Supplementary methods. RNA isolation, cdna synthesis, and quantitative real-time PCR. Total RNAs were
|
|
- Isaac Evans
- 5 years ago
- Views:
Transcription
1 Supplementary methods RNA isolation, cdna synthesis, and quantitative real-time PCR. Total RNAs were extracted from cells by using an RNeasy Mini Kit (QIAGEN) and then reverse-transcribed using the SuperScript III First-Strand Synthesis System (Life Technologies). Quantitative real-time PCR was performed on a Life Technologies ViiA7 Real-time PCR system using the Fast SYBR Green Master Mix (Life Technologies) and specific primer sets for the GAPDH gene (sense: 5 -GCG GCA CGT CAG ATC CA-3 ; antisense: 5 -CAT GGC CTT CCG TGT TTC CTA-3 ) and the CCL3 gene (sense: 5 -GCT GAC AAG CTC ACC CTC TGT-3 ; antisense: 5 -GGC AGT GGT GGA GAC CTT CA-3 ). Relative expression of the CCL3 gene was analyzed by the ΔΔCt method using the Ct value of the GAPDH gene. Flow cytometry. Isolated leukocytes were stained with various combinations of fluorescent dye-conjugated Abs. For intracellular CCL3 and MPO staining, leukocytes were incubated in serum-free S-Clone SF-03 medium (Sanko Junyaku) supplemented with 0.1 % GolgiStop reagent (BD Biosciences) for 4 h. Subsequently, intracellular CCL3 and MPO were stained with PE-conjugated anti-ccl3 Ab and biotin-conjugated anti-mpo Ab, respectively, and incubated with APC and APC-Cy7-conjugated streptavidin, respectively, with the help of an Intracellular Cytokine Staining Starter Kit (BD Biosciences). Intranuclear Ki67 was stained sequentially with biotin-conjugated anti-ki67 Ab and with APC-conjugated streptavidin using the Foxp3/Transcription Factor Buffer Set (ebioscience). Expression of each molecule was determined using a FACSCantoII (BD Biosciences) and analyzed with FlowJo software (Tree Star). 1
2 In situ hybridization (ISH) assessment of the BM biopsy specimens from patients with CML. For this study, 4-μm sections were prepared from paraffin-embedded tissue and attached to positively charged glass slides. Double-color staining of mrna was conducted using the QuantiGene ViewRNA ISH kit (Panomics Inc.), according to the manufacturer s instruction. Deparaffinized tissue samples were incubated with a pretreatment solution followed by protease digestion. Human CCL3- and ENPP3-specific probes were designed and synthesized by Panomics/Affymetrix. Probe sets and amplifier molecules were hybridized to each pair of oligonucleotides. After the unbound probes were removed by washing, the samples were incubated with alkaline phosphatase to break down the fast red and fast blue substrates to form precipitates. Images of target mrna were acquired using a DP21 microscopic camera (Olympus). Effects of imatinib on cell viability and CCL3 expression in a human basophilic CML cell line, KU812. KU812 cells ( /ml) were incubated at the indicated concentrations of imatinib for 24 h and its cell viability was determined by using the cell counting kit-8 (Dojindo Co. Ltd). The ratios of cell viability were determined by comparing the OD value in the absence of imatinib. At the same time, intracellular CCL3 expression was determined gating on ENPP3- and Fc R1-positive cells by using a flow cytometer., Determination of CCL3 expression in total BM cells of CML patients. BM biopsy samples were obtained from 10 CML patients, who were newly diagnosed at Juntendo University Hospital, three times; prior to, or 3 months or 6 months after the initiation of dasatinib treatment. Total RNAs were extracted and were subjected to quantification of 2
