: DNA Modeling and Intro to Replication By the end of today, you will have an answer to: How can 1 strand
Learning to Use PyMOL (includes instructions for PS #2)
Learning to Use PyMOL (includes instructions for PS #2) To begin, download the saved PyMOL session file, 4kyz.pse from the Chem 391 Assignments web page: http://people.reed.edu/~glasfeld/chem391/assign.html
Chapter 2 Molecules to enzymes - Short answer [72 marks]
![Chapter 2 Molecules to enzymes - Short answer [72 marks]](/thumbs/72/67260206.jpg "Chapter 2 Molecules to enzymes - Short answer [72 marks]")
Chapter 2 Molecules to enzymes - Short answer [72 marks] 1a. Outline primary and quaternary protein structures. Primary protein structure: Quaternary protein structure: a. (primary structure) is sequence
Air Emissions from the Chevron North Burnaby Refinery
Air Emissions from the Chevron North Burnaby Refinery Appendix C Detailed Description of Methods for Analysis of Ambient Air Concentration Data Susan M. Kennedy, Sarah Henderson Date: 6 July 2002 Contents
Complexes of π bonded and. aromatic ligands. Ferrocene. cyclopentadienyl anion ligand
Complexes of π bonded and cyclopentadienyl anion ligand aromatic ligands Fe Ferrocene π-bonded ligands Ethylene, the simplest alkene, binds to d-block metals in a side-on fashion. It is viewed as either
Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t.
BC 4054 Spring 2001 Chapter 11 & 12 Review Lecture otes Slide 1 ucleic Acid Structure Linear polymer of nucleotides Phosphodiester linkage between 3 and 5 positions See Figure 11.17 Slide 2 ucleic Acid
SCOTT Method TO-14A/15/17
SCOTT Method TO-14A/15/17 Calibration Standards Benefits and Features SCOTT technical expertise in engineering Method 14A/15/17, HAPS and TIC calibration standards, sulfur mixes and vapor intrusion products
CHAPTER 4. tert-butylation OF ETHYLBENZENE WITH tert-butyl ALCOHOL
72 CHAPTER 4 tert-butylation OF ETHYLBENZENE WITH tert-butyl ALCOHOL 4.1 INTRODUCTION Production of dialkyl-substituted benzene compounds via alkylation, trans-alkylation or disproportionation of aromatic
Today! Demonstrations of Redox Chemistry! Electrochemistry! electrons moving about! equilibrium with a control knob! The disappearing Aluminum Rod!
Today! Electrochemistry! electrons moving about! equilibrium with a control knob! Redox chemistry! oxidation and reduction! Demonstrations of Redox Chemistry! The disappearing Aluminum Rod! Alkali Metals
a. 50% fine pearlite, 12.5% bainite, 37.5% martensite. 590 C for 5 seconds, 350 C for 50 seconds, cool to room temperature.
Final Exam Wednesday, March 21, noon to 3:00 pm (160 points total) 1. TTT Diagrams A U.S. steel producer has four quench baths, used to quench plates of eutectoid steel to 700 C, 590 C, 350 C, and 22 C
7.1 The lac Operon 7-1
7.1 The lac Operon The lac operon was the first operon discovered It contains 3 genes coding for E. coli proteins that permit the bacteria to use the sugar lactose Galactoside permease (lacy) which transports
Learning Virtual Work Method in Statics in a Nutshell: Demystifying It as a Magic Black Box
Learning Virtual Work Method in Statics in a Nutshell: Demstifing It as a Magic Black Box Ing-Chang Jong Universit of rkansas bstract Statics is a fundamental course in mechanics and is taken b students
CHAPTER 13 LECTURE SLIDES
CHAPTER 13 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
New Replaceable Coupling Beams for Shear Wall Structures
New Replaceable Coupling Beams for Shear Wall Structures Yun Chen State Key laboratory of Disaster Reduction in Civil Engineering, Tongji University, Shanghai, China Xilin Lu State Key laboratory of Disaster
DNA Structure and Properties Basic Properties Predicting Melting Temperature. Dinesh Yadav
