Introduction to DNA. Natalia Tretyakova, College of Pharmacy, U. of Minnesota Richard Lavery, Institut de Biologie Physico-Chimique, Paris
|
|
|
- Gervais Parsons
- 6 years ago
- Views:
Transcription
1 Introduction to DNA Lecture notes edited by John Reif from PPT lectures by: Natalia Tretyakova, College of Pharmacy, U. of Minnesota Richard Lavery, Institut de Biologie Physico-Chimique, Paris Image from
2 DNA Double helix Stores genetic code as a linear sequence of bases 20 Å in diameter Human genome 3.3 x 10 9 bp 25,000 genes Richard Lavery Institut de Biologie Physico-Chimique, Paris
3 DNA Size Scale
4 Chemical bond 1 Å (10-10 m) Amino acid 10 Å (10-9 m) Globular protein 100 Å (10-8 m) Virus 1000 Å (10-7 m) Cell nucleus 1 µm (10-6 m) Bacterial cell 5 µm (10-5 m) Chromosome DNA 10 cm (10-1 m) Richard Lavery Institut de Biologie Physico-Chimique, Paris Biological length scale
5 DNA BASES
6 The Building Blocks of DNA OH ribose H deoxyribose Nucleoside Nucleotide Richard Lavery Institut de Biologie Physico-Chimique, Paris
7 Ø Nucleotides are linked by phosphodiester bonds Ø Strand has a direction (5' 3') Ø DNA is negatively charged on phosphate backbone. Richard Lavery Institut de Biologie Physico-Chimique, Paris
8 C8 N7 C5 C6 N1 N3 C4 C5 C6 N9 C4 N3 C2 C2 N1 Purine (Pur / R) Pyrimidine (Pyr / Y) Richard Lavery Institut de Biologie Physico-Chimique, Paris Base families
9 DNA and RNA nucleobases NH 2 O 8 7 N 5 6 N 1 N N N NH 9 N H 4 Purine N 3 2 N H N Adenine (A) N H N Guanine (G) NH N 3 NH 2 N H 3 C O NH O NH 6 N H 1 Pyrimidine 2 N H Cytosine (C) O N H Thymine (T) (DNA only) O N H O Uracil (U) (RNA only) Natalia Tretyakova College of Pharmacy, U. of Minnesota
10 Richard B. Hallick Introductory Course in Biology or Biochemistry Purine Bases The 9 atoms that make up the fused rings (5 carbon, 4 nitrogen) are numbered 1-9. All ring atoms lie in the same plane.
11 Natalia Tretyakova College of Pharmacy, U. of Minnesota Purine Nucleotides
12 Richard B. Hallick Introductory Course in Biology or Biochemistry Pyrimidine Bases All pyrimidine ring atoms lie in the same plane.
13 Natalia Tretyakova College of Pharmacy, U. of Minnesota Pyrimidine Nucleotides
14 Nomenclature of nucleobases, nucleosides, and mononucleotides nucleobase (Deoxy) nucleoside 5 -mononucleotide Adenine (A) Guanine (G) Thymine (T) Cytosine (C) Uracil (U) 2 -Deoxyadenosine (da) 2 - Deoxyguanosine (dg) 2 - Deoxythymidine (dt) 2 - Deoxycytidine (dc) Uridine (U) Deoxyadenosine 5 -monophosphate (5 -damp) Deoxyguanosine 5 -monophosphate (5 -dgmp) Deoxythymidine 5 -monophosphate (5 -dtmp) Deoxycytidine 5 -monophosphate (5 -dcmp) Uridine 5 -monophosphate (5 -UMP) Natalia Tretyakova College of Pharmacy, U. of Minnesota
15 Structural differences between DNA and RNA DNA O RNA O H 3 C NH NH N O H Thymine (T) N O H Uracil (U) HO CH 2 H H O O H H Base H HO CH 2 H H O O Base H H OH 2'-deoxyribose ribose Natalia Tretyakova College of Pharmacy, U. of Minnesota
16 Deoxyribose Sugar The hydroxyl groups on the 5'- and 3'- carbons link to the phosphate groups to form the DNA backbone. Richard B. Hallick Introductory Course in Biology or Biochemistry
17 Richard B. Hallick Introductory Course in Biology or Biochemistry Nucleosides A nucleotide is a nucleoside with one or more phosphate groups covalently attached to the 3'- and/or 5'-hydroxyl group(s).