3 the copy number of BCR-ABL gene according to the previously described method. 1 Simultaneously, total RNAs were subjected to quantitative real-time PCR with Life Technologies ViiA7 Real-time PCR system using Thunderbird SYBR qpcr Mix (TOYOBO), and the specific primer sets for GAPDH gene (sense: 5 -aga gac cct cac tgc tg-3 ; antisense: 5 -aga ttc agt gtg gtg gg-3 ) and CCL3 gene 2 (sense: 5 -cca gtt ctc tgc atc act tgc t-3 ; antisense: 5 -ctg ctc gtc tca aag tag tca gct a-3 ). Relative expression of the CCL3 gene was analyzed by the ΔΔCt method using the Ct value of the GAPDH gene. This study was conducted in accordance with the Declaration of Helsinki, and the study design was approved by the Ethics Committee of the Juntendo University (Registration No ). 3
4 List of Abs. Antigen Clone Reactivity Host Company CD4 RM4-5 Mouse Rat TONBO Biosciences CD Mouse Rat TONBO Biosciences CD11b M1/70 Mouse Rat TONBO Biosciences CD16/32 2.4G2 Mouse Rat BD Biosciences CD19 1D3 Mouse Rat BD Biosciences CD34 RAM34 Mouse Rat ebioscience CD45.1 A20 Mouse Rat TONBO Biosciences CD Mouse Rat TONBO Biosciences CD45R/B220 RA3-6B2 Mouse Rat TONBO Biosciences CD48 HN48-1 Mouse Rat ebioscience CD49b DX5 Mouse Rat BioLegend CD117/c-kit ACK2 Mouse Rat TONBO Biosciences CD150/SLAM TC15-12F12.2 Mouse Rat BioLegend CD200R3 Ba13 Mouse Rat BioLegend FcεR1 MAR-1 Mouse Hamster ebioscience FcεR1 AMR-37 Human Mouse ebioscience ENPP3 NP4D6 Human Mouse BioLegend Ki67 SolA15 Mouse Rat ebioscience Lineage cocktail Mouse Rat BD Biosciences Ly-6A/E/Sca-1 D7 Mouse Rat ebioscience Ly-6G/Gr-1 RB6-8C5 Mouse Rat TONBO Biosciences Ly6G 1A8 Mouse Rat TONBO Biosciences MIP-1α/CCL Mouse Rat R & D Systems MIP-1α/CCL Human Mouse R & D Systems Myeloperoxidase 2D4 Rat, Mouse Mouse Abcam TCR-β chain H Mouse Hamster TONBO Biosciences TER-119 TER-119 Mouse Rat TONBO Biosciences Isotype-matched control IgGs for individual rat monoclonal Abs and control mouse IgG were purchased from BD Biosciences. 4
5 Supplementary references 1. Yoshida C, Fletcher L, Ohashi K, et al. Harmonization of molecular monitoring of chronic myeloid leukemia therapy in Japan. Int J Clin Oncol. 2012;17(6): Zhang B, Ho YW, Huang Q, et al. Altered microenvironmental regulation of leukemic and normal stem cells in chronic myelogenous leukemia. Cancer Cell. 2012;21(4):
6 6
7 7
8 8
9 9
10 10
11 11
12 12
13 13
14 14
15 15
16 16
17 17
Supplementary. Table 1: Oligonucleotides and Plasmids. complementary to positions from 77 of the SRα '- GCT CTA GAG AAC TTG AAG TAC AGA CTG C
Supplementary Table 1: Oligonucleotides and Plasmids 913954 5'- GCT CTA GAG AAC TTG AAG TAC AGA CTG C 913955 5'- CCC AAG CTT ACA GTG TGG CCA TTC TGC TG 223396 5'- CGA CGC GTA CAG TGT GGC CAT TCT GCT G
More informationSupplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
More informationSupporting Information
Supporting Information Transfection of DNA Cages into Mammalian Cells Email: a.turberfield@physics.ox.ac.uk Table of Contents Supporting Figure 1 DNA tetrahedra used in transfection experiments 2 Supporting
More informationhcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+
ApoE+/+ ApoE-/- ApoE-/- H&E (1x) Supplementary Figure 1. No obvious pathology is observed in the colon of diseased ApoE-/me. Colon samples were fixed in 1% formalin and laid out in Swiss rolls for paraffin
More informationPCR analysis was performed to show the presence and the integrity of the var1csa and var-
Supplementary information: Methods: Table S1: Primer Name Nucleotide sequence (5-3 ) DBL3-F tcc ccg cgg agt gaa aca tca tgt gac tg DBL3-R gac tag ttt ctt tca ata aat cac tcg c DBL5-F cgc cct agg tgc ttc
More informationFigure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis
1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons
More informationSupplementary Figure 1A A404 Cells +/- Retinoic Acid