DNA Structure and Properties Basic Properties Predicting Melting Temperature Dinesh Yadav Nucleic Acid Structure Question: Is this RNA or DNA? Molecules of Life, pp. 15 2 Nucleic Acid Bases Molecules of
Bi 8 Lecture 7. Ellen Rothenberg 26 January Reading: Ch. 3, pp ; panel 3-1
Bi 8 Lecture 7 PROTEIN STRUCTURE, Functional analysis, and evolution Ellen Rothenberg 26 January 2016 Reading: Ch. 3, pp. 109-134; panel 3-1 (end with free amine) aromatic, hydrophobic small, hydrophilic
1.10 Close packed structures cubic and hexagonal close packing
1.9 Description of crystal structures The most common way for describing crystal structure is to refer the structure to the unit cell. The structure is given by the size and shape of the cell and the position
Aerobic and Anaerobic Biodegradation. Danny Clark ENSO Bottles LLC 06/29/2010
2010 Aerobic and Anaerobic Biodegradation Danny Clark ENSO Bottles LLC 06/29/2010 Aerobic and Anaerobic Biodegradation A look into aerobic and anaerobic biodegradation By Danny Clark ENSO Bottles, LLC
Mobility laws in dislocation dynamics simulations
Materials Science and Engineering A 387 389 (2004) 277 281 Mobility laws in dislocation dynamics simulations Wei Cai, Vasily V. Bulatov Lawrence Livermore National Laboratory, University of California,
Introduction to DNA. Natalia Tretyakova, College of Pharmacy, U. of Minnesota Richard Lavery, Institut de Biologie Physico-Chimique, Paris
Introduction to DNA Lecture notes edited by John Reif from PPT lectures by: Natalia Tretyakova, College of Pharmacy, U. of Minnesota Richard Lavery, Institut de Biologie Physico-Chimique, Paris Image from
GHS and DOT What You Need to Know Today. Bruce Carlile and John Baker COQA Meeting February 2015
GHS and DOT What You Need to Know Today Bruce Carlile and John Baker COQA Meeting February 2015 Introduction for COQA Meeting February 2015 What has Bureau Veritas become today? What is GHS? Review of
Nucleotide Metabolism Biochemistry by Lippincott pp
Nucleotide Metabolism Biochemistry by Lippincott pp 291-306 Metabolism: CONCEPT Ø Metabolism is the totality of an organism s chemical reactions. Ø A metabolic pathway begins with a specific molecule and
AN ASSESSMENT OF CAPPED POLYALKYLENE GLYCOL TECHNOLOGY FOR CO 2 REFRIGERATION. Elizabeth Dixon
AN ASSESSMENT OF CAPPED POLYALKYLENE GLYCOL TECHNOLOGY FOR CO 2 REFRIGERATION. Elizabeth Dixon LAPORTE - COGNIS Introduction The refrigeration industry has recently realised a number of significant changes
Basic Concepts of Human Genetics
Basic oncepts of Human enetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. ne pair is called sex chromosomes
Lab Exercise: Examining Water Quality: Most Probable Number & Colilert Test Kit Lab
Lab Exercise: Examining Water Quality: Most Probable Number & Colilert Test Kit Lab OBJECTIVES 1. Understand the use of MPN to determine likely fecal water contamination. 2. Understand the use of MUG,
6- Important Molecules of Living Systems. Proteins Nucleic Acids Taft College Human Physiology
6- Important Molecules of Living Systems Proteins Nucleic Acids Taft College Human Physiology Proteins Proteins- made from: C, H, O, N, and S. Proteins are very large molecules composed of long chains
The Double Helix. DNA and RNA, part 2. Part A. Hint 1. The difference between purines and pyrimidines. Hint 2. Distinguish purines from pyrimidines
DNA and RNA, part 2 Due: 3:00pm on Wednesday, September 24, 2014 You will receive no credit for items you complete after the assignment is due. Grading Policy The Double Helix DNA, or deoxyribonucleic
COSMOS. Design to Prevent Fatigue. COSMOSWorks. SolidWorks Corporation. Introduction. What is Fatigue?