18 Preferred conformations of nucleobases and sugars in DNA and RNA NH 2 NH 2 N N HO O N O HO O O N OH Anti conformation OH Syn conformation Sugar puckers: 7.0 A Natalia Tretyakova College of Pharmacy, U. of Minnesota HO 5' 5.9 A HO HO 2' BASE 5' 3' BASE O 1' O 1' 3' H (OH) HO H (OH) 2' endo (B-DNA) 3' endo (RNA)
19 Nucleosides Must Be Converted to 5 -Triphosphates to be Part of DNA and RNA HO O Base Kinase O HO P HO O O Base OH ATP OH Mo no ph osphate ATP Kinase O HO P HO O O P O OH O P O OH O Base Kinase O HO P HO O O P O OH O Base OH ATP OH Triphosp ha te Di phosphat e Natalia Tretyakova College of Pharmacy, U. of Minnesota
20 DNA BASE PAIRING
21 Thymine -Adenine Cytosine -Guanine Watson-Crick base pairs Richard Lavery Institut de Biologie Physico-Chimique, Paris
22 Richard B. Hallick Introductory Course in Biology or Biochemistry A-T and G-C Base Pairing
23 Hydrogen bond donors and acceptors on each edge of a base pair Major groove To deoxyribose To deoxyribose Minor groove Natalia Tretyakova College of Pharmacy, U. of Minnesota
24 Richard Lavery Institut de Biologie Physico-Chimique, Paris Purine always binds with a Pyrimidine
25 Richard Lavery Institut de Biologie Physico-Chimique, Paris Base pair dimensions
26 RNA : A,U,G,C + ribose DNA : A,T,G,C + deoxyribose Richard Lavery Institut de Biologie Physico-Chimique, Paris DNA/RNA chemical structure
27 DNA BACKBONE STRUCTURE
28 Helix Axis View: Backbone structure: Alternating backbone of deoxyribose and phosphodiester groups Chain has a direction (known as polarity), 5'- to 3'- from top to bottom Oxygens (red atoms) of phosphates are polar and negatively charged Bases extend away from chain, and stack atop each other Bases are hydrophobic Richard B. Hallick Introductory Course in Biology or Biochemistry
29 OnScreen DNA Model app
30 B-DNA STRUCTURE
31 Video of DNA Helix Structure: Contains material from: Alberts, Bray, Hopkin, Johnson, Lewis, Raff, Roberts, Walter, Essential Cell Biology, Second Edition, Garland Science Publishing, 2004
32 B-DNA Structure 20 Å GC AT CG TA CGCGTTGACAACTGCAGAATC 34 Å AT GC TA Minor Groove 3.4 Å TA CG AT Major Groove Strands are antiparallel CG GC GC Richard Lavery Institut de Biologie Physico-Chimique, Paris
33 Features of the B-DNA Double Helix Two DNA strands form a helical spiral, winding around a helix axis in a right-handed spiral The two polynucleotide chains run in opposite directions The sugar-phosphate backbones of the two DNA strands wind around the helix axis like the railing of a sprial staircase The bases of the individual nucleotides are on the inside of the helix, stacked on top of each other like the steps of a spiral staircase. Richard B. Hallick Introductory Course in Biology or Biochemistry
34 Richard Lavery Institut de Biologie Physico-Chimique, Paris B-DNA (axial view)
35 R.H. helix B-DNA (lateral view) Richard Lavery Institut de Biologie Physico-Chimique, Paris
36 Natalia Tretyakova College of Pharmacy, U. of Minnesota Base stacking: an axial view of B-DNA
37 PI Bonds (Mechanism of PI Base Stacking)
38 Forces stabilizing DNA double helix 1. Hydrogen bonding (2-3 kcal/mol per base pair) 2. Stacking (hydrophobic) interactions (4-15 kcal/mol per base pair) 3. Electrostatic forces. Comparison to other bonds 1. Covalent Bond Energies: 1. C-C 85 kcal/mol 2. C-O 87 kcal/mol Natalia Tretyakova College of Pharmacy, U. of Minnesota
39 right handed helix helical axis passes through base pairs planes of bases are nearly perpendicular to the helix axis. 3.4 A rise between base pairs B-DNA 23.7 A Sugars are in the 2 endo conformation. 7.0 A HO 5' O 3' HO Bases are the anti conformation. NH 2 N 2' BASE 1' H (OH) Wide and deep HO N O O Narrow and deep OH Bases have a helical twist of 34.6º (10.4 bases per helix turn) Helical pitch = 34 A Natalia Tretyakova College of Pharmacy, U. of Minnesota
40 DNA can deviate from the ideal Watson-Crick structure Helical twist ranges from 28 to 42 Propeller twisting 10 to 20 Base pair roll Natalia Tretyakova College of Pharmacy, U. of Minnesota
41 Richard Lavery Institut de Biologie Physico-Chimique, Paris DNA grooves
42 Major groove and Minor groove of DNA Hypothetical situation: the two grooves would have similar size if dr residues were attached at 180 to each other To deoxyribose-c1 Base Base C1 -To deoxyribose Major groove Major groove To deoxyribose C-1 N N N O NH NH 2 Minor groove H 2 N N O N C-1 To deoxyribose C-1 N N N N NH 2 Minor groove O HN O N C-1 Natalia Tretyakova College of Pharmacy, U. of Minnesota
43 Major and minor groove of the double helix Major groove To deoxyribose C-1 N N N O NH NH 2 Minor groove H 2 N N O N C-1 To deoxyribose Wide and deep C-1 N N N NH 2 N O HN O N C-1 Narrow and deep Natalia Tretyakova College of Pharmacy, U. of Minnesota
44 B-type duplex is not possible for RNA HO CH 2 H O H Base H H O OH ribose steric clash Natalia Tretyakova College of Pharmacy, U. of Minnesota
45 A-DNA STRUCTURE
46 De-hydration Hydration Antiparallel strands B A Richard Lavery Institut de Biologie Physico-Chimique, Paris A and B DNA allomorphs
47 Richard Lavery Institut de Biologie Physico-Chimique, Paris A-DNA (longitudinal view)
48 R.H. helix A-DNA (lateral view) Richard Lavery Institut de Biologie Physico-Chimique, Paris
49 A-form helix: dehydrated DNA; RNA-DNA hybrids Right handed helix planes of bases are tilted 20 relative the helix axis. Sugars are in the 3 endo conformation. Bases are the anti conformation 2.3 A rise between base pairs 25.5 A 11 bases per helix turn Helical pitch = 25.3 A Top View Natalia Tretyakova College of Pharmacy, U. of Minnesota
50 The sugar puckering in A-DNA is 3 -endo 5.9 A 7.0 A O 5' 2' BASE O 1' 3' H (OH) O 2' endo (3' exo) B-DNA O O 3' 5' O 2' H (OH) 3' endo (A-DNA) BASE 1' Natalia Tretyakova College of Pharmacy, U. of Minnesota