Supplementary Figure 1A A44 Cells +/- Retinoic Acid 1 1 H3 Lys4 di-methylation SM-actin VEC cfos (-) RA (+) RA 14 1 1 8 6 4 H3 Lys79 di-methylation SM-actin VEC cfos (-) RA (+) RA Supplementary Figure
More informationHes6. PPARα. PPARγ HNF4 CD36
SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa
More informationSupplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC
Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC
More informationSupplemental Information. Human Senataxin Resolves RNA/DNA Hybrids. Formed at Transcriptional Pause Sites. to Promote Xrn2-Dependent Termination
Supplemental Information Molecular Cell, Volume 42 Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination Konstantina Skourti-Stathaki, Nicholas
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
More informationAdd 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
More informationLecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR
Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1 Characterization of GSCs. a. Immunostaining of primary GSC spheres from GSC lines. Nestin (neural progenitor marker, red), TLX (green). Merged images of nestin,
More informationPGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells
Supplementary Information for: PGRP negatively regulates NOD-mediated cytokine production in rainbow trout liver cells Ju Hye Jang 1, Hyun Kim 2, Mi Jung Jang 2, Ju Hyun Cho 1,2,* 1 Research Institute
More informationAnti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR
Supplementary Methods Antibodies Anti-Pim-1 (Cat#3247), anti-met (Cat#3127), anti-ron (Cat#2654), Anti-EGFR (Cat#2646), anti-igf1r (Cat#3018), anti-insr (Cat#3020), anti-akt (pan, Cat#4691), anti-phospho-akt
More informationConverting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system
Converting rabbit hybridoma into recombinant antibodies with effective transient production in an optimized human expression system Dr. Tim Welsink Molecular Biology Transient Gene Expression OUTLINE Short
More informationMaterials Protein synthesis kit. This kit consists of 24 amino acids, 24 transfer RNAs, four messenger RNAs and one ribosome (see below).
Protein Synthesis Instructions The purpose of today s lab is to: Understand how a cell manufactures proteins from amino acids, using information stored in the genetic code. Assemble models of four very
More informationSupplemental Information. Andrianne, Assabban et al.
Supplemental Information. Andrianne, Assabban et al. Figure S1. Related to Figure 1. Sensitivity of Zfp36 -/- mice to Imiquimod treatment following different experimental protocols. Zfp36-deficient mice
More informationArabidopsis actin depolymerizing factor AtADF4 mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB
Arabidopsis actin depolymerizing factor mediates defense signal transduction triggered by the Pseudomonas syringae effector AvrPphB Files in this Data Supplement: Supplemental Table S1 Supplemental Table
More informationSupplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana
Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction
More informationSupporting information for Biochemistry, 1995, 34(34), , DOI: /bi00034a013
Supporting information for Biochemistry, 1995, 34(34), 10807 10815, DOI: 10.1021/bi00034a013 LESNIK 10807-1081 Terms & Conditions Electronic Supporting Information files are available without a subscription
More informationSupplemental material
Supplemental material Diversity of O-antigen repeat-unit structures can account for the substantial sequence variation of Wzx translocases Yaoqin Hong and Peter R. Reeves School of Molecular Bioscience,
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic
More informationSupplemental Table 1. Primers used for PCR.