WHITE PAPER Design to Prevent Fatigue COSMOSWorks CONTENTS Introduction What is Fatigue? 1 Determining the fatigue strength of materials 2 Methods for calculating fatigue life 4 Fatigue life calculation
Total Petroleum Hydrocarbons in Vapor: Seeing the Forest for the Trees
Total Petroleum Hydrocarbons in Vapor: Seeing the Forest for the Trees An Overview and Laboratory Perspective of Air-Phase TPH Suzie Nawikas & Kristin Beckley for H&P Mobile Geochemistry, Inc. Overview
PHYSICAL AND CHEMICAL PROPERTIES
2 SECTION OXYGEN FUEL IGNITION PHYSICAL AND CHEMICAL PROPERTIES OF PROPANE 10 OBJECTIVES SECTION 2 Physical and Chemical Properties of Propane 1) List the two major flammable gases used in the Liquefied
ALE 20. Crystalline Solids, Unit Cells, Liquids and the Uniqueness of Water
Name Chem 162, Section: Group Number: ALE 20. Crystalline Solids, Unit Cells, Liquids and the Uniqueness of Water (Reference: pp. 463 473 of Sec. 12.6 Silberberg 5 th edition) How are the particles within
GCSE BITESIZE Examinations
GCSE BITESIZE Examinations General Certificate of Secondary Education AQA SCIENCE A CHY1A Unit Chemistry C1a (Products from Rocks) AQA Chemistry Unit Chemistry C1a (Products from Rocks) FOUNDATION TIER
User-friendly Summary of Test Results for UltraWater performed by:
User-friendly Summary of Test Results for UltraWater performed by: All test results are certified and performed in NELAP accredited labs to proper EPA Standards. Abstract: All tests performed were done
Pre-Lab 5: Magnesium and Magnesium Oxide
Name: Pre-Lab 5: Magnesium and Magnesium Oxide Section: Answer the following questions after reading the background information at the beginning of the lab. This should be completed before coming to lab.
Chapter 3 Structure of Crystalline Solids
Chapter 3 Structure of Crystalline Solids Crystal Structures Points, Directions, and Planes Linear and Planar Densities X-ray Diffraction How do atoms assemble into solid structures? (for now, focus on
Seed Germination and Stand Establishment. Thomas G Chastain CROP 200 Crop Ecology and Morphology
Seed Germination and Stand Establishment Thomas G Chastain CROP 200 Crop Ecology and Morphology Seed Germination and Stand Establishment Seed Germination Seed Germination is defined as the following: A
Select Al2O3 MAPD : a new Inert Al2O3 column for the trace analysis of polar reactive hydrocarbons.
GC Columns Select Al2O3 MAPD : a new Inert Al2O3 column for the trace analysis of polar reactive hydrocarbons. Jaap de Zeeuw and Coen Duvekot Varian, Inc. Middelburg, The Netherlands Varian PO Box 8033,
Performance Attributes of Organic Corrosion Inhibitors
Performance Attributes of Organic Corrosion Inhibitors Additives 2012 Conference September 12-13, 2012 Sheraton Inner Harbor Baltimore, MD Nathan Kofira Technical Development Manager Overview 1 2 3 Requirements
Hazardous petrol hydrocarbons from refueling with and without vapour recovery
GASOLINE GAS STATION BENZENE EXPOSURE SAMPLING VAPOR FILLING STATION ALKENES AIR POLLUTION GAS CHROMATOGRAPHY Open access manuscript version of Sci. Total Environ. 91 (1990) 49-57 Hazardous petrol hydrocarbons
test 7 3. What is the main function of a vacuole in a cell?
test 7 Name: Date: 1. ase your answer(s) to the following question(s) on the diagram below and on your knowledge of biology. The diagram represents a model cell setup. The locations of three different
Energy Flow through an Ecosystem (Lexile 1020L)
ycles of Matter and Energy Transfer in Ecosystems Energy Flow through an Ecosystem (Lexile 1020L) 1 ll energy necessary to sustain life comes from the sun. Plants harvest this energy directly and are called
Canonical B-DNA CGCGTTGACAACTGCAGAATC GC AT CG TA AT GC TA TA CG AT 20 Å. Minor Groove 34 Å. Major Groove 3.4 Å. Strands are antiparallel
DNA Canonical B-DNA 20 Å GC AT CG TA CGCGTTGACAACTGCAGAATC 34 Å AT GC TA Minor Groove 3.4 Å TA CG AT Major Groove Strands are antiparallel CG GC GC Canonical B DNA First determined experimentally by fiber
Chapter Outline Dislocations and Strengthening Mechanisms. Introduction
Chapter Outline Dislocations and Strengthening Mechanisms What is happening in material during plastic deformation? Dislocations and Plastic Deformation Motion of dislocations in response to stress Slip
SCIENCE STD. VII CARBON AND ITS ALLOTROPES
SCIENCE STD. VII CARBON AND ITS ALLOTROPES OCCURENCE OF CARBON: Carbon is the fourth most abundant element in the universe. It exists in the free as well as in the combined state in nature. Carbon is found
Cells and Tissues. Overview CELLS
Cells and Tissues WIll The basic unit of structure and function in the human body is the cell. Each of a cell's parts, or organelles, as well as the entire cell, is organized to perform a specific function.