51 A-DNA has a shallow minor groove and a deep major groove Major groove To deoxyribose N N N O H 2 N NH N N N O H 2 N NH 2 O N Minor groove N NH N NH 2 O To deoxyribose To deoxyribose Major groove Helix axis Minor groove N To deoxyribose B-DNA A-DNA Natalia Tretyakova College of Pharmacy, U. of Minnesota
52 Z-DNA STRUCTURE
53 Richard Lavery Institut de Biologie Physico-Chimique, Paris Z-DNA (longitudinal view)
54 L.H. helix Z-DNA (lateral view) Richard Lavery Institut de Biologie Physico-Chimique, Paris
55 Richard Lavery Institut de Biologie Physico-Chimique, Paris Base pairs are rotated in Z-DNA
56 Z-form double helix: polynucleotides of alternating purines and pyrimidines (GCGCGCGC) at high salt Left handed helix planes of the bases are tilted 9 relative the helix axis. 3.8 A rise between base pairs Backbone zig-zags because suga puckers alternate between 2 endo pyrimidines and 3 endo (purines) Bases alternate between anti (pyrimidines) and syn conformation (purines). 12 bases per helix turn 18.4 A Helical pitch = 45.6 A Flat major groove Narrow and deep minor groove Natalia Tretyakova College of Pharmacy, U. of Minnesota
57 Sugar and base conformations in Z-DNA alternate: 5 -GCGCGCGCGCGCG 3 -CGCGCGCGCGCGC C: sugar is 2 -endo, base is anti G: sugar is 3 -endo, base is syn NH 2 O N HN HO 5' O 3' HO H 2 N N O 2' N HO HO 1' 3' 5' H O C G H N 1' N Natalia Tretyakova College of Pharmacy, U. of Minnesota
58 Comparing A, B and Z-DNA
59 Natalia Tretyakova College of Pharmacy, U. of Minnesota
60 Biological relevance of the minor types of DNA secondary structure Although the majority of chromosomal DNA is in B-form, some regions assume A- or Z-like structure Runs of multiple Gs are A-like The upstream sequences of some genes contain 5-methylcytosine = Z-like duplex NH 2 H 3 C N N H O 5-methylcytosine (5-Me-C) Structural variations play a role in DNA-protein interactions RNA-DNA hybrids and ds RNA have an A-type structure Natalia Tretyakova College of Pharmacy, U. of Minnesota
61
62 Backbone Dihedrals
63 ν 0 Backbone dihedrals - I Richard Lavery Institut de Biologie Physico-Chimique, Paris
64 Staggered Eclipsed Dihedral angle definition Richard Lavery Institut de Biologie Physico-Chimique, Paris
65 gauche - gauche + trans Favoured conformations Richard Lavery Institut de Biologie Physico-Chimique, Paris
66 α : O3 P O5 C5 g - β : P O5 C5 C4 t γ : O5 C5 C4 C3 g + δ : C5 C4 C3 O3 g + ε : C4 C3 O3 P t ζ : C3 O3 P O5 g - χ (Y) : O4 C1 N1 C2 g - χ(r) : O4 C1 N9 C4 Backbone dihedrals - II Richard Lavery Institut de Biologie Physico-Chimique, Paris
67 Richard Lavery Institut de Biologie Physico-Chimique, Paris syn-anti glycosidic conformations
68 C5 ENDO EXO Base Richard Lavery Institut de Biologie Physico-Chimique, Paris Sugar ring puckering
69 Sugar pucker described as pseudorotation North : C3 -endo East : O4 -endo South : C3 -endo "2 B or not 2 B..." W. Shakespeare 1601
70 tan P = (ν 4 - ν 1 ) - (ν 3 - ν 0 ) ν 4 ν 0 Base 2ν 2 (Sin 36 + Sin72 ) Amp = ν 2 / Cos P ν 3 ν 2 ν 1 Pseudorotation Equations Altona et al. J. Am. Chem. Soc. 94, 1972, 8205
71 Richard Lavery Institut de Biologie Physico-Chimique, Paris Preferred sugar puckers
72 Richard Lavery Institut de Biologie Physico-Chimique, Paris Sugar pucker and P-P distance
73 UNUSUAL DNA STRUCTURES
74 Reversed Watson-Crick Watson-Crick Hoogsteen Reversed Hoogsteen Alternative base pairs Richard Lavery Institut de Biologie Physico-Chimique, Paris
75 - note C(N3) protonation Richard Lavery Institut de Biologie Physico-Chimique, Paris Watson-Crick + Hoogsteen = Base triplet
76 Richard Lavery Institut de Biologie Physico-Chimique, Paris Triple helix DNA
77 Guanine Hoogsteen pairing Base tetraplex Richard Lavery Institut de Biologie Physico-Chimique, Paris
78 Watson Crick vs Hoogsteen Hydrogen Bonding. (inset, G-C bonding also shown) Robert E Johnson et. al University of Texas Medical Branch
79 Richard Lavery Institut de Biologie Physico-Chimique, Paris Quadruplex DNA
80 Inverted repeat can lead to loop formation Richard Lavery Institut de Biologie Physico-Chimique, Paris
81 Holliday junction DNA cruciform Richard Lavery Institut de Biologie Physico-Chimique, Paris
82 Richard Lavery Institut de Biologie Physico-Chimique, Paris PNA versus DNA
83 Ø Achiral, peptide-like backbone Ø Backbone is uncharged High thermal stability Ø High-specificity hybridization with DNA Ø Resistant to enzymatic degradation Ø Can displace DNA strand of duplex Ø Pyrimidine PNA strands can form 2:1 triplexes with ssdna Ø Biotechnological applications Richard Lavery Institut de Biologie Physico-Chimique, Paris Peptide Nucleic acid(pna)
84 Richard Lavery Institut de Biologie Physico-Chimique, Paris Parallel-stranded DNA
85 I-DNA: intercalated parallel-stranded duplexes Richard Lavery Institut de Biologie Physico-Chimique, Paris
86 Richard Lavery Institut de Biologie Physico-Chimique, Paris α and β nucleotide anomers
87 H OH is not the only change in passing from DNA to RNA... Richard Lavery Institut de Biologie Physico-Chimique, Paris
88 Biophysical properties of DNA
89 Biophysical properties of DNA Facile denaturation (melting) and re-association of the duplex are important for DNA s biological functions. In the laboratory, melting can be induced by heating. A 260 Single strands T T M duplex T, C Hybridization techniques are based on the affinity of complementary DNA strands for each other. Duplex stability is affected by DNA length, % GC base pairs, ionic strength, the presence of organic solvents, ph Natalia Negative Tretyakova charge can be separated by gel electrophoresis College of Pharmacy, U. of Minnesota