Supplemental Table 1. Primers used for PCR. Gene Type Primer Sequence Genotyping and semi-quantitative RT-PCR F 5 -TTG CCC GAT CAC CAT CTG TA-3 rwa1-1 R 5 -TGT AGC GAT CAA GGC CTG ATC TAA-3 LB 5 -TAG CAT
More informationDierks Supplementary Fig. S1
Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F
More informationOverexpression Normal expression Overexpression Normal expression. 26 (21.1%) N (%) P-value a N (%)
SUPPLEMENTARY TABLES Table S1. Alteration of ZNF322A protein expression levels in relation to clinicopathological parameters in 123 Asian and 74 Caucasian lung cancer patients. Asian patients Caucasian
More informationSupplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURB
Supplementary Methods Quantitative RT-PCR. For mrna, total RNA was prepared using TRIzol reagent (Invitrogen) and genomic DNA was eliminated with TURBO DNA-free Kit (Ambion). One µg of total RNA was reverse
More informationMayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama
Immunity, Volume 38 Supplemental Information Inflammatory Monocytes Recruited to Allergic Skin Acquire an Anti-inflammatory M2 Phenotype via Basophil-Derived Interleukin-4 Mayumi Egawa, Kaori Mukai, Soichiro
More informationY-chromosomal haplogroup typing Using SBE reaction
Schematic of multiplex PCR followed by SBE reaction Multiplex PCR Exo SAP purification SBE reaction 5 A 3 ddatp ddgtp 3 T 5 A G 3 T 5 3 5 G C 5 3 3 C 5 ddttp ddctp 5 T 3 T C 3 A 5 3 A 5 5 C 3 3 G 5 3 G
More informationLewis x/cd15 expression in human myeloid cell differentiation. is regulated by sialidase activity
Lewis x/cd15 expression in human myeloid cell differentiation is regulated by sialidase activity Samah Zeineb Gadhoum 1, 2 and Robert Sackstein* 1, 2, 3, 4 From the Departments of Dermatology 1 and Medicine
More informationSupporting Information
Supporting Information Table S1. Oligonucleotide sequences used in this work Oligo DNA A B C D CpG-A CpG-B CpG-C CpG-D Sequence 5 ACA TTC CTA AGT CTG AAA CAT TAC AGC TTG CTA CAC GAG AAG AGC CGC CAT AGT
More informationDisease and selection in the human genome 3
Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression
More information* Correspondence: Ralf Dressel: 1 Supplementary Figures and Tables. - Supplementary Tables 1 to 3. - Supplementary Figures 1 to 6
s Efficient killing of murine pluripotent stem cells by natural killer (NK) cells requires activation by cytokines and partly depends on the activating NK receptor NKG2D Carina Gröschel, Daniela Hübscher,
More informationFigure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining.
Supplementary information Supplementary figures Figure S1. Purity of primary cultures of renal proximal tubular epithelial culture ascertained by cytokeratin staining. Figure S2. Induction of Nur77 in
More informationSupplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR
Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC
More informationΔPDD1 x ΔPDD1. ΔPDD1 x wild type. 70 kd Pdd1. Pdd3
Supplemental Fig. S1 ΔPDD1 x wild type ΔPDD1 x ΔPDD1 70 kd Pdd1 50 kd 37 kd Pdd3 Supplemental Fig. S1. ΔPDD1 strains express no detectable Pdd1 protein. Western blot analysis of whole-protein extracts
More informationLegends for supplementary figures 1-3
High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology Sidsel Nag 1,2 *, Marlene D. Dalgaard 3, Poul-Erik
More informationRPA-AB RPA-C Supplemental Figure S1: SDS-PAGE stained with Coomassie Blue after protein purification.