Chapter 8 Deformation and Strengthening Mechanisms. Question: Which of the following is the slip system for the simple cubic crystal structure?
Chapter 8 Deformation and Strengthening Mechanisms Concept Check 8.1 Why? Question: Which of the following is the slip system for the simple cubic crystal structure? {100} {110} {100} {110}
Pre-Lab: Molecular Biology
Pre-Lab: Molecular Biology Name 1. What are the three chemical parts of a nucleotide. Draw a simple sketch to show how the three parts are arranged. 2. What are the rules of base pairing? 3. In double
PORTAL FRAMES 1.0 INTRODUCTION
36 PORTAL FRAMES 1.0 INTRODUCTION The basic structural form of portal frames was developed during the Second World War, driven by the need to achieve the low - cost building envelope. Now they are the
BETA STRAND Prof. Alejandro Hochkoeppler Department of Pharmaceutical Sciences and Biotechnology University of Bologna
Prof. Alejandro Hochkoeppler Department of Pharmaceutical Sciences and Biotechnology University of Bologna E-mail: a.hochkoeppler@unibo.it C-ter NH and CO groups: right, left, right (plane of the slide)
BAR STRAIN GAGE DATA SEMICONDUCTOR BAR STRAIN GAGES DATA SHEET
SEMICONDUCTOR BAR STRAIN GAGES DATA SHEET BAR STRAIN GAGE DATA BAR GAGE SCHEMATIC See Table for X, Y & Z dimensions X=Overall Length Y= Active Area Z= Width BAR SEMICONDUCTOR STRAIN GAGES Part Number Lead
Conversion of Hydrocarbons into Syn-Gas Stimulated by Non-thermal Atmospheric Pressure Plasma
Conversion of Hydrocarbons into Syn-Gas Stimulated by Non-thermal Atmospheric Pressure Plasma Alexander Fridman, Alexander Gutsol Young I Cho, Chiranjeev Kalra Plasma Catalysis Vs. Plasma Processing Methane
Astronomy picture of the day (4/21/08)
Biol 205 Spring 2008 Astronomy picture of the day (4/21/08) http://antwrp.gsfc.nasa.gov/apod/ap080421.html Are viruses alive? http://serc.carleton.edu/microbelife/yellowstone/viruslive.html 1 Week 3 Lecture
Crush Performance of Thin Walled Spot-Welded and Weld-Bonded Sections
Crush Performance of Thin Walled Spot-Welded and Weld-Bonded Sections Paul Davidson*, M.S Engineering Prof. Donald Malen University of Michigan, Ann Arbor, MI 48109 *pauldave@umich.edu Acknowledgement
PROCESS MOISTURE ANALYZERS Measuring moisture in gas or HC liquids in hazardous areas
PROCESS MOISTURE ANALYZERS Measuring moisture in gas or HC liquids in hazardous areas EExd Construction Safety by containment PROCESS MOISTURE ANALYZER Channel 1 dew-point & pressure sensor Through-glass
(3) The compound boron nitride (BN) has a high melting point (2967 ºC), high density, and is very hard. What is the best classification of this solid?
Solids and Liquids Name: Period: (1) Identify the type of solid formed by each compound. (a) Ag (b) CO 2 (c) SiO 2 (d) wax (e) MgCl 2 (f) Fe (g) graphite (h) SO 2 (i) CaCO 3 (j) I 2 (k) rubber (l) SiC
Central Dogma. 1. Human genetic material is represented in the diagram below.
Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)