90 Separation of DNA fragments by PAGE DNA strands are negatively charged. Migrate towards the (+) electrode (anode) Migration time ~ ln ( number of base pairs)
91 Principles of Nucleic Acid Structure, W. Saenger, 1984 Springer-Verlag Nucleic Acid Structure, Ed. S. Neidle, 1999 Oxford University Press DNA Structure and Function, R.R. Sinden, 1994 Academic Press Biochemistry, D. Voet and J.G. Voet, 1998 DeBoeck The Eighth Day of Creation, H.F. Judson, 1996 Cold Spring Harbour Press Richard Lavery Institut de Biologie Physico-Chimique, Paris Books on DNA
92 HISTORY of DNA
93 1865 Gregor Mendel publishes his work on plant breeding with the notion of "genes" carrying transmissible characteristics 1869 "Nuclein" is isolated by Johann Friedrich Miescher à Tübingen in the laboratory of Hoppe-Seyler 1892 Meischer writes to his uncle "large biological molecules composed of small repeated chemical pieces could express a rich language in the same way as the letters of our alphabet" 1920 Recognition of the chemical difference between DNA and RNA Phoebus Levene proposes the "tetranucleotide hypothesis" 1938 William Astbury obtains the first diffraction patters of DNA fibres Richard Lavery Institut de Biologie Physico-Chimique, Paris History of DNA
94 1944 Oswald Avery (Rockefeller Institute) proves that DNA carries the genetic message by transforming bacteria History of DNA Richard Lavery Institut de Biologie Physico-Chimique, Paris
95 1950 Erwin Chargaff discovers A/G = T/C Richard Lavery Institut de Biologie Physico-Chimique, Paris History of DNA
96 1953 Watson and Crick propose the double helix as the structure of DNA based on the work of Erwin Chargaff, Jerry Donohue, Rosy Franklin and John Kendrew Richard Lavery Institut de Biologie Physico-Chimique, Paris History of DNA
97 Maurice Wilkins Kings College, London Richard Lavery Institut de Biologie Physico-Chimique, Paris
98 Watson-Crick model of DNA was based on X-ray diffraction picture of DNA fibres (Rosalind Franklin and Maurice Wilkins) Rosalind Franklin Natalia Tretyakova College of Pharmacy, U. of Minnesota
99 Rosalind Franklin (in Paris) Richard Lavery Institut de Biologie Physico-Chimique, Paris
100 X-ray fibre diffraction pattern of B-DNA Richard Lavery Institut de Biologie Physico-Chimique, Paris
101 Richard Lavery Institut de Biologie Physico-Chimique, Paris Linus Pauling s DNA
102 DNA secondary structure double helix James Watson and Francis Crick, proposed a model for DNA structure Francis Crick Jim Watson DNA is the molecule of heredity (O.Avery, 1944) Natalia Tretyakova College of Pharmacy, U. of Minnesota X-ray diffraction (R.Franklin and M. Wilkins)
103 Watson and Crick Richard Lavery Institut de Biologie Physico-Chimique, Paris
104 It has not escaped our notice that the specific pairing we have postulated suggests a possible copying mechanism for the genetic material. Richard Lavery Institut de Biologie Physico-Chimique, Paris It has not escaped our notice
105 Richard Lavery Institut de Biologie Physico-Chimique, Paris Double helix?
106 Nucleic Acids DNA (deoxyribonucleic acids) RNA (ribonucleic acids) Central Dogma of Biology DNA RNA Proteins Cellular Action replication transcription translation DNA Natalia Tretyakova College of Pharmacy, U. of Minnesota
107 Richard Lavery Institut de Biologie Physico-Chimique, Paris Dickerson Dodecamer (Oct. 1980)
Canonical B-DNA CGCGTTGACAACTGCAGAATC GC AT CG TA AT GC TA TA CG AT 20 Å. Minor Groove 34 Å. Major Groove 3.4 Å. Strands are antiparallel
DNA Canonical B-DNA 20 Å GC AT CG TA CGCGTTGACAACTGCAGAATC 34 Å AT GC TA Minor Groove 3.4 Å TA CG AT Major Groove Strands are antiparallel CG GC GC Canonical B DNA First determined experimentally by fiber
1.1 Chemical structure and conformational flexibility of single-stranded DNA
1 DNA structures 1.1 Chemical structure and conformational flexibility of single-stranded DNA Single-stranded DNA (ssdna) is the building base for the double helix and other DNA structures. All these structures
Structural Bioinformatics (C3210) DNA and RNA Structure
Structural Bioinformatics (C3210) DNA and RNA Structure Importance of DNA/RNA 3D Structure Nucleic acids are essential materials found in all living organisms. Their main function is to maintain and transmit
Non-standard base pairs Non-standard base pairs play critical roles in the varied structures observed in DNA and RNA.
DNA ORIENTATION Non-standard base pairs Non-standard base pairs play critical roles in the varied structures observed in DNA and RNA. Non-standard base pairs Wobble and mismatched base pairs still use
How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information
DNA: CH 13 How do we know what the structure and function of DNA is? - Double helix, base pairs, sugar, and phosphate - Stores genetic information Discovering DNA s Function 1928: Frederick Griffith studied
Biochemistry Prof. S. Dasgupta Department of Chemistry. Indian Institute of Technology Kharagpur. Lecture - 16 Nucleic Acids - I
Biochemistry Prof. S. Dasgupta Department of Chemistry. Indian Institute of Technology Kharagpur Lecture - 16 Nucleic Acids - I We start our discussion on Nucleic Acids and their components. Before we
Fundamentals of Organic Chemistry. CHAPTER 10: Nucleic Acids
Fundamentals of Organic Chemistry CHEM 109 For Students of Health Colleges Credit hrs.: (2+1) King Saud University College of Science, Chemistry Department CHEM 109 CHAPTER 10: Nucleic Acids 2 o Nucleic
MBMB,BCHM, or CHEM 451A
MBMB,BCHM, or CHEM 451A This is a team taught course Blaine Bartholomew: 1 st section Joseph Schmit: 2 nd section Peter Hardwicke:3 rd Section Text is Lehninger Principles of Biochemistry 4 th edition
Chapter 5: Nucleic Acids, etc.