RPA-AB RPA-C (a) (b) (c) (d) (e) (f) Supplemental Figure S: SDS-PAGE stained with Coomassie Blue after protein purification. (a) RPA; (b) RPA-AB; (c) RPA-CDE; (d) RPA-CDE core; (e) RPA-DE; and (f) RPA-C
More informationORFs and genes. Please sit in row K or forward
ORFs and genes Please sit in row K or forward https://www.flickr.com/photos/teseum/3231682806/in/photostream/ Question: why do some strains of Vibrio cause cholera and others don t? Methods Mechanisms
More informationSupplementary Information. Construction of Lasso Peptide Fusion Proteins
Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and
More informationSupplemental methods Supplemental figure and legend...7. Supplemental table.. 8
Supplemental Digital Content (SDC) Contents Supplemental methods..2-6 Supplemental figure and legend...7 Supplemental table.. 8 1 SDC, Supplemental Methods Flow cytometric analysis of intracellular phosphorylated
More informationSupplementary Information
Supplementary Information Microbead-based biomimetic synthetic neighbors enhance survival and function of rat pancreatic β-cells Wei Li, a Samuel Lee, b Minglin Ma, a, f Soo Min Kim, b Patrick Guye, c
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature11496 Cl. 8 Cl. E93 Rag1 -/- 3H9 + BM Rag1 -/- BM CD CD c-kit c-kit c-kit wt Spleen c-kit B22 B22 IgM IgM IgM Supplementary Figure 1. FACS analysis of single-cell-derived pre-b cell clones.
More informationGene synthesis by circular assembly amplification
Gene synthesis by circular assembly amplification Duhee Bang & George M Church Supplementary figures and text: Supplementary Figure 1. Dpo4 gene (1.05kb) construction by various methods. Supplementary
More informationCat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1
Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer
More informationII 0.95 DM2 (RPP1) DM3 (At3g61540) b
Table S2. F 2 Segregation Ratios at 16 C, Related to Figure 2 Cross n c Phenotype Model e 2 Locus A Locus B Normal F 1 -like Enhanced d Uk-1/Uk-3 149 64 36 49 DM2 (RPP1) DM1 (SSI4) a Bla-1/Hh-0 F 3 111
More informationAn engineered tryptophan zipper-type peptide as a molecular recognition scaffold
SUPPLEMENTARY MATERIAL An engineered tryptophan zipper-type peptide as a molecular recognition scaffold Zihao Cheng and Robert E. Campbell* Supplementary Methods Library construction for FRET-based screening
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature07182 SUPPLEMENTAL FIGURES AND TABLES Fig. S1. myf5-expressing cells give rise to brown fat depots and skeletal muscle (a) Perirenal BAT from control (cre negative) and myf5-cre:r26r3-yfp
More informationSupplemental Data. Bennett et al. (2010). Plant Cell /tpc
BRN1 ---------MSSSNGGVPPGFRFHPTDEELLHYYLKKKISYEKFEMEVIKEVDLNKIEPWDLQDRCKIGSTPQNEWYFFSHKDRKYPTGS 81 BRN2 --------MGSSSNGGVPPGFRFHPTDEELLHYYLKKKISYQKFEMEVIREVDLNKLEPWDLQERCKIGSTPQNEWYFFSHKDRKYPTGS 82 SMB
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/494/eaan6284/dc1 Supplementary Materials for Activation of master virulence regulator PhoP in acidic ph requires the Salmonella-specific protein UgtL Jeongjoon
More informationSupporting Online Information
Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical
More informationBD IMag. Streptavidin Particles Plus - DM. Technical Data Sheet. Product Information
Technical Data Sheet Streptavidin Particles Plus - DM Product Information Material Number: Size: Storage Buffer: 557812 5 ml Aqueous buffered solution containing BSA and 0.09% sodium azide. Description
More informationSUPPLEMENTARY INFORMATION. Material and methods
SUPPLEMENTARY INFORMATION Material and methods Cell culture Human hepatocellular carcinoma (HepG) cells and human embryonic kidney (HEK)93 cells were grown in Dulbecco s modified Eagle s medium (Invitrogen
More informationSUPPORTING INFORMATION FILE
Intrinsic and extrinsic connections of Tet3 dioxygenase with CXXC zinc finger modules Nan Liu, Mengxi Wang, Wen Deng, Christine S. Schmidt, Weihua Qin, Heinrich Leonhardt and Fabio Spada Department of
More informationFlow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).
Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant
More informationDNA aptamer to c-met inhibits cancer cell migration
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information For DNA aptamer to c-met inhibits cancer cell migration Ryosuke
More informationHuman skin punch biopsies were obtained under informed consent from normal healthy
SUPPLEMENTAL METHODS Acquisition of human skin specimens. Human skin punch biopsies were obtained under informed consent from normal healthy volunteers (n = 30) and psoriasis patients (n = 45) under a
More informationNongenetic Reprogramming of the Ligand Specificity. of Growth Factor Receptors by Bispecific DNA Aptamers
Supporting Information For Nongenetic Reprogramming of the Ligand Specificity of Growth Factor Receptors by Bispecific DNA Aptamers Ryosuke Ueki,* Saki Atsuta, Ayaka Ueki and Shinsuke Sando* Department
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Coding and noncoding transcription at the vg locus. (a,b) qpcr analysis of developmental and tissue-specific vg mrna (a) and PRE/TRE (b) transcription, shown as percentage of TBP
More informationstrain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular
Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain
More informationTotal RNA was extracted from ESCs or wild-type MEF using an RNeasy Plus mini kit
Supplementary information, Data S1 Materials and methods RNA-seq Total RNA was extracted from ESCs or wild-type MEF using an RNeasy Plus mini kit (Qiagen). Poly A+ RNA was purified from the total RNA and
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
More informationSUPPLEMENTARY INFORMATION
1. RNA/DNA sequences used in this study 2. Height and stiffness measurements on hybridized molecules 3. Stiffness maps at varying concentrations of target DNA 4. Stiffness measurements on RNA/DNA hybrids.
More informationWelcome to More Choice. Mouse Panels
Welcome to More Choice Mouse Panels Choose from our extensive portfolio of high-quality fluorescent-conjugated reagents to build your multicolor flow cytometry panels. Welcome to a More Colorful World
More informationSupplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the
Supplementary Fig. 1. Isolation and in vitro expansion of EpCAM + cholangiocytes. For collagenase perfusion, enzyme solution was injected from the portal vein for digesting adult livers, whereas it was
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Investigation of the Biosynthesis of the Lasso Peptide Chaxapeptin Using an E. coli-based Production System Helena Martin-Gómez, Uwe Linne, Fernando Albericio, Judit Tulla-Puche,*
More informationA Genetically Encoded Toolbox for Glycocalyx Engineering: Tunable Control of Cell Adhesion,
TITLE A Genetically Encoded Toolbox for Glycocalyx Engineering: Tunable Control of Cell Adhesion, Survival, and Cancer Cell Behaviors AUTHORS Carolyn R. Shurer *, Marshall J. Colville *, Vivek K. Gupta,
More informationQuantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were
1 Supplemental methods 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 21 22 23 Quantitative reverse-transcription PCR. Transcript levels of flgs, flgr, flia and flha were monitored by quantitative reverse-transcription
More information-15 diopter negative lenses in wild-type and homozygous CHRM2-deleted mice, and
Supplementary Materials Supplementary Figure 1: Myopia induction was performed using uniocular -10 and -15 diopter negative lenses in wild-type and homozygous CHRM2-deleted mice, and results at 2, 4 and
More informationOnline Data Supplement
Persistence of Rhinovirus Infection of Lower Airways in Patients with Bronchial Asthma Monika Wo, Marek Sanak, Jerzy Soja, Henryk Olechnowicz,William W. Busse, Andrew Szczeklik Online Data Supplement 39
More informationPILRα Is a Herpes Simplex Virus-1 Entry Coreceptor That Associates with Glycoprotein B
Satoh et al. Page S1 Cell, Volume 132 PILRα Is a Herpes Simplex Virus-1 Entry Coreceptor That Associates with Glycoprotein B Takeshi Satoh, Jun Arii, Tadahiro Suenaga, Jing Wang, Amane Kogure, Junji Uehori,
More informationSupporting Information