Chapter 5: Nucleic Acids, etc. Voet & Voet: Sections 1 & 3 Pages 82-84 & 88-93 Any introductory Biochemistry textbook will have an introductory chapter on nucleic acids Slide 1 Nucleotides and Derivatives
Nucleic acids. How DNA works. DNA RNA Protein. DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology
Nucleic acid chemistry and basic molecular theory Nucleic acids DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Cell cycle DNA RNA Protein Transcription Translation
Gene and DNA structure. Dr Saeb Aliwaini
Gene and DNA structure Dr Saeb Aliwaini 2016 DNA during cell cycle Cell cycle for different cell types Molecular Biology - "Study of the synthesis, structure, and function of macromolecules (DNA, RNA,
MOLECULAR STRUCTURE OF DNA
MOLECULAR STRUCTURE OF DNA Characteristics of the Genetic Material 1. Replication Reproduced and transmitted faithfully from cell to cell (generation to generation) 2. Information Storage Biologically
Nucleotides and Nucleic Acids
ucleotides and ucleic Acids ucleotides: Composed of a sugar; a weak nitrogenous base; at least one phosphoryl group - - P - C 2 Base *ucleoside: sugar + base 2 Classes of ucleotides: Ribonucleotides and
DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.
DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,
Paper : 03 Structure and Function of Biomolecules II Module: 02 Nucleosides, Nucleotides and type of Nucleic Acids
Paper : 03 Structure and Function of Biomolecules II Module: 02 Nucleosides, Nucleotides and type of Nucleic Acids Principal Investigator Paper Coordinators Prof. Sunil Kumar Khare, Professor, Department
Opening Activity. DNA is often compared to a ladder or a spiral staircase. Look at the picture above and answer the following questions.
Opening Activity DNA is often compared to a ladder or a spiral staircase. Look at the picture above and answer the following questions. 1. How is the structure of DNA similar to that of a ladder or spiral
CHAPTER 8 Nucleotides and Nucleic Acids
CHAPTER 8 Nucleotides and Nucleic Acids Key topics Biological function of nucleotides and nucleic acids Structures of common nucleotides Structure of double-stranded DNA Structures of ribonucleic acids
DNA Structures. Biochemistry 201 Molecular Biology January 5, 2000 Doug Brutlag. The Structural Conformations of DNA
DNA Structures Biochemistry 201 Molecular Biology January 5, 2000 Doug Brutlag The Structural Conformations of DNA 1. The principle message of this lecture is that the structure of DNA is much more flexible
The Structure and Func.on of Macromolecules Nucleic Acids
The Structure and Func.on of Macromolecules Nucleic Acids The FOUR Classes of Large Biomolecules All living things are made up of four classes of large biological molecules: Carbohydrates Lipids Protein
Structure and Function of Nucleic Acids
Structure and Function of Nucleic Acids E T Nyahangare Class Assignment 1. Write notes and outline the role of the following in protein biosynthesis a. DNA replication b. Transcription c. Genetic code
Nucleic Acids: How Structure Conveys Information 1. What Is the Structure of DNA? 2. What Are the Levels of Structure in Nucleic Acids? 3.
Fig. 9-CO, p.215 Nucleic Acids: How Structure Conveys Information 1. What Is the Structure of DNA? 2. What Are the Levels of Structure in Nucleic Acids? 3. What Is the Covalent Structure of Polynucleotides?
Nucleic Acids: DNA and RNA
Nucleic Acids: DNA and RNA Living organisms are complex systems. Hundreds of thousands of proteins exist inside each one of us to help carry out our daily functions. These proteins are produced locally,
Components of DNA. Components of DNA. Aim: What is the structure of DNA? February 15, DNA_Structure_2011.notebook. Do Now.
Aim: What is the structure of DNA? Do Now: Explain the Hershey Chase experiment and what was its conclusion? Homework Read pp. 298 299 P.299 3,4,6.7 Do Now Paperclip Combos Material: 8 paperclips, 2 each
From Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
Molecular biology (1)
Molecular biology (1) Color index: Doctors slides Notes and explanations Extra information highlights Objectives Know the central dogma of molecular biology. Understand the composition, types and structure
What Are the Chemical Structures and Functions of Nucleic Acids?
THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic
Fundamentals of Organic Chemistry. CHAPTER 10: Nucleic Acids
Fundamentals of Organic Chemistry CHEM 109 For Students of Health Colleges Credit hrs.: (2+1) King Saud University College of Science, Chemistry Department CHEM 109 CHAPTER 10: Nucleic Acids 2 o Nucleic
UNIT 24: Nucleic Acids Essential Idea(s): The structure of DNA allows efficient storage of genetic information.
UNIT 24: Nucleic Acids Name: Essential Idea(s): The structure of DNA allows efficient storage of genetic information. IB Assessment Statements 2.6.U1 The nucleic acids DNA and RNA are polymers of nucleotides.
Review of ORGANIC CHEMISTRY
Nucleic Acids: DNA Review of ORGANIC CHEMISTRY Definition: Contains CARBON (C) and Hydrogen (H) Large polymers can be made of smaller individual monomers. Ex: For carbohydrates, polysaccharides are large
Nucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
MCB 110:Biochemistry of the Central Dogma of MB. MCB 110:Biochemistry of the Central Dogma of MB
MCB 110:Biochemistry of the Central Dogma of MB Part 1. DNA replication, repair and genomics (Prof. Alber) Part 2. RNA & protein synthesis. Prof. Zhou Part 3. Membranes, protein secretion, trafficking
Friedrich Miescher (1869) Isolated nucleic acids from the nuclei of white blood cells
Friedrich Miescher (1869) Isolated nucleic acids from the nuclei of white blood cells Collected pus from local hospital bandages After further examination he discovered a substance that he called Nuclein
Unit 6 Molecular Genetics
Unit 6 Molecular Genetics I. DNA and RNA structure pages 2-6 II. DNA replication pages 6-7 III. Protein Synthesis pages 7-10 South Dakota State Standard 9-12.L.1.1 Students are able to relate cellular
Nucleic Acids: Structure and Function
ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ydrolysis of nucleotides gives phosphoric acid, a pentose sugar,
Molecular biology (1)
2018/9/24 Molecular biology (1) Important. 436 Notes Original slides. 438 notes Extra information Objectives: Know the central dogma of molecular biology. Understand the composition, types and structure
Nucleotides: structure and functions. Prof. Dalė Vieželienė Biochemistry department Room No
Nucleotides: structure and functions Prof. Dalė Vieželienė Biochemistry department Room No. 229 Email: daleveze@med.kmu.lt Composition of Nucleic Acids Nucleotide structure Two types of nucleic acids:
Exam: Structure of DNA and RNA 1. Deoxyribonucleic Acid is abbreviated: a. DRNA b. DNA c. RNA d. MRNA
Exam: Structure of DNA and RNA 1. Deoxyribonucleic Acid is abbreviated: a. DRNA b. DNA c. RNA d. MRNA 2. Which two scientists discovered DNA? a. Mendel and Newton b. Bohr and Crick c. Watson and Crick
HISTORICAL EXPERIMENTS. DNA as Genetic Material DNA Structure
HISTORICAL EXPERIMENTS DNA as Genetic Material DNA Structure DNA as the genetic material Miescher (1868) Griffith (1928) Avery, McCarty, MacLeod (1944) Hershey, Chase (1952) 1868 - Friedrich Miescher Discovery
Purines vs. Pyrimidines
Introduction to Genetics/DNA Replication The DNA molecule is found in the nucleus and is composed of nucleotides The DNA Molecule Composed of 2 polymers of nucleotides Polymers are oriented in antiparallel
DNA: The Primary Source of Heritable Information. Genetic information is transmitted from one generation to the next through DNA or RNA
DNA and Replication DNA: The Primary Source of Heritable Information Genetic information is transmitted from one generation to the next through DNA or RNA Chromosomes Non-eukaryotic (bacteria) organisms
CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY
Chapter 4 Notes: Part 1 Biochemistry 461 Fall 2010 CHAPTER 4, Part 1: LECTURE TOPICS: DNA and RNA - MOLECULES OF HEREDITY 1) DNA/RNA structures, nomenclature, shorthand conventions 2) DNA and RNA as genetic
Nucleic Acids: Structure and Function
ucleic Acids: Structure and Function Components of ucleotides The building blocks (monomers) of the nucleic acids are called nucleotides. ucleotides are made up of: phosphoric acid, a pentose sugar, and
A nucleotide consists of: an inorganic phosphate group (attached to carbon 5 of the sugar) a 5C sugar (pentose) a Nitrogenous (N containing) base
Nucleic Acids! Nucleic acids are found in all living cells and viruses and the two main types are DNA and RNA. They are macromolecules made of chains of nucleotides bonded together. They carry genetic
Chapter 16 DNA: The Genetic Material. The Nature of Genetic Material. Chemical Nature of Nucleic Acids. Chromosomes - DNA and protein
Chapter 16 DNA: The Genetic Material The Nature of Genetic Material Chromosomes - DNA and protein Genes are subunits DNA = 4 similar nucleotides C(ytosine) A(denine) T(hymine) G(uanine) Proteins = 20 different
Nucleic acids AP Biology
Nucleic acids 2006-2007 Nucleic Acids Information storage 2006-2007 Nucleic Acids Function: u genetic material DNA stores information w genes w blueprint for building proteins n DNA RNA proteins transfers
The nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).
Nucleic acids are macromolecules composed of chains of mononucleotides joined by phosphodiester bonds. The nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Nucleic acids are universal
THE COMPONENTS & STRUCTURE OF DNA
THE COMPONENTS & STRUCTURE OF DNA - How do genes work? - What are they made of, and how do they determine the characteristics of organisms? - Are genes single molecules, or are they longer structures made
DNA Structure. DNA: The Genetic Material. Chapter 14
DNA: The Genetic Material Chapter 14 DNA Structure DNA is a nucleic acid. The building blocks of DNA are nucleotides, each composed of: a 5-carbon sugar called deoxyribose a phosphate group (PO 4 ) a nitrogenous
Molecular Biology (1)
Molecular Biology (1) DNA structure and basic applications Mamoun Ahram, PhD Second semester, 2018-2019 Resources This lecture Cooper, pp. 49-52, 118-119, 130 Nucleic acids 2 types: Deoxyribonucleic acid
Division Ave. High School Ms. Foglia AP Biology. Nucleic acids. AP Biology Nucleic Acids. Information storage
Nucleic acids 2006-2007 Nucleic Acids Information storage 2006-2007 1 DNA Nucleic Acids Function: u genetic material stores information w genes w blueprint for building proteins n DNA RNA proteins transfers
IDENTIFYING THE GENETIC MATERIAL DR. A. TARAB DEPT. OF BIOCHEMISTRY HKMU
IDENTIFYING THE GENETIC MATERIAL DR. A. TARAB DEPT. OF BIOCHEMISTRY HKMU EARLY HYPOTHESES Most people look somewhat like a mixture of their parents In general, certain traits are passed on from one generation
A. Incorrect! A sugar residue is only part of a nucleotide. Go back and review the structure of nucleotides.
Organic Chemistry - Problem Drill 24: ucleic Acids o. 1 of 10 1. What are the components of a nucleotide? (A) A sugar residue (B) A sugar residue + a nitrogenous base (C) A sugar residue + a nitrogenous
Unit 5 DNA, RNA, and Protein Synthesis
1 Biology Unit 5 DNA, RNA, and Protein Synthesis 5:1 History of DNA Discovery Fredrick Griffith-conducted one of the first experiment s in 1928 to suggest that bacteria are capable of transferring genetic
MET Reference Book : Molecular Diagnostics: Fundamentals, Methods and Clinical Applications (Lela Buckingham, Maribeth L.