Supporting Information Barderas et al. 10.1073/pnas.0801221105 SI Text: Docking of gastrin to Constructed scfv Models Interactive predocking of the 4-WL-5 motif into the central pocket observed in the
More informationTable S1. Antibodies and recombinant proteins used in this study
Table S1. Antibodies and recombinant proteins used in this study Labeled Antibody Clone Cat. no. Streptavidin-PerCP BD Biosciences 554064 Biotin anti-mouse CD25 7D4 BD Biosciences 553070 PE anti-mouse
More informationSupplemental Information. Target-Mediated Protection of Endogenous. MicroRNAs in C. elegans. Inventory of Supplementary Information
Developmental Cell, Volume 20 Supplemental Information Target-Mediated Protection of Endogenous MicroRNAs in C. elegans Saibal Chatterjee, Monika Fasler, Ingo Büssing, and Helge Großhans Inventory of Supplementary
More informationSupplemental Material S1, Zhang et al. (2009)
Supplemental Material S1, Zhang et al. (2009) Cloning of PS small RNA fragments. PS RNA labeled with [γ 32 P]-ATP (NEN) of a length from 30 to 90 nucleotides were isolated from the gel after denaturing
More informationTable S1. Bacterial strains (Related to Results and Experimental Procedures)
Table S1. Bacterial strains (Related to Results and Experimental Procedures) Strain number Relevant genotype Source or reference 1045 AB1157 Graham Walker (Donnelly and Walker, 1989) 2458 3084 (MG1655)
More informationNAME:... MODEL ANSWER... STUDENT NUMBER:... Maximum marks: 50. Internal Examiner: Hugh Murrell, Computer Science, UKZN
COMP710, Bioinformatics with Julia, Test One, Thursday the 20 th of April, 2017, 09h30-11h30 1 NAME:...... MODEL ANSWER... STUDENT NUMBER:...... Maximum marks: 50 Internal Examiner: Hugh Murrell, Computer
More informationSupporting Information
Supporting Information Sen et al. 10.1073/pnas.1114232109 SI Materials and Methods Cell Culture. Human embryonic lung fibroblasts (HELF) were maintained in Eagle s minimum essential medium (Mediatech)
More informationevaluated with UAS CLB eliciting UAS CIT -N Libraries increase in the
Supplementary Figures Supplementary Figure 1: Promoter scaffold library assemblies. Many ensembless of libraries were evaluated in this work. As a legend, the box outline color in top half of the figure
More informationTable S1. Sequences of mutagenesis primers used to create altered rdpa- and sdpa genes
Supplementary Table and Figures for Structural Basis for the Enantiospecificities of R- and S-Specific Phenoxypropionate/α-Ketoglutarate Dioxygenases by Tina A. Müller, Maria I. Zavodszky, Michael Feig,
More informationSadaf Haghiri PhD student at Environmental engineering faculty Middle East Technical University. Supervisor: Assoc. Prof. Dr.
Sadaf Haghiri PhD student at Environmental engineering faculty Middle East Technical University Supervisor: Assoc. Prof. Dr. Bülent İçgen October 2016 2 Outline Intoduction Motivation for this research
More informationfor Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides
Supporting Information Design of α-transglucosidases of Controlled Specificity for Programmed Chemo-enzymatic Synthesis of Antigenic Oligosaccharides Elise Champion ±,,,, Isabelle André ±,,, Claire Moulis
More informationDynamic enhancer-gene body contacts during transcription elongation
Dynamic enhancer-gene body contacts during transcription elongation Kiwon Lee, Chris C.-S. Hsiung,, Peng Huang, Arjun Raj, *, and Gerd A. Blobel Division of Hematology, The Children s Hospital of Philadelphia,
More informationDNA Computing Circuits Using Libraries of. DNAzyme Subunits
SUPPLEMENTARY INFORMATION Supplementary Information for the paper: DNA Computing Circuits Using Libraries of DNAzyme Subunits Johann Elbaz a, Oleg lioubashevski a, Fuan Wang a, Françoise Remacle b, Raphael
More informationSupplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of
Supplementary Figure 1. Localization of MST1 in RPE cells. Proliferating or ciliated HA- MST1 expressing RPE cells (see Fig. 5b for establishment of the cell line) were immunostained for HA, acetylated
More informationOccurrence of viruses in apple and pear orchards in Latvia.