MET 4217 Reference Book : Molecular Diagnostics: Fundamentals, Methods and Clinical Applications (Lela Buckingham, Maribeth L. Flaws, ) ISBN-13: 978-0-8036-1659-2 ISBN-10: 0-8036-1659-7 / Applied Medical
DNA: The Genetic Material. Chapter 14. Genetic Material
DNA: The Genetic Material Chapter 14 Genetic Material Frederick Griffith, 1928 Streptococcus pneumoniae, a pathogenic bacterium causing pneumonia 2 strains of Streptococcus: - S strain virulent - R strain
By the end of today, you will have an answer to: How can 1 strand of DNA serve as a template for replication?
Name: Period: Date: KIPP NYC College Prep Genetics and Biotech UNIT 9: Introduction to DNA Lecture 4: DNA Modeling and Intro to Replication By the end of today, you will have an answer to: How can 1 strand
Lesson Overview. The Structure of DNA
Lesson Overview The Structure of DNA Related Videos Stated Clearly: http://youtu.be/zwibgnge4ay Bozeman Nucleic acids: http://youtu.be/nnasrkiu5fw Bozeman People who discovered DNA: http://youtu.be/qoervswkmgk
DNA and RNA Structure. Unit 7 Lesson 1
Unit 7 Lesson 1 Students will be able to: Explain the structure and function of the DNA and RNA. Illustrate the structure of nucleotide. Summarize the differences between DNA and RNA. Identify the different
translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
Molecular Biology (1)
Molecular Biology (1) DNA structure and basic applications Mamoun Ahram, PhD Second semester, 2017-2018 Resources This lecture Cooper, pp. 49-52, 118-119, 130 What is molecular biology? Central dogma
Macromolecule Review
DNA: CH 13 Macromolecule Review Nucleic acid Monomer = nucleotide Polymer = DNA, RNA Function = genetic information Protein Monomer = amino acid Polymer = polypeptide Function = structure and chemical
what are proteins? what are the building blocks of proteins? what type of bond is in proteins? Molecular Biology Proteins - review Amino Acids
Molecular Biology The Study of Proteins and Nucleic Acids what are proteins? what are the building blocks of proteins? what type of bond is in proteins? Proteins - review functions include: catalysts for
Frederick Griffith. Dead Smooth Bacteria. Live Smooth Bacteria. Live Rough Bacteria. Live R+ dead S Bacteria
Frederick Griffith Live Smooth Bacteria Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S Bacteria Live Smooth Bacteria Frederick Griffith Live Rough Bacteria Dead Smooth Bacteria Live R+ dead S
Dina Al-Tamimi. Faisal Nimri. Ma amoun Ahram. 1 P a g e
1 Dina Al-Tamimi Faisal Nimri Ma amoun Ahram 1 P a g e **Difference between Molecular Biology and Genetics: Molecular Biology: is a fancy term of biochemistry. It is the science that deals with DNA, RNA
DNA: The Molecule Of Life
DNA: The Molecule Of Life Introductory Concepts -One unique set of DNA in an organism is termed its genome (link to fig 1-3) -DNA is the main component of chromosomes -Humans are diploid organisms, with
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses)
NUCLEIC ACIDS Genetic material of all known organisms DNA: deoxyribonucleic acid RNA: ribonucleic acid (e.g., some viruses) Consist of chemically linked sequences of nucleotides Nitrogenous base Pentose-
DNA. Scientists now know: DNA carries genetic information DNA defines many traits and predisposition for certain diseases
5.1 DNA Structure DNA Scientists now know: DNA carries genetic information DNA defines many traits and predisposition for certain diseases Experiment 1a: Identifying DNA as the Material of Heredity Frederick
Concept 5.5: Nucleic acids store and transmit hereditary information
Concept 5.5: Nucleic acids store and transmit hereditary information The amino acid sequence of a polypeptide is programmed by a unit of inheritance called a gene Genes are made of DNA, a nucleic acid
Nucleic Acids. The book of you. Nucleic Acids DNA RNA PROTEINS. Function: genetic material stores information genes blueprint for building proteins
ucleic Acids DA RA PRTEIS 1 The book of you 2 ucleic Acids Function: genetic material stores information genes blueprint for building proteins DA DA RA proteins transfers information blueprint for new
THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE
Umm AL Qura University THE CELLULAR AND MOLECULAR BASIS OF INHERITANCE Dr. Neda Bogari www.bogari.net EMERY'S ELEMENTS OF MEDICAL GENETICS Peter Turnpenny and Sian Ellard 13 th edition 2008 COURSE SYLLABUS
BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 10 Nucleic Acids
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 10 Nucleic Acids 2 3 DNA vs RNA DNA RNA deoxyribose ribose A, C, G, T A, C, G, U 10 3 10 8 nucleotides 10 2 10 4 nucleotides nucleus cytoplasm double-stranded
Nucleic acids. AP Biology
Nucleic acids 2006-2007 Nucleic Acids Information storage Nucleic Acids: Function: u genetic material stores information w genes w blueprint for building proteins n DNA DNA RNA proteins transfers information
MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization
Overview & Recap of Molecular Biology before the last two sections MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription Gene Organization Joy Winuthayanon, PhD School of Molecular Biosciences
NUCLEIC ACID. Subtitle
NUCLEIC ACID Subtitle NUCLEIC ACID Building blocks of living organisms One of the four important biomolecule 1 st isolated from the nuclei of white blood cells by Friedrich Miescher (1860) Came from the
BIOCHEM SHEET (8) Made by: rahmeh Alsukkar corrected by: date : 11-10
BIOCHEM SHEET (8) Made by: rahmeh Alsukkar corrected by: date : 11-10 1 Note: Thursday it is a revision lecture slide 3 ( 5:11 min ) *nucleic acid is a monomer of DNA *nucleotide composed of :1-nitroenous
DNA Structure, Function, and Engineering Page /14/2018 Dr. Amjid Iqbal 1
DNA Structure, Function, and Engineering Page 40-51 2/14/2018 Dr. Amjid Iqbal 1 Background Organisms exhibit striking similarity at the molecular level. The structures and metabolic activities of all cells
Chapter 13 - Concept Mapping
Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin
DNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
PowerPoint Notes on Chapter 9 - DNA: The Genetic Material
PowerPoint Notes on Chapter 9 - DNA: The Genetic Material Section 1 Identifying the Genetic Material Objectives Relate Griffith s conclusions to the observations he made during the transformation experiments.
Vocabulary: DNA (Deoxyribonucleic Acid) RNA (Ribonucleic Acid) Gene Mutation
STUDENTS WILL: Identify the parts of a DNA molecule and its structure. Explain how DNA copies itself. Describe the structure and function of each kind of RNA. Vocabulary: DNA (Deoxyribonucleic Acid) RNA
All This For Four Letters!?! DNA and Its Role in Heredity
All This For Four Letters!?! DNA and Its Role in Heredity What Is the Evidence that the Gene Is DNA? By the 1920s, it was known that chromosomes consisted of DNA and proteins. A new dye stained DNA and
Nucleic Acids. Biotechnology
Nucleic Acids Biotechnology DNA Deoxyribonucleic acid Forms the Genetic Code 1953 The work of four people identify the structure of DNA. This knowledge opens the floodgates of scientific discovery that
DNA is a nucleic acid which acts as molecular repository for all genetic information
FLOW OF INFORMATION DNA is a nucleic acid which acts as molecular repository for all genetic information Chemically, DNA is a long polymer of simple units called nucleotides, with a backbone made of sugars
GENETICS - CLUTCH CH.7 DNA AND CHROMOSOME STRUCTURE.
!! www.clutchprep.com COCEPT: DA AS THE GEETIC MATERIAL DA wasn t always thought of as the genetic material To be genetic material, a molecule needs to have certain - Store information - Transmit information
II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928
HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA
Reading for lecture 2
Reading for lecture 2 1. Structure of DNA and RNA 2. Information storage by DNA 3. The Central Dogma Voet and Voet, Chapters 28 (29,30) Alberts et al, Chapters 5 (3) 1 5 4 1 3 2 3 3 Structure of DNA and
Nucleic Acid Structure. Nucleic Acid Sequence Abbreviations. Sequence Abbreviations, con t.
BC 4054 Spring 2001 Chapter 11 & 12 Review Lecture otes Slide 1 ucleic Acid Structure Linear polymer of nucleotides Phosphodiester linkage between 3 and 5 positions See Figure 11.17 Slide 2 ucleic Acid
3/10/16 DNA. Essential Question. Answer in your journal notebook/ What impact does DNA play in agriculture, science, and society as a whole?
DNA Essential Question. Answer in your journal notebook/ What impact does DNA play in agriculture, science, and society as a whole? 1 Benchmark SC.912.N.1.3, SC912.L16.9 Explain how & why the genetic code
Syllabus for GUTS Lecture on DNA and Nucleotides
Syllabus for GUTS Lecture on DNA and Nucleotides I. Introduction. DNA is the instruction manual for how to build a living organism here on earth. The instructions in DNA are propagated to future generations
Nucleic Acids. Nucleic Acids. Nucleotides. Types of Nucleotides. Function: Examples: Structure: 3 parts. 2 types of nucleotides.
Nucleic Acids Nucleic Acids : store & transmit hereditary information : RNA (ribonucleic acid) DNA (deoxyribonucleic acid) Structure: monomers = nucleotides Nucleotides 3 parts nitrogen base (C-N ring)
Unit VII DNA to RNA to protein The Central Dogma
Unit VII DNA to RNA to protein The Central Dogma DNA Deoxyribonucleic acid, the material that contains information that determines inherited characteristics. A DNA molecule is shaped like a spiral staircase
DNA: Structure and Function
DNA: Structure and Function Biology's biggest moment in the 20th century, as heralded in six paragraphs in The New York Times, May 16, 1953. 2 Research of DNA Structure Chargaff s Rule of Ratios Amount
Unit 3 Part II: Modern Genetics p
Unit 3.notebook June 03, 2014 Unit 3 Part II: Modern Genetics p.568 569 This part of the unit will focus on DNA how it s structure was determined how it replicates and how it codes for proteins. Mar 21
DNA Structure & Replication (Outline)
DNA Structure & Replication (Outline) Historical perspective (DNA as the genetic material): Genetic transformation DNA as the transforming agent DNA is the genetic material in bacterial viruses (phage)
Lecture 8. Chromosome. The Nuclei. Two Types of Nucleic Acids. Genes. Information Contained Within Each Cell
Information Contained Within Each Cell Lecture 8 Nucleic Acids and Protein Synthesis Chapter 23: Section 1-5 Most higher organisms reproduce sexually! Sperm cell + Egg cell! Fertilized egg The wondrous
Route to DNA discovery
Unit 6 All living things use DNA to pass genetic information to the next generation. Genetic information directs the development and homeostasis of organism through a process of translating the genetic
Nucleic Acids. By Sarah, Zach, Joanne, and Dean
Nucleic Acids By Sarah, Zach, Joanne, and Dean Basic Functions Carry genetic information (DNA storing it) Protein synthesis Helps in cell division (DNA replicates itself) RNA- numerous functions during
}Nucleosides NUCLEIC ACIDS. Nucleic acids are polymers Monomer---nucleotides Nitrogenous bases Purines Pyrimidines Sugar Ribose Deoxyribose
DNA STRUCTURE NUCLEIC ACIDS Nucleic acids are polymers Monomer---nucleotides Nitrogenous bases Purines Pyrimidines Sugar Ribose Deoxyribose Phosphates +nucleoside=nucleotide }Nucleosides The Sugars The
Chapter 9: DNA: The Molecule of Heredity
Chapter 9: DNA: The Molecule of Heredity What is DNA? Answer: Molecule that carries the blueprint of life General Features: DNA is packages in chromosomes (DNA + Proteins) Gene = Functional segment of
Vocabulary. Nucleic Acid Nucleotide Base pairing Complementary Template Strand Semiconservative Replication Polymerase
DNA and Replication TEKS (6) Science concepts. The student knows the mechanisms of genetics, including the role of nucleic acids and the principles of Mendelian Genetics. The student is expected to: (A)