INTERNATIONAL SCIENTIFIC CONFERENCE Sustainable Fruit Growing: From Plant to Product Occurrence of viruses in apple and pear orchards in Latvia. Neda P pola, Anna K le, Inga Moro ko Bi evska. The economically
More informationFig. S1: Nkx2.2 is specifically deleted in the intestinal epithelium.
Fig. S1: Nkx2.2 is specifically deleted in the intestinal epithelium. PCR of representative tissues with oligonucleotides to identify recombination of the Nkx2.2flox allele. Nkx2.2 is specifically deleted
More informationSUPPLEMENTARY MATERIALS AND METHODS. E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1)
SUPPLEMENTARY MATERIALS AND METHODS E. coli strains, plasmids, and growth conditions. Escherichia coli strain P90C (1) dinb::kan (lab stock) derivative was used as wild-type. MG1655 alka tag dinb (2) is
More informationHomework. A bit about the nature of the atoms of interest. Project. The role of electronega<vity
Homework Why cited articles are especially useful. citeulike science citation index When cutting and pasting less is more. Project Your protein: I will mail these out this weekend If you haven t gotten
More informationSupplemental Data. Jones et al. Plant Cell. (2010) /tpc
IAA synthesis rate Supplemental Data. Jones et al. Plant Cell. ()..5/tpc..7856 Supplemental Figure. Root tip specific IAA biosynthesis after induction of the CKX gene. 6 DAG pmdc7:atckx seedling roots
More informationvirus middle T oncoprotein (PyMT) under the Mouse Mammary Tumor Virus (MMTV)
Supplementary Methods Animals HIF-1α fl/fl LysM-Cre and control mice were crossed with mice expressing the polyoma virus middle T oncoprotein (PyMT) under the Mouse Mammary Tumor Virus (MMTV) promoter,
More informationNESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples
NESTED Sequence-based Typing (SBT) protocol for epidemiological typing of Legionella pneumophila directly from clinical samples VERSION 2.0 SUMMARY This procedure describes the use of nested Sequence-Based
More informationMacBlunt PCR Cloning Kit Manual
MacBlunt PCR Cloning Kit Manual Shipping and Storage MacBlunt PCR Cloning Kits are shipped on dry ice. Each kit contains a box with cloning reagents and an attached bag with Eco-Blue Competent Cells (optional).
More informationSupplementary Figure 1. The level of pri-mir-8 gradually decreases while those of BR-C and E74 increase during 3rd instar larval development.
qrt-pcr RT-PCR Relative pri-mir-8 level 1.2 1.0 0.8 0.6 0.4 0.2 0.0 Early 3rd (72h) Mid 3rd (96h) Late 3rd (119h) BR-C E74 mtl rrna Early 3rd (72h) Mid 3rd (96h) Late 3rd (119h) Supplementary Figure 1.
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Multiplexed Detection of Lung Cancer Cells at the Single-Molecule
More informationLecture 11: Gene Prediction
Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are
More informationA green method of staining DNA in polyacrylamide gel electrophoresis based on fluorescent copper nanoclusters synthesized in situ
Electronic Supplementary Material A green method of staining DNA in polyacrylamide gel electrophoresis based on fluorescent copper nanoclusters synthesized in situ Xiaoli Zhu 1, Hai Shi 1, Yalan Shen 1,
More informationSolid-phase PCR in a picowell array for immobilizing and arraying 100,000 PCR products to a microscope slide
Solid-phase PCR in a picowell array for immobilizing and arraying 100,000 PCR products to a microscope slide Jochen Hoffmann a,b, Martin Trotter a, Felix von Stetten a,b, Roland Zengerle, a,b,c Günter
More informationSearch for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers
DNA Research 9, 163 171 (2002) Search for and Analysis of Single Nucleotide Polymorphisms (SNPs) in Rice (Oryza sativa, Oryza rufipogon) and Establishment of SNP Markers Shinobu Nasu, Junko Suzuki, Rieko
